Abstract
Objective: To investigate the correlation between growth differentiation factor 15 (GDF 15) + 157 A/T polymorphism and the formation of collateral circulation in acute non-ST segment elevated myocardial infarction in Han population of Shandong province. Method: The medical records of 200 cases of patients undergoing selective coronary angiography were analyzed, and the arterial blood specimens of included patients were collected before coronary angiography. Based on the results of coronary angiography, patients were divided into acute myocardial infarction (AMI) group and normal control group; AMI group was divided into collateral group and non-collateral group by Rentrop’s grading method; polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing methods were used to analyze the GDF 15 + 157 A/T polymorphism in the two groups. Results: There were statistically significant differences in GDF 15 + 157 A/T AA and AT distribution between AMI group and the control group (P = 0.002); and there was statistically significant difference in allele frequencies between the two groups (P = 0.006); for AMI group, there were statistically significant differences in GDFAA and AT genotype distribution between patients with and without collateral (P = 0.014), and there was statistically significant difference in allele frequencies between the two (P = 0.025). Conclusion: There was correlation between GDF 15 + 157 A/T polymorphism and the formation of collateral circulation in patients with non-ST-segment elevated myocardial infarction.
Keywords: Acute myocardial infarction, GDF 15, Gene polymorphism, SNPs, PCR-RFLP, Collateral circulation
Introduction
In acute non-ST-segment elevated myocardial infarction, coronary thrombosis and branch vessel blockage occurred, resulting in myocardial necrosis in the corresponding region dominated by the clogged blood vessels. Early and timely construction of collateral circulation plays an important role in regulating the infarct size. This re-establishment of collateral circulation can ensure the early myocardial activity in the corresponding region dominated by clogged blood vessels, protect the heart function, and improve the clinical outcome of patients [1-3]. The factors promoting the formation of collateral circulation in patients with acute myocardial infarction (AMI) have become a hot research spot in medical field.
Growth differentiation factor 15 (GDF 15) belongs to GDFs family, which is a member of the transforming growth factor β superfamily [4]; Previous study indicated that GDF 15-3148 loci polymorphism had a close relationship with collateral circulation in acute myocardial infarction [5,6]. However, + 157 A/T loci polymorphism in GDF gene was not observed. This paper aims to explore the correlation between + 157 A/T polymorphism and the collateral circulation in patients with acute non-ST segment elevated myocardial infarction.
Materials and methods
Subjects
Inclusion criteria
From the beginning of January 2014, we selected 126 patients diagnosed AMI by coronary angiography in cardiac catheterization laboratory of Xiangya Hospital, Central South University. At the same time patients with chest pain but with normal coronary angiography were enrolled in the control group (n = 74). They all signed the informed consent and took arterial blood samples at the same time while performing coronary angiography.
Exclusion criteria
We excluded the patients with clinical manifestations of acute and chronic inflammatory disease, or with cancer, valvular disease; cardiomyopathy disease, severe kidney disease (serum creatinine was greater than 2.5 mg/dL), severe liver disease, blood diseases, neoplastic diseases and other heart disease.
Methods
Coronary angiography
Selective coronary angiography was performed according to Judkins method. More than 50% luminal diameter stenosis in any major coronary arteries (left main, left anterior descending artery, right coronary artery, circumflex artery, the main diagonal branch or obtuse marginal branch) was defined as significant coronary artery stenosis.
Collateral evaluation
Rentrop’s classification system was used to evaluate the collateral circulation. Grade 0: no collateral vascular perfusion; grade 1: visible collateral vessels, but no contrast agent perfusion; grade 2: visible collateral vessels and partial epicardial artery perfusion; grade 3: visible collateral vessels, complete epicardial artery perfusion.
Grouping
The arterial blood specimens of included patients were collected before coronary angiography. According to the Rentrop’s classification method, the AMI group was divided into two subgroups: Rentrop’s grade 0 was included in non-collateral group; Rentrop’s grades 1-3 were taken as collateral group.
DNA extraction
3 mL fasting blood was collected with anticoagulant tubes containing EDTANa2; after well mixing, genomic DNA extraction was performed with whole blood genomic DNA extraction kit (Beijing Fiesole Technology Co.).
Primers design and synthesis
Relevant literature [5] was reviewed for primer design; primers were synthesized by Shanghai Sangon Biological Technology Co., Ltd. Upstream: 5’GGCTGCTTGGGGGGTGGGAG3’; Downstream: 5’GCAAGTTTCTCGGGACCCTCAGAGTTGTAC3’.
Genotyping
We utilized PCR-RFLP technique to genotype the + 157 A/T locus. A total of 30 μL of the mixture was used for amplification and the PCR conditions for β-Fg-455G/A were: pre-denaturation at 95°C for 5 minutes; 35 cycles of denaturation at 95°C for 50 seconds, annealing at 58.2°C for 45 seconds and extension at 72°C for 60 seconds; and a final extension at 72°C for 7 minutes. Reaction was terminated by cooling to 4°C. Then, 6 μL of products were separated by 1.5% agarose gel electrophoresis (100 V) for 20 minutes and visualized with ethidium bromide staining.
PCR products were digested for 12 h; the reaction system was as follows: PCR product 8.75 μL, 10 × Buffer 1 μL, endonuclease (BsrI enzyme) 0.25 μL; the total volume was 10 μL.
Statistical analysis
SPSS 19.0 statistical software was used for statistical analysis. Measurement data were presented as mean ± standard deviation (Mean ± SD) and compared by t test; whether genotype distribution meets Hardy Weinberg genetic equilibrium law, inter-group gene frequencies and alleles were compared using χ2 test. P < 0.05 was considered statistically significant.
Results
General information
No statistically significant differences had been found in age, sex, smoking history, hyperlipidemia, hypertension, diabetes, and family history between acute myocardial infarction and control groups (P > 0.05); there was no statistically significant difference in baseline data between collateral group and non-collateral group (P > 0.05), shown in Table 1.
Table 1.
The characteristics of participants
| Indices | AMI (n = 126) | Control group (n = 74) | P values | |
|---|---|---|---|---|
|
| ||||
| Collateral circulation (n = 90) | NO-collateral circulation (n = 36) | |||
| Age (Years) | 58.3 ± 12.3 | 58.9 ± 11.4 | 59.3 ± 12.5 | 0.987 |
| Sex (M/F) | 61/29 | 25/11 | 48/26 | 0.265 |
| Smoking (Y/N) | 49/41 | 21/15 | 40/34 | 0.132 |
| Hypertension | 51/39 | 22/14 | 42/32 | 0.134 |
| Diabetes | 42/48 | 17/19 | 30/44 | 0.665 |
| Hyperlipidemia | 55/35 | 24/12 | 50/24 | 0.194 |
| Family history of CHD | 33/57 | 11/25 | 20/54 | 0.119 |
Hardy Weinberg genetic equilibrium
The genotype distribution of GDF + 157 A/T locus in both groups were in line with the law of Hardy Weinberg genetic equilibrium (P > 0.05), with a group representative.
GDF 15 gene + 157 A/T locus genotype frequencies and allele frequencies
As shown in Table 2, between the two groups there was statistically significant difference in + 157 A/T locus genotype frequency (P = 0.002); and there was statistically significant difference in allele frequencies (P = 0.006).
Table 2.
Comparison of genotype frequency and allele frequency of GDF + 157 A/T locus between the control and AMI groups
| Groups | n | Genotype | Allele | ||
|---|---|---|---|---|---|
|
|
|||||
| AA | AT | A | T | ||
| AMI group | 126 | 102 (81.0) | 24 (19.0) | 228 (90.5) | 24 (9.5) |
| Control group | 74 | 45 (60.8) | 29 (39.2) | 119(80.4) | 29 (19.6) |
| P values | 0.002 | 0.006 | |||
| OR (95% CI) | 2.738 (1.437-5.218) | 2.315 (1.290-4.153) | |||
GDF 15 gene + 157 A/T locus genotype frequencies and allele frequencies in non-collateral circulation group and collateral circulation group
As shown in Table 3, there was statistically significant difference in + 157 A/T genotype frequencies between the two groups (P = 0.014); and there was statistically significant difference in allele frequencies (P = 0.025). For the genotype distribution, + 157 A/T AT genotype had a trend to significantly promote the formation of collateral circulation in patients with AMI.
Table 3.
Comparison of gene frequency and allele frequency of GDF 15 gene + 157 A/T locus between the collateral circulation group and the no-collateral circulation group
| Groups | n | Genotype | Allele | ||
|---|---|---|---|---|---|
|
|
|||||
| AA | AT | A | T | ||
| Collateral circulation group | 90 | 70 (77.8) | 20 (22.2) | 160 (88.9) | 20 (11.1) |
| No-collateral circulation group | 36 | 20 (55.6) | 16 (45.4) | 56 (77.8) | 16 (22.2) |
| P values | 0.014 | 0.025 | |||
| OR (95% CI) | 2.800 (1.228-6.344) | 2.285 (1.107-4.716) | |||
Multivariable logistic regression analyses for the relation between GDF 15 gene + 157 A-/-T polymorphism
As shown in Table 4, we found GDF 15 gene + 157 A-/-T polymorphism was independently related to the formation of collateral circulation in patients with non-ST-segment elevated myocardial infarction, after adjustments of other traditional risk factors, such as smoking, hypertension, diabetes, hyperlipidemia and family history of CHD.
Table 4.
Multivariable logistic regression result
| Variables | B | SE | P value | OR (95.0% CI) |
|---|---|---|---|---|
| GDF + 157 A/T locus | 0.231 | 0.087 | 0.028 | 1.562 (1.109-3.872) |
| Smoking | 0.2221 | 0.315 | 0.521 | 1.321 (0.430-2.699) |
| Age | 0.152 | 0.216 | 0.101 | 1.054 (1.021-1.087) |
| Sex | 0.723 | 0.313 | 0.323 | 1.024 (0.963-3.217) |
| Hypertension | 0.200 | 0.419 | 0.519 | 1.209 (0.776-3.127) |
| Diabetes | 0.201 | 0.320 | 0.187 | 1.029 (0.910-3.374) |
| Hyperlipidemia | 0.042 | 0.106 | 0.098 | 1.051 (1.112-2.087) |
| Family history of CHD | 0.554 | 0.312 | 0.121 | 1.067 (0.967-3.217) |
Discussion
Collateral circulation is the non-capillary anatomical connection between different parts of the same blood vessel and between different coronary arteries [7]. When the existing cardiac coronary is unable to provide adequate blood flow, collateral circulation is a potentially important source of supply for vessels [8]. Growth differentiation factor 15 is mainly involved in regulating many cell functions and biological processes, such as multiple organ growth, differentiation and tissue repair [9]. Recent studies have found that GDF 15 not only has the above biological function, but also is involved in the development and progression of cardiovascular disease [10-11]. In 2002, Brown et al [12] reported that serum protein level of GDF 15 was an independent risk factor for women suffering from atherosclerosis and other cardiovascular events, and firstly linked GDF 15 with cardiovascular disease. To clarify the correlation between GDF 15 gene polymorphism and the formation of collateral circulation in patients with non-ST segment elevated myocardial infarction (NSTEMI), patients with NSTEMI and individuals with normal coronary angiography were taken as the subjects. Two genotypes of + 157 A/T locus, AA and AT, were found both in the acute myocardial infarction group and the control group; the statistics showed that there were statistically significant differences in the two genotypes between AMI group and control group (P < 0.05); and AT genotype may be a risk factor of acute myocardial infarction; the risk of AMI in people with AT genotype could be increased by 2.73 times. At the same time, the possibility of the existence of collateral circulation in patients with AMI carrying AT genotype could be increased by 2.8 times. However, in this study, there were no statistically significant differences in + 157 A/T allele frequency; this may be due to that the sample size of this study was small. Therefore, the sample size should be increased for further study.
GDF 15 + 157 A/T polymorphism had a certain correlation with the formation of collateral circulation in non-ST-segment elevated acute myocardial infarction. AT genotype may be associated with the prevalence of acute myocardial infarction, and the possibility of collateral circulation in patients with AMI carrying AT genotype was large, so it can be used as a biological indicator for the prediction of myocardial infarction. After adjusting of other traditional risk factors, GDF 15 gene + 157 A-/-T polymorphism was independently related to the formation of collateral circulation in patients with non-ST-segment elevated myocardial infarction. But the sample size was small, with some limitations, so it may not truly reflect the correlation between the polymorphism and the formation of collateral circulation in acute non-ST segment elevated myocardial infarction, which still needs to be further verified by expanding the sample size.
Acknowledgements
This work supported by Shandong Province Medical and Health Science and Technology Development Projects (2013WS0107).
Disclosure of conflict of interest
None.
References
- 1.Wang J, Xiang B, Lin HY, Liu HY, Freed D, Arora RC, Tian GH. Collateral circulation formation determines the characteristic profiles of contrast-enhanced MRI in the infarcted myocardium of pigs. Acta Pharmacol Sin. 2015;36:463–472. doi: 10.1038/aps.2014.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Jang WJ, Yang JH, Choi SH, Song YB, Hahn JY, Choi JH, Kim WS, Lee YT, Gwon HC. Long-term survival benefit of revascularization compared with medical therapy in patients with coronary chronic total occlusion and well-developed collateral circulation. JACC Cardiovasc Interv. 2015;8:271–279. doi: 10.1016/j.jcin.2014.10.010. [DOI] [PubMed] [Google Scholar]
- 3.Iaitskiĭ NA, Zverev OG, Volkov AB, Voĭnov AV, Abdulragimov RI. Coronary collateral circulation in infarction-related artery in patients with acute myocardial infarction with rise and without rise of ST segment. Vestn Khir Im I I Grek. 2014;173:66–68. [PubMed] [Google Scholar]
- 4.Altena R, Fehrmann RS, Boer H, de Vries EG, Meijer C, Gietema JA. Growth differentiation factor 15 (GDF-15) plasma levels increase during bleomycin- and cisplatin-based treatment of testicular cancer patients and relate to endothelial damage. PLoS One. 2015;10:e0115372. doi: 10.1371/journal.pone.0115372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chen Z, Xie F, Ma G, Feng Y, Qian Q, Liu N. Study of the association between growth differentiation factor 15 gene polymorphism and coronary artery disease in a Chinese population. Mol Biol Rep. 2011;38:5085–5091. doi: 10.1007/s11033-010-0655-4. [DOI] [PubMed] [Google Scholar]
- 6.Ärlestig L, Rantapää-Dahlqvist S. Polymorphisms of the genes encoding CD40 and growth differentiation factor 15 and in the 9p21.3 region in patients with rheumatoid arthritis and cardiovascular disease. J Rheumatol. 2012;39:939–945. doi: 10.3899/jrheum.111336. [DOI] [PubMed] [Google Scholar]
- 7.van Lavieren MA, van de Hoef TP, Piek JJ. Coronary wedge pressure and collateral flow contribution: not a dichotomy! EuroIntervention. 2014;9:1485–1488. doi: 10.4244/EIJV9I12A250. [DOI] [PubMed] [Google Scholar]
- 8.Werner GS. The role of coronary collaterals in chronic total occlusions. Curr Cardiol Rev. 2014;10:57–64. doi: 10.2174/1573403X10666140311123814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Meier JC, Haendler B, Seidel H, Groth P, Adams R, Ziegelbauer K, Kreft B, Beckmann G, Sommer A, Kopitz C. Knockdown of platinum-induced growth differentiation factor 15 abrogates p27-mediated tumor growth delay in the chemoresistant ovarian cancer model A2780cis. Cancer Med. 2015;4:253–267. doi: 10.1002/cam4.354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hong JH, Chung HK, Park HY, Joung KH, Lee JH, Jung JG, Kim KS, Kim HJ, Ku BJ, Shong M. GDF15 Is a Novel Biomarker for Impaired Fasting Glucose. Diabetes Metab J. 2014;38:472–479. doi: 10.4093/dmj.2014.38.6.472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hinoi E. Regulation of osteoclastogenesis by osteocytes through growth differentiation factor-15. Yakugaku Zasshi. 2014;134:1259–1263. doi: 10.1248/yakushi.14-00209-4. [DOI] [PubMed] [Google Scholar]
- 12.Brown DA, Bauskin AR, Fairlie WD, Smith MD, Liu T, Xu N, Breit SN. Antibody-based approach to high-volume genotyping for MIC-1 polymorphism. Biotechniques. 2002;33:118–120. 122, 124 passim. doi: 10.2144/02331rr03. [DOI] [PubMed] [Google Scholar]