Abstract
AIM: To probe into the genetic susceptibility of HLA-DRB1 alleles to esophageal carcinoma in Han Chinese in Hubei Province.
METHODS: HLA-DRB1 allele polymorphisms were typed by polymerase chain reaction with sequence-specific primers (PCR-SSP) in 42 unrelated patients with esophageal cancer and 136 unrelated normal control subjects and the associated HLA-DRB1 allele was measured by nucleotide sequence analysis with PCR.SAS software was used in statistics.
RESULTS: Allele frequency (AF) of HLA-DRB1*0901 was significantly higher in esophageal carcinoma patients than that in the normal controls (0.2500 vs 0.1397, P = 0.028, the odds ratio 2.053, etiologic fraction 0.1282). After analyzed the allele nucleotide sequence of HLA-DRB1*0901 which approachs to the corresponded exon 2 sequence of the allele in genebank. There was no association between patients and controls in the rested HLA-DRB1 alleles.
CONCLUSION: HLA-DRB1*0901 allele is more common in the patients with esophageal carcinoma than in the healthy controls, which is positively associated with the patients of Hubei Han Chinese. Individuals carrying HLA-DRB1*0901 may be susceptible to esophageal carcinoma.
INTRODUCTION
The major histocompatibility complex (MHC) refers to as human leukocyte antigen (HLA). The loss of HLA antigens by neoplastic cells is considered important for tumor growth and metastasis[1-3]. Since tumor neoantigens on the surface of aberrant cells are recognized by T-cells only in the context of the HLA “self” antigens, loss of the HLA antigens may allow the tumors to escape immunosurveillance[4]. HLA system is a kind of genetic marker of human being, and the most complicated human genetic polymorphic system with hereditary features of haplotype inheritance and allele polymorphism and linkage disequilibrium. It played an important role in the event of antigen recongnition and presentation, immune response and modulation, destroying foreign antigen targeted cells. The alleles of the HLA system control a variety of immune functions and influence the susceptibility to more than 40 diseases, many of which have an autoimmune component[5-17], esophageal cancer is a complex, probably multifactorial disease[18-41]. Association of a particular HLA allele with a disease implies that the frequency of the allele is different in the patient population as compared with that of an ethnically matched control population. However, there has been no report on the association between HLA alleles and esophageal carcinoma.
In this study, we used polymerase chain reaction with sequence-specific primers (PCR-SSP) and DNA sequence analysis techniques on HLA-DRB1 alleles typing to investigate the genetic susceptibility of HLA allele polymorphisms in esophageal carcinoma of Hubei Han Chinese. This may be beneficial to the early prevention and surveillance,thus setting up gene therapy basis for esophageal carcinoma.
MATERIALS AND METHODS
Subjects
Included in our study were healthy controls and patients with esophageal carcinoma. The control group consists of one hundred and thirty-six unrelated donors or healthy individuals by physical examination, including 62 men and 74 women, ranging 22-48 years, in age, with a mean of 36 ± 6 years. The esophageal carcinoma group includes forty-two unrelated patients with esophageal squamous cell carcinoma, 35 men and 7 women, ranging in age 41-80 years,with a mean age of 60 ± 5 years,who were evaluated endoscopically and surgically. And all were tested by histopathology at Zhongnan Hospital of Wuhan University, between August 1998 and June 1999.
DNA extraction
Genomic DNA was isolated from leukocytes obtained from anticoagulated peripheral blood of patients and controls using the salting-out procedure[5,42,43], or QIAamp Blood Kit (QIAGEM GmbH, Germany) with which DNA was obtained through solid phase affinity columns.
HLA-DRB1 alleles PCR-SSP typing
For HLA-DRB1 “low solution” typing by PCR-SSP, 23 separate PCR reactions were performed for each sample. PCR-SSP typed system: each PCR reaction mixture contained 2-4 allele- or group-specific -DRB1 primers and the internal positive control primer pair. Allele sequence specific primers (2pmol), designed on the basis of published sequences[43-45], were used in multiple amplification reaction. HLA-DRB1 alleles PCR-SSP typed system consisted of 60 ng genomic DNA, 0.5 U Taq DNA polymerase (Ampli Taq® DNA polymerase, Roche Diagnostic System, Inc. USA), 20 μmol each deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), 10 mmol/L Tris-HCl pH8.3, 50 mmol·L-1 KCl (kalium chloride), 1.5 mmol·L-1 MgCl2 (magnesium chloride). PCR amplifications were carried out in PTC-100 thermal cycler (MJ Research, Inc, USA) according to the method of Olerup et al[5,42,43]. Initial denaturation was made at 94 °C for 5 min; with 30 cycles each consisting of denaturation at 94 °C for 30 s, annealing at 65 °C for 1 min and extension at 72 °C for 1 min. The HLA-DRB1 alleles typed vizualization of amplification was observed using medium resolution PCR-SSP products by 20 g·L-1 gels agarose(Boehringer Mannhein GmbH, Germany) electrophoresis. The gels were run for 20 min at 15 V·cm-1 in 0.5xTBE buffer and visualized using UV illumination and keeping file copies in computer.
Positive control, false negative allele
The most common form of individual PCR reaction failure is where random individual reactions fail to produce allele or control bands. This occurred on average in 1% of all PCR-SSP amplification. In each PCR reaction, a pair primers were included which specifically amplify the exon 2 of HLA-DRB1 alleles. These two primers matched non-allelic sequences and thus functioned as an internal positive amplification control. We used human growth hormone gene as a intra-positive control, in which primer[5] is 5’-primer, 21 mer, 5’GCCTTCCCAACCATTCCCTTA3’, Tm 64 °C; 3’-primer, 22 mer, 5’TCACGGATTTCTGTTGTGTTTC3’,terminal concentration 0.15 μmol·L-1,product 429 base pair (bp) fragment. Control failure is not a problem if the genotype obtained is heterozygous for all alleles and the type is unequivocal. Homozygous samples, in which the control failed, normally would require typing with a new DNA sample once again. Individual false negative allele amplifications where the control amplification worked but an expected allele was not amplified, did occur, the same be required repeated typing.
DNA sequence analysis of PCR-SSP products
Specific PCR-SSP products of amplification were obtained from agarose gels electrophoresis, then purified with glassmilk kit (Clontech Laboratories, Inc, USA) , and the base sequence was examined by PCR sequence analysis with ABI prism 310 (Perkin-Elmer, USA) with the addition of a terminal deoxytransferase extension step at the end of the chain termination reaction.
Statistical analysis
SAS (6.12 for Win), including χ2 analysis or Fisher’s Exact Test,was used to compare the allele frequency (AF) of HLA-DRB1 between the patients with esophageal carcinoma and the controls.
RESULTS
HLA-DRB1*0901 was present at increased frequency in patients with esophageal squamous cell carcinoma, 0.2500 vs 0.1397, P = 0.028, odds ratio 2.053, etiologic fraction 0.1282 (Table 1). The rested HLA-DRB1 alleles frequencies showed no significant difference in comparison between patients and the controls, i.e., there was positive association between HLA-DRB1*0901 and the patients of Hubei Hans. The HLA-DRB1*0901 nucleotide sequence, was analyzed in this study, approachs to the corresponded exon 2 of the allele sequence in genebank. Esophageal carcinoma was associated with HLA genotype: individuals carrying HLA-DRB1*0901 may be susceptibilitive to esophageal carcinoma in Hubei Hans.
Table 1.
HLA-DRB1 allels |
Control group |
Esophageal cancer group |
P | ||||
N1 | AF(n1 = 272) | PF(n2 = 136)% | N2 | AF(n1 = 84) | PF(n2 = 42)% | ||
0101-2 | 13 | 0.0478 | 9.5588 | 2 | 0.0238 | 4.7619 | > 0.05 |
0103 | 0 | 0.0000 | 0.0000 | 0 | 0.0000 | 0.0000 | |
150X | 46 | 0.1691 | 32.3529 | 9 | 0.1071 | 21.4286 | > 0.05 |
160X | 9 | 0.0331 | 6.6176 | 3 | 0.0356 | 7.1429 | > 0.05 |
0301 | 19 | 0.0699 | 13.9706 | 6 | 0.0714 | 14.2857 | > 0.05 |
0302 | 2 | 0.0074 | 1.4706 | 0 | 0.0000 | 0.0000 | > 0.05 |
040X | 30 | 0.1103 | 20.5882 | 12 | 0.1429 | 26.1905 | > 0.05 |
0701-2 | 13 | 0.0478 | 9.5588 | 3 | 0.0357 | 7.1429 | > 0.05 |
080X | 22 | 0.0809 | 15.4412 | 4 | 0.0476 | 9.5238 | > 0.05 |
0901 | 38 | 0.1397 | 26.4706 | 21 | 0.2500 | 45.2400 | 0.028* |
1001 | 11 | 0.0404 | 7.3529 | 2 | 0.0238 | 4.7619 | > 0.05 |
110X | 18 | 0.0662 | 12.5000 | 7 | 0.0833 | 16.6667 | > 0.05 |
120X | 17 | 0.0625 | 12.5000 | 11 | 0.1310 | 26.1905 | > 0.05 |
1301-2 | 15 | 0.0551 | 11.0294 | 1 | 0.0119 | 2.3810 | > 0.05 |
1303-4 | 4 | 0.0147 | 2.9412 | 0 | 0.0000 | 0.0000 | > 0.05 |
1305 | 1 | 0.0037 | 0.7353 | 0 | 0.0000 | 0.0000 | > 0.05 |
1305-6 | 0 | 0.0000 | 0.0000 | 0 | 0.0000 | 0.0000 | |
140X | 15 | 0.0551 | 11.0294 | 3 | 0.0357 | 0.0357 | > 0.05 |
AF: allele frequence, PF: phenotype frequence; P: Fisher,s exact test (2-tail) or χ2, compared with the control with AF; *Odds ratio = 2.053, etiologic fraction = 0.12820.
DISCUSSION
Familial aggregation of esophageal cancer is common. There is an approximate increase in abnormal chromosome ratio of this cancerous relatives as compared with the general population,although the inheritance patterns clearly fit no simple Mendelian patterns. However, the illness may exist in the same family at a higher frequency than expected by chance alone[5,24-27]. This suggests that there may be an internal environment susceptible to malignant and a genetic component in the patients’ families,which supports the concept that heredity may play an important role in the pathogenesis of esophageal cancer[2,9,46-53].
Major histocompatibility complex (MHC) is a genetic name describing alleles encoding antigens first discovered because they determine in a major way the fate of a graft, i.e., histocompatibility. In many species, the MHC has an additional name such as HLA for humans, H-2 for mice, SLA for swine, etc. The HLA alleles are located in a 3500-4000 kilobase region of chromosome 6; and the allele encoding β2-microglobulin, a related protein in the system, is on chromosome 15. The major classes of HLA alleles are class I (HLA-A, -B, and -C) and class II (HLA-DR, -DQ, and -DP).Between the class I and II alleles, there are many other alleles, some with immune-related functions that could also be associated with diseases,tumor necrosis factor A and B genes being among them. Class II HLA presents peptides derived from extracellular antigens. The HLA polymorphism appears to be responsible for variations in the immune response of different individuals to different antigens, and may contribute to the susceptibility to diseases and autoimmune disorders[5,15-17]. The loss of HLA antigens by neoplastic cells is considered important to tumor growth and metastasis, and for tumor escape immune surveillance. HLA class I molecules are required for the presentation of tumor neoantigens to cytotoxic T-lymphocytes. There is evidence that tumor cells with reduced expression or lack of such antigens could evade an immune response and selected for tumor progression. It can be considered that either extensive abnormalities in the regulation of the HLA alleles occurred or substantial chromosomal damage took place in the short arm of chromosome 6, where the human HLA allele complex is located. It was demonstrated that oncogenes may suppress the expression of HLA class I alleles, such as the activation of oncogenes or the inactivation of suppressor-genes[50,54-56]. The data presented here demonstrate that HLA-DRB1*0901 AF increased in the patients with esophageal cancer compared with that in healthy controls (0.2500 vs 0.1397, P = 0.028, OR = 2.053, EF = 0.1282), but none of the rested HLA-DRB1 alleles occurred at markedly altered frequency between the patients and the normal individuals we investigated, indicating that HLA-DRB1*0901 is positively associated with esophageal cancer.
The nucleotide sequence of HLA-DRB1*0901 allele which was measured in our research approachs to the corrsponded exon 2 gene sequence of genebank[44,45]. The AF of HLA-DRB1*0901 was also increased in both Japanese patients with lung cancer and prostate cancer. It is the allele that is associated with genetic susceptibility of various tumors,but why It was entirely unclear up to now. Pathogenesis of genetic association may be linkage disequilibrium (nonrandom association) and/ or changing in the recognized procession of the specific antigen.
It is still controversial whether or not HLA antigen expression in carcinomas correlates with the development of carcinoma and prognosis. The immune responses involving HLA antigens expressed on carcinoma cells are thought to play an important role in eliminating mutated cells or suppressing carcinoma progression[51-53,57-59]. As reported in some studies, the reduced expression of HLA antigens in malignant tissues has been proposed as a mechanism thereby tumor-associated proteins cannot be presented in the T cells, therefore the tumor cell proliferates are unperturbed by the immune system and carcinomas protect themselves from hosts’ immunosurveillance. There is a possibility that HLA allele genetic association and expression on carcinoma may provide a clue to the understanding of the therapeutic mechanisms of biological response modifiers or immunotherapy which may cut through the induction of HLA antigens on carcinoma cells[56,60-63]. The cells of a given individual may express HLA alleles, which altered binding to tumor peptides, thereby leading to a modified immune response to the tumor. Identification of the mechanism associating HLA-DRB1*0901 with esophageal cancer could ultimately help target individuals most likely to benefit from cancer screening and prevention programs, and could facilitate novel therapeutic strategies for cancer immunoprevention .
Footnotes
Edited by Ma JY
References
- 1.Geertsen R, Hofbauer G, Kamarashev J, Yue FY, Dummer R. Immune escape mechanisms in malignant melanoma. Int J Mol Med. 1999;3:49–57. doi: 10.3892/ijmm.3.1.49. [DOI] [PubMed] [Google Scholar]
- 2.Jimenez P, Cantón J, Concha A, Cabrera T, Fernández M, Real LM, García A, Serrano A, Garrido F, Ruiz-Cabello F. Microsatellite instability analysis in tumors with different mechanisms for total loss of HLA expression. Cancer Immunol Immunother. 2000;48:684–690. doi: 10.1007/s002620050017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ramal LM, Maleno I, Cabrera T, Collado A, Ferron A, Lopez-Nevot MA, Garrido F. Molecular strategies to define HLA haplotype loss in microdissected tumor cells. Hum Immunol. 2000;61:1001–1012. doi: 10.1016/s0198-8859(00)00171-3. [DOI] [PubMed] [Google Scholar]
- 4.Facoetti A, Capelli E, Nano R. HLA class I molecules expression: evaluation of different immunocytochemical methods in malignant lesions. Anticancer Res. 2001;21:2435–2440. [PubMed] [Google Scholar]
- 5.Lin J, Deng CS, Sun J, Zhou Y, Xiong P, Wang YP. Study on the genetic susceptibility of HLA-DQB1 alleles in esophageal can-cer of Hubei Chinese Hans. Shijie Huaren Xiaohua Zazhi. 2000;8:965–968. [Google Scholar]
- 6.Noble A. Review article: molecular signals and genetic reprogramming in peripheral T-cell differentiation. Immunology. 2000;101:289–299. doi: 10.1046/j.1365-2567.2000.00133.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Douek DC, Altmann DM. T-cell apoptosis and differential human leucocyte antigen class II expression in human thymus. Immunology. 2000;99:249–256. doi: 10.1046/j.1365-2567.2000.00940.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Boyton RJ, Lohmann T, Londei M, Kalbacher H, Halder T, Frater AJ, Douek DC, Leslie DG, Flavell RA, Altmann DM. Glutamic acid decarboxylase T lymphocyte responses associated with susceptibility or resistance to type I diabetes: analysis in disease discordant human twins, non-obese diabetic mice and HLA-DQ transgenic mice. Int Immunol. 1998;10:1765–1776. doi: 10.1093/intimm/10.12.1765. [DOI] [PubMed] [Google Scholar]
- 9.Koriyama C, Shinkura R, Hamasaki Y, Fujiyoshi T, Eizuru Y, Tokunaga M. Human leukocyte antigens related to Epstein-Barr virus-associated gastric carcinoma in Japanese patients. Eur J Cancer Prev. 2001;10:69–75. doi: 10.1097/00008469-200102000-00008. [DOI] [PubMed] [Google Scholar]
- 10.Chatzipetrou MA, Tarassi KE, Konstadoulakis MM, Pappas HE, Zafirellis KD, Athanassiades TE, Papadopoulos SA, Panousopoulos DG, Golematis BC, Papasteriades CA. Human leukocyte antigens as genetic markers in colorectal carcinoma. Dis Colon Rectum. 1999;42:66–70. doi: 10.1007/BF02235184. [DOI] [PubMed] [Google Scholar]
- 11.Ishigami S, Aikou T, Natsugoe S, Hokita S, Iwashige H, Tokushige M, Sonoda S. Prognostic value of HLA-DR expression and dendritic cell infiltration in gastric cancer. Oncology. 1998;55:65–69. doi: 10.1159/000011837. [DOI] [PubMed] [Google Scholar]
- 12.Zamani M, Cassiman JJ. Reevaluation of the importance of polymorphic HLA class II alleles and amino acids in the susceptibility of individuals of different populations to type I diabetes. Am J Med Genet. 1998;76:183–194. doi: 10.1002/(sici)1096-8628(19980305)76:2<183::aid-ajmg12>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
- 13.Hanifi Moghaddam P, de Knijf P, Roep BO, Van der Auwera B, Naipal A, Gorus F, Schuit F, Giphart MJ. Genetic structure of IDDM1: two separate regions in the major histocompatibility complex contribute to susceptibility or protection. Belgian Diabetes Registry. Diabetes. 1998;47:263–269. [PubMed] [Google Scholar]
- 14.Rigby AS, MacGregor AJ, Thomson G. HLA haplotype sharing in rheumatoid arthritis sibships: risk estimates subdivided by proband genotype. Genet Epidemiol. 1998;15:403–418. doi: 10.1002/(SICI)1098-2272(1998)15:4<403::AID-GEPI6>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
- 15.Azuma T, Ito S, Sato F, Yamazaki Y, Miyaji H, Ito Y, Suto H, Kuriyama M, Kato T, Kohli Y. The role of the HLA-DQA1 gene in resistance to atrophic gastritis and gastric adenocarcinoma induced by Helicobacter pylori infection. Cancer. 1998;82:1013–1018. doi: 10.1002/(sici)1097-0142(19980315)82:6<1013::aid-cncr2>3.0.co;2-f. [DOI] [PubMed] [Google Scholar]
- 16.Zavaglia C, Martinetti M, Silini E, Bottelli R, Daielli C, Asti M, Airoldi A, Salvaneschi L, Mondelli MU, Ideo G. Association between HLA class II alleles and protection from or susceptibility to chronic hepatitis C. J Hepatol. 1998;28:1–7. doi: 10.1016/s0168-8278(98)80195-5. [DOI] [PubMed] [Google Scholar]
- 17.Weinshenker BG, Santrach P, Bissonet AS, McDonnell SK, Schaid D, Moore SB, Rodriguez M. Major histocompatibility complex class II alleles and the course and outcome of MS: a population-based study. Neurology. 1998;51:742–747. doi: 10.1212/wnl.51.3.742. [DOI] [PubMed] [Google Scholar]
- 18.Wu MY, Chen MH, Liang YR, Meng GZ, Yang HX, Zhuang CX. Experimental and clinicopathologic study on the relationship between transcription factor Egr-1 and esophageal carcinoma. World J Gastroenterol. 2001;7:490–495. doi: 10.3748/wjg.v7.i4.490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kawaguchi H, Ohno S, Araki K, Miyazaki M, Saeki H, Watanabe M, Tanaka S, Sugimachi K. p53 polymorphism in human papillomavirus-associated esophageal cancer. Cancer Res. 2000;60:2753–2755. [PubMed] [Google Scholar]
- 20.Wijnhoven BP, Nollet F, De Both NJ, Tilanus HW, Dinjens WN. Genetic alterations involving exon 3 of the beta-catenin gene do not play a role in adenocarcinomas of the esophagus. Int J Cancer. 2000;86:533–537. doi: 10.1002/(sici)1097-0215(20000515)86:4<533::aid-ijc15>3.0.co;2-o. [DOI] [PubMed] [Google Scholar]
- 21.Takubo K, Nakamura K, Sawabe M, Arai T, Esaki Y, Miyashita M, Mafune K, Tanaka Y, Sasajima K. Primary undifferentiated small cell carcinoma of the esophagus. Hum Pathol. 1999;30:216–221. doi: 10.1016/s0046-8177(99)90279-4. [DOI] [PubMed] [Google Scholar]
- 22.Fong LY, Pegg AE, Magee PN. Alpha-difluoromethylornithine inhibits N-nitrosomethylbenzylamine-induced esophageal carcinogenesis in zinc-deficient rats: effects on esophageal cell proliferation and apoptosis. Cancer Res. 1998;58:5380–5388. [PubMed] [Google Scholar]
- 23.Arber N, Gammon MD, Hibshoosh H, Britton JA, Zhang Y, Schonberg JB, Roterdam H, Fabian I, Holt PR, Weinstein IB. Overexpression of cyclin D1 occurs in both squamous carcinomas and adenocarcinomas of the esophagus and in adenocarcinomas of the stomach. Hum Pathol. 1999;30:1087–1092. doi: 10.1016/s0046-8177(99)90227-7. [DOI] [PubMed] [Google Scholar]
- 24.van Lieshout EM, Roelofs HM, Dekker S, Mulder CJ, Wobbes T, Jansen JB, Peters WH. Polymorphic expression of the glutathione S-transferase P1 gene and its susceptibility to Barrett's esophagus and esophageal carcinoma. Cancer Res. 1999;59:586–589. [PubMed] [Google Scholar]
- 25.Zou JX, Wang LD, Shi ST, Yang GY, Xue ZH, Gao SS, Li YX, Yang CS. p53 gene mutations in multifocal esophageal precan-cerous and cancerous lesions in patients with esophageal cancer in high-risk northern China. Shijie Huaren Xiaohua Zazhi. 1999;7:280–284. [Google Scholar]
- 26.Liu J, Su Q, Zhang W. Relationship between HPV-E6 p53 pro-tein and esophageal squamous cell carcinoma. Shijie Huaren Xiaohua Zazhi. 2000;8:494–496. [Google Scholar]
- 27.Qin HY, Shu Q, Wang D, Ma QF. Study on genetic polymor-phisms of DDC gene VNTR in esophageal cancer. Shijie Huaren Xiaohua Zazhi. 2000;8:782–785. [Google Scholar]
- 28.Mori M, Mimori K, Shiraishi T, Alder H, Inoue H, Tanaka Y, Sugimachi K, Huebner K, Croce CM. Altered expression of Fhit in carcinoma and precarcinomatous lesions of the esophagus. Cancer Res. 2000;60:1177–1182. [PubMed] [Google Scholar]
- 29.Dolan K, Garde J, Walker SJ, Sutton R, Gosney J, Field JK. LOH at the sites of the DCC, APC, and TP53 tumor suppressor genes occurs in Barrett's metaplasia and dysplasia adjacent to adenocarcinoma of the esophagus. Hum Pathol. 1999;30:1508–1514. doi: 10.1016/s0046-8177(99)90175-2. [DOI] [PubMed] [Google Scholar]
- 30.zur Hausen A, Sarbia M, Heep H, Willers R, Gabbert HE. Retinoblastoma-protein (prb) expression and prognosis in squamous-cell carcinomas of the esophagus. Int J Cancer. 1999;84:618–622. doi: 10.1002/(sici)1097-0215(19991222)84:6<618::aid-ijc14>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
- 31.Shen ZY, Shen J, Li QS, Chen CY, Chen JY, Yi Z. Morphological and functional changes of mitochondria in apoptotic esophageal carcinoma cells induced by arsenic trioxide. World J Gastroenterol. 2002;8:31–35. doi: 10.3748/wjg.v8.i1.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Xu CT, Yan XJ. p53 anti-cancer gene and digestive system neoplasms. Shijie Huaren Xiaohua Zazhi. 1999;7:77–79. [Google Scholar]
- 33.Gu HP, Shang PZ, Su H, Li ZG. Association of CD15 antigen expression with cathepsin D in esophageal carcinoma tissues. Shijie Huaren Xiaohua Zazhi. 2000;8:259–261. [Google Scholar]
- 34.Liu J, Chen SL, Zhang W, Su Q. P31WAF1 gene expression with P53 mutation in esophageal carcinoma. Shijie Huaren Xiaohua Zazhi. 2000;8:1350–1353. [Google Scholar]
- 35.Tan LJ, Jiang W, Zhang W, Zhang XR, Qiu DH. Fas/FasL ex-pression of esophageal squamous cell carcinoma, dysplasia tis-sues and normal mucosa. Shijie Huaren Xiaohua Zazhi. 2001;9:15–19. [Google Scholar]
- 36.Wang LD, Chen H, Guo LM. Alterations of tumor suppressor gene system p53-Rb and human esophageal carcinogenesis. Shijie Huaren Xiaohua Zazhi. 2001;9:367–371. [Google Scholar]
- 37.Gao F, Yi J, Shi GY, Li H, Shi XG, Tang XM. The sensitivity of digestive tract tumor cells to As2O3 is associated with the inherent cellular level of reactive oxygen species. World J Gastroenterol. 2002;8:36–39. doi: 10.3748/wjg.v8.i1.36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Shen ZY, Shen WY, Chen MH, Shen J, Cai WJ, Yi Z. Nitric oxide and calcium ions in apoptotic esophageal carcinoma cells induced by arsenite. World J Gastroenterol. 2002;8:40–43. doi: 10.3748/wjg.v8.i1.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Gu ZP, Wang YJ, Li JG, Zhou YA. VEGF165 antisense RNA suppresses oncogenic properties of human esophageal squamous cell carcinoma. World J Gastroenterol. 2002;8:44–48. doi: 10.3748/wjg.v8.i1.44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wang LD, Zhou Q, Wei JP, Yang WC, Zhao X, Wang LX, Zou JX, Gao SS, Li YX, Yang C. Apoptosis and its relationship with cell proliferation, p53, Waf1p21, bcl-2 and c-myc in esophageal carcinogenesis studied with a high-risk population in northern China. World J Gastroenterol. 1998;4:287–293. doi: 10.3748/wjg.v4.i4.287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Zhang LJ, Chen KN, Xu GW, Xing HP, Shi XT. Congenital expression of mdr-1 gene in tissues of carcinoma and its relation with pathomorphology and prognosis. World J Gastroenterol. 1999;5:53–56. doi: 10.3748/wjg.v5.i1.53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Carter AS, Bunce M, Cerundolo L, Welsh KI, Morris PJ, Fuggle SV. Detection of microchimerism after allogeneic blood transfusion using nested polymerase chain reaction amplification with sequence-specific primers (PCR-SSP): a cautionary tale. Blood. 1998;92:683–689. [PubMed] [Google Scholar]
- 43.Carter AS, Cerundolo L, Bunce M, Koo DD, Welsh KI, Morris PJ, Fuggle SV. Nested polymerase chain reaction with sequence-specific primers typing for HLA-A, -B, and -C alleles: detection of microchimerism in DR-matched individuals. Blood. 1999;94:1471–1477. [PubMed] [Google Scholar]
- 44.Schreuder GM, Hurley CK, Marsh SG, Lau M, Maiers M, Kollman C, Noreen HJ. The HLA Dictionary 2001: a summary of HLA-A, -B, -C, -DRB1/3/4/5, -DQB1 alleles and their association with serologically defined HLA-A, -B, -C, -DR and -DQ antigens. Tissue Antigens. 2001;58:109–140. doi: 10.1034/j.1399-0039.2001.580210.x. [DOI] [PubMed] [Google Scholar]
- 45.Marsh SG. HLA class II region sequences, 1998. Tissue Antigens. 1998;51:467–507. doi: 10.1111/j.1399-0039.1998.tb02984.x. [DOI] [PubMed] [Google Scholar]
- 46.Xu M, Jin YL, Fu J, Huang H, Chen SZ, Qu P, Tian HM, Liu ZY, Zhang W. The abnormal expression of retinoic acid receptor-beta, p 53 and Ki67 protein in normal, premalignant and malignant esophageal tissues. World J Gastroenterol. 2002;8:200–202. doi: 10.3748/wjg.v8.i2.200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhou Y, Gao SS, Li YX, Fan ZM, Zhao X, Qi YJ, Wei JP, Zou JX, Liu G, Jiao LH, et al. Tumor suppressor gene p16 and Rb expression in gastric cardia precancerous lesions from subjects at a high incidence area in northern China. World J Gastroenterol. 2002;8:423–425. doi: 10.3748/wjg.v8.i3.423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Xiong XD, Xu LY, Shen ZY, Cai WJ, Luo JM, Han YL, Li EM. Identification of differentially expressed proteins between human esophageal immortalized and carcinomatous cell lines by two-dimensional electrophoresis and MALDI-TOF-mass spectrometry. World J Gastroenterol. 2002;8:777–781. doi: 10.3748/wjg.v8.i5.777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Qin LX. Chromosomal aberrations related to metastasis of human solid tumors. World J Gastroenterol. 2002;8:769–776. doi: 10.3748/wjg.v8.i5.769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Wang AH, Sun CS, Li LS, Huang JY, Chen QS. Relationship of tobacco smoking CYP1A1 GSTM1 gene polymorphism and esophageal cancer in Xi'an. World J Gastroenterol. 2002;8:49–53. doi: 10.3748/wjg.v8.i1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Bustin SA, Li SR, Phillips S, Dorudi S. Expression of HLA class II in colorectal cancer: evidence for enhanced immunogenicity of microsatellite-instability-positive tumours. Tumour Biol. 2001;22:294–298. doi: 10.1159/000050630. [DOI] [PubMed] [Google Scholar]
- 52.Hombach A, Heuser C, Marquardt T, Wieczarkowiecz A, Groneck V, Pohl C, Abken H. CD4+ T cells engrafted with a recombinant immunoreceptor efficiently lyse target cells in a MHC antigen- and Fas-independent fashion. J Immunol. 2001;167:1090–1096. doi: 10.4049/jimmunol.167.2.1090. [DOI] [PubMed] [Google Scholar]
- 53.Iguchi C, Nio Y, Takeda H, Yamasawa K, Hirahara N, Toga T, Itakura M, Tamura K. Plant polysaccharide PSK: cytostatic effects on growth and invasion; modulating effect on the expression of HLA and adhesion molecules on human gastric and colonic tumor cell surface. Anticancer Res. 2001;21:1007–1013. [PubMed] [Google Scholar]
- 54.Kim C, Matsumura M, Saijo K, Ohno T. In vitro induction of HLA-A2402-restricted and carcinoembryonic-antigen-specific cytotoxic T lymphocytes on fixed autologous peripheral blood cells. Cancer Immunol Immunother. 1998;47:90–96. doi: 10.1007/s002620050508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Savoie CJ, Kamikawaji N, Sudo T, Furuse M, Shirasawa S, Tana T, Sasazuki T. MHC class I bound peptides of a colon carcinoma cell line, a Ki-ras gene-targeted progeny cell line and a B cell line. Cancer Lett. 1998;123:193–197. doi: 10.1016/s0304-3835(97)00418-7. [DOI] [PubMed] [Google Scholar]
- 56.Tanaka H, Tsunoda T, Nukaya I, Sette A, Matsuda K, Umano Y, Yamaue H, Takesako K, Tanimura H. Mapping the HLA-A24-restricted T-cell epitope peptide from a tumour-associated antigen HER2 / neu: possible immunotherapy for colorectal carcinomas. Br J Cancer. 2001;84:94–99. doi: 10.1054/bjoc.2000.1547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Wang RF, Johnston SL, Zeng G, Topalian SL, Schwartzentruber DJ, Rosenberg SA. A breast and melanoma-shared tumor antigen: T cell responses to antigenic peptides translated from different open reading frames. J Immunol. 1998;161:3598–3606. [PubMed] [Google Scholar]
- 58.Nagorsen D, Keilholz U, Rivoltini L, Schmittel A, Letsch A, Asemissen AM, Berger G, Buhr HJ, Thiel E, Scheibenbogen C. Natural T-cell response against MHC class I epitopes of epithelial cell adhesion molecule, her-2/neu, and carcinoembryonic antigen in patients with colorectal cancer. Cancer Res. 2000;60:4850–4854. [PubMed] [Google Scholar]
- 59.Sato N, Nabeta Y, Kondo H, Sahara H, Hirohashi Y, Kashiwagi K, Kanaseki T, Sato Y, Rong S, Hirai I, et al. Human CD8 and CD4 T cell epitopes of epithelial cancer antigens. Cancer Chemother Pharmacol. 2000;46 Suppl:S86–S90. doi: 10.1007/pl00014057. [DOI] [PubMed] [Google Scholar]
- 60.Nabeta Y, Sahara H, Suzuki K, Kondo H, Nagata M, Hirohashi Y, Sato Y, Wada Y, Sato T, Wada T, et al. Induction of cytotoxic T lymphocytes from peripheral blood of human histocompatibility antigen (HLA)-A31(+) gastric cancer patients by in vitro stimulation with antigenic peptide of signet ring cell carcinoma. Jpn J Cancer Res. 2000;91:616–621. doi: 10.1111/j.1349-7006.2000.tb00990.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Schirle M, Keilholz W, Weber B, Gouttefangeas C, Dumrese T, Becker HD, Stevanović S, Rammensee HG. Identification of tumor-associated MHC class I ligands by a novel T cell-independent approach. Eur J Immunol. 2000;30:2216–2225. doi: 10.1002/1521-4141(2000)30:8<2216::AID-IMMU2216>3.0.CO;2-7. [DOI] [PubMed] [Google Scholar]
- 62.Novellino PS, Trejo YG, Beviacqua M, Bordenave RH, Rumi LS. Regulation of HLA-DR antigen in monocytes from colorectal cancer patients by in vitro treatment with human recombinant interferon-gamma. J Investig Allergol Clin Immunol. 2000;10:90–93. [PubMed] [Google Scholar]
- 63.Novellino PS, Trejo YG, Beviacqua M, Bordenave RH, Rumi LS. Cisplatin containing chemotherapy influences HLA-DR expression on monocytes from cancer patients. J Exp Clin Cancer Res. 1999;18:481–484. [PubMed] [Google Scholar]