The induction of Ethylene response factor 3 (ERF3) in potato as a result of co-inoculation with Pseudomonas sp. R41805 and Rhizophagus irregularis MUCL 41833 – a possible role in plant defense

Abstract

Colonization of plant rhizosphere/roots by beneficial microorganisms (e.g. plant growth promoting rhizobacteria – PGPR, arbuscular mycorrhizal fungi – AMF) confers broad-spectrum resistance to virulent pathogens and is known as induced systemic resistance (ISR) and mycorrhizal-induced resistance (MIR). ISR or MIR, an indirect mechanism for biocontrol, involves complex signaling networks that are regulated by several plant hormones, the most important of which are salicylic acid (SA), jasmonic acid (JA) and ethylene (ET). In the present study, we investigated if inoculation of potato plantlets with an AMF (Rhizophagus irregularis MUCL 41833) and a PGPR (Pseudomonas sp R41805) either alone or in combination, could elicit host defense response genes in the presence or absence of Rhizoctonia Solani _EC-1, a major potato pathogen. RT-qPCR revealed the significant expression of ethylene response factor 3 (EFR3) in mycorrhized potato plantlets inoculated with Pseudomonas sp R41805 and also in mycorrhized potato plantlets inoculated with Pseudomonas sp R41805 and challenged with R. solani. The significance of ethylene response factors (ERFs) in pathogen defense has been well documented in the literature. The results of the present study suggest that the dual inoculation of potato with PGPR and AMF may play a part in the activation of plant systemic defense systems via ERF3.

Introduction

Globally, potato is the most important crop after wheat and rice with over 300 million metric tons being produced annually and its continued cultivation is essential for global food security (http://cipotato.org/). The potato therefore needs to be protected from potato-associated pathogens, but current strategies sometimes lack efficacy and generally involve the application of chemical fungicides. Legislative changes in relation to the control and use of agrichemicals (especially in Europe) dictate that a more integrated approach to disease management needs to be implemented. To this end, several non-chemical approaches have been developed to promote plant resistance. Although single resistance gene transgenic plants have been successful, virulence factors may rapidly evolve to overcome resistance.¹ In addition, the mechanisms that drive resistance are not always clear and, in spite of continuing efforts, mechanisms of resistance to persistent and important diseases, such as the fungal necrotrophic pathogen Rhizoctonia solani, have yet to be identified.²

One promising non-chemical solution is to exploit one of a number of induced biochemical resistance pathways that are triggered in plants by exposure to certain microorganisms, such as with the use of plant defense bioprimers, including plant growth-promoting rhizobacteria (PGPR; such as Pseudomonas and Bacillus spp.) and arbuscular mycorrhizal fungi (AMF).^3,4 This approach can provide broad-spectrum resistance to virulent pathogens by exploiting a mechanism known as the induced systemic resistance (ISR) response,^5,6 in which plants are bioprimed for enhanced activation of cellular defense mechanisms when a pathogen attacks; these mechanisms include the oxidative burst, cell-wall consolidation, aggregation of defense-associated enzymes, and production of secondary metabolites.^7-9 Upon activation, it is imperative that ISR is effective against different pathogens for a significant period of time, regardless of whether the inducing bacterial population declines.³ Specific symbiotic interactions are established between AMF, which are obligate symbiotic biotrophs (phylum Glomeromycota), and the roots of 80% of higher plants,¹⁰ including primary agricultural crops like the potato. These fungi supply the host plant with water and nutrients such as phosphorus, which in turn absorb carbohydrates from the plant.^11,12 Similar to ISR, mycorrhizal-induced resistance (MIR) is triggered by colonisation with AMF, which induces a prolonged primed state to better resist pathogens (including R. solani in the potato) and improve crop yields.^4,13

Induced defense responses involve complex signaling networks that are regulated by several plant hormones, the most important of which are salicylic acid (SA), jasmonic acid (JA), and ethylene (ET). ISR is characterized by induction of JA- and ET-dependent signaling pathways, which ultimately results in the expression of resistance-related proteins, including plant defensins.¹⁴ Similar to ISR, a distinct, SA-dependent induced resistance response called systemic acquired resistance (SAR) is triggered by exposure of plants to pathogens and induces a hypersensitive response in plant leaves. Plant tissues distal to the site of this initial, or “immunizing,” infection acquire long-lasting and broad-spectrum resistance to virulent pathogens. An essential regulator of SAR is the non-expressor of PR1 (NPR1) protein, which is required for the expression of genes induced by SA. SA-inducible genes ultimately lead to the systemic accumulation of pathogenesis-related (PR) proteins, such as PR1, PR2, and PR5.^8,9 The nature of the pathogen (e.g., biotrophic or necrotrophic) appears to dictate the type of phytohormone utilised in the signaling pathways for defense gene regulation; SA-dependent signaling pathways mediate normal biotrophic pathogenic resistance, while necrotrophic pathogens utilize JA/ET-dependent mechanisms.¹⁵ However, in some cases, ISR activation can also mobilise different signaling pathways, since certain ISR inducers have been reported to trigger an SA-dependent pathway.^16,17 Interactions between SA- and JA/ET-dependent signaling pathways are known to exist, which function as an efficient regulatory mechanism by which the plant adjusts its inducible defense reaction depending on pathogen type.¹⁸

Combining defense bioprimers has been successfully used as a strategy to increase ISR efficiency, with mixtures of bacterial strains shown to induce greater ISR,⁵ which in reality emulates real-life scenarios in nature. We have coined the acronym RMISR to refer to the phenomenon of the response induced in plants following the co-inoculation of AMF and rhizobacteria (i.e rhizobacteria mycorrhizae-mediated induced systemic resistance). Positive interactions between bacteria and AMF are known to exist,^19-22 and the combined root inoculations, as biological triggers might be a strategic alternative to enhance RMISR and crop outcomes. While the molecular mechanisms that drive the interaction between plants and bacteria or plants and AMF are reasonably well defined, the specific mechanisms underpinning the interactions between AMF and bacteria remain elusive and there has yet to be a transcriptional study of potato tuber disease responses to a combination of bacteria and AMF.

The objective of this study was therefore to determine if inoculation of potato plantlets with AMF (R. irregularis MUCL 41833) and a PGPR (Pseudomonas sp. R41805) either alone or in combination, could elicit host defense response genes in the presence or absence of R. solani. Glutathione-S-transferase 1 (GST1), and class II chitinase (PR3) for the SA pathway, lipoxygenase (Lox) for the JA pathway, and basic PR1 (PR1b) for the combined JA- and ET-mediated pathway, and the ethylene response factor 3 (ERF3) for the ET pathway were chosen as pathway reporter genes.

Results and Discussion

RT-qPCR analysis was carried out to reveal the biopriming potential of mycorrhizal and non-mycorrhizal potato plantlets inoculated with Pseudomonas sp R41805 followed by infection with R. solani. The following differences in gene expression were observed in co-inoculated plantlets relative to control. Of the 5 genes studied, only ERF3 expression showed significant differences in expression between the groups. ERF3 was upregulated in the mycorrhizal potato plantlets cultivated with bacteria in the absence of pathogen (p < 0.05) and the mycorrhizal potato plantlets cultivated with bacteria and challenged with R. solani (p < 0.05), with no significant differences in expression seen in the other treatments (Table 2). This was confirmed by 3-way ANOVA; AMF (p < 0.001) and bacteria (p < 0.01), as well as their interaction (AMF × bacteria; p < 0.05), were significantly associated with ERF3 upregulation. Co-inoculation with the Pseudomonas sp R41805 and R. irregularis MUCL 41833 may therefore activate the systemic defense system in potato plantlets via ERF3. Since the expression of GST1, PR3, Lox, and PR1b in our study, did not significantly change in response to the treatments i.e., AMF, bacteria, R. solani, or their combinations, one explanation might be that the most likely candidate regulatory mechanism in this instance is ET-dependant. ET-dependent resistance responses are regulated by transcription factors called ethylene-response factors (ERFs) that bind to specific DNA motifs. Plants encode a number of ERFs that bind to the promoters of a subset of pathogenesis-associated genes downstream of the ET and/or JA signaling pathways, thereby altering gene expression and subsequently affecting pathogen resistance.²³ The potato-associated ERF3 (Accession no: EF091875) targeted in this study binds to sequence-specific DNA motifs of the ethylene response element (ERE), a promoter element necessary for ethylene responsiveness. ERFs may function as either transcriptional activators or repressors depending on the stress response. For example LeERF3b, a putative repressor, was upregulated in tomato in response to abiotic stress.²⁴ The ERF3 was upregulated during hypersensitive response (HR) response by Tobacco mosaic virus (TMV) infection in tobacco plants carrying N resistance gene.²⁵ It was demonstrated that, the expression of potato-associated ERF3 was upregulated in both mycorrhized and non- mycorrhized potato plantlets challenged with Phytopthora infestans.²⁶ It may be possible that a potato-associated pathogen can interfere with potato-associated ERF3 activity and reduce defense protein expression, as previously described.²⁷ In this study, the slight decrease in the relative expression of ERF3 observed in the mycorhizal plantlets cultivated with bacteria and challenged by the pathogen compared to the same plantlets not challenged with R. solani, indicates that R. solani had at least some impact on the reduction of ERF3 expression. We speculate that the protective action of ERF3 is indirect and this is also supported by previous studies that have shown that overexpression of plant ethylene transcription factors (such as ERF5) in tobacco can enhance resistance to Ralstonia solanacearum infection.²⁸ The overexpression of ERF1 in Arabidopsis can enhance plant resistance to necrotrophic fungi, such as Botrytis cinerea, Plectosphaerella cucumerina, and Fusarium oxysporum, which requires both a functional ET and JA pathway.²⁹ Although many ERFs have been associated with plant immunity, specific mechanisms underpinning the relationship between ERF expression and PGPR inoculation are unknown.²⁷ Although the expression of downstream genes was not directly measured in this study, the patterns of expression of ERF3 following co-inoculation with AMF and bacteria, are likely to result in the expression of defense genes/proteins and may promote resistance to R. solani. This hypothesis will also need to be confirmed using functional studies, such as gene silencing, with the genes showing the strongest phenotypic responses when silenced or overexpressed, selected as key candidates in pathways driving R. solani resistance in potatoes.

Table 2.

Relative expression levels of 5 genes in mycorrhized and non-mycorrhized potato plantlets inoculated with Pseudomonas sp. and challenged with R. solani. Roots inoculated with and without mycorrhizae (+M, −M); Roots inoculated with and without Bacteria (+B, −B); Roots inoculated with and without R. solani (+R, −R)

	Treatments
Gene	−M −B −R	−M −B +R	−M +B −R	−M +B +R	+M −B −R	+M −B +R	+M +B −R	+M +B +R
GST1	0.80 (0.31)	1.98 (1.12)	0.92 (0.30)	0.67 (0.20)	1.53 (0.39)	2.12 (0.77)	1.28 (0.38)	1.20 (0.33)
PR3	1.36 (0.41)	1.46 (0.49)	0.62 (0.32)	0.35 (0.07)	1.42 (0.30)	2.03 (0.64)	1.61 (0.62)	2.04 (0.42)
Lox	2.08 (1.01)	1.06 (0.33)	0.79 (0.40)	3.98 (1.35)	0.54 (0.25)	1.42 (0.69)	2.65 (1.20)	1.60 (0.62)
PR1b	3.77 (2.11)	2.80 (1.61)	3.05 (2.52)	0.39 (0.13)	1.73 (0.65)	3.00 (2.34)	0.99 (0.35)	1.09 (0.34)
ERF3	0.49 (0.11)	1.09 (0.16)	0.66 (0.15)	0.67 (0.19)	1.12 (0.13)	1.15 (0.44)	2.78 (0.55)*	2.38 (0.62)*

The standard error is shown in brackets. Means followed by asterisk are significantly different with respect to corresponding non-inoculated control as determined Tukey's post-hoc test (*P < 0.05).

We have previously demonstrated that, inoculation of potato plantlets in vitro with Pseudomonas sp R41805 alone, showed plant growth and enhanced resistance to R. solani infection.³⁰ In a field trial conducted in Bolivia, a reduced level of R. solani infection was observed on potato tuber plants that had been treated with Pseudomonas sp. R41805 (Unpublished data). In our present study, we did not observe any significant upregulation of defense response genes when cultivated with bacteria and also challenged with R. solani. It is also possible that induction of GST1, PR3, Lox, and PR1b was not detected in this study because different plants use different signaling pathways or defense genes in response to various pathogens.^26,27,31-35 Alternatively, since the time course of defense response gene expression was not studied and defense gene expression may be time-dependent, this protocol may not have detected differences in gene expression related to JA/SA pathway activation. This finding also suggests that, apart from ISR, other indirect mechanisms (e.g. production of antibiotics) play a role in suppressing plant pathogens. In this study, it is possible that the expression of antibiotic biosynthetic genes in the Pseudomonas sp R41805 was repressed by extracellular metabolites produced by AMF, when co-inoculated, in order to counteract the negative effect of antibiotics on AMF colonization. More in depth studies are therefore needed on the mechanisms controlling synergistic interaction between bacteria and AMF, mainly patterns of expression of ERF3, the characterization of antibiotic synthetic genes and also the colonization patterns of Pseudomonas sp R41805 using marker genes. For the successful and efficient induction of ISR, plant roots must recognize bacterial determinants. A number of microbe-associated molecular patterns (MAMPs) involved in ISR activation have been characterized, including lipopolysaccharide (LPS), antibiotics (such as 2,4-diacetylphloroglucinol), siderophores, and volatile organic compounds (VOCs; such as 2,3-butanediol or tridecane).³⁶ Work in our lab in a previous study demonstrated that when the soil-borne pathogenic fungus R. solani was exposed to the Pseudomonas sp R41805 volatiles in vitro, its growth was strongly suppressed (Unpublished data). Thus, we also speculate that volatile organic compounds may also participate with AMF in the activation of ERF3, but this remains to be tested. In this present study, plantlets were successfully colonized by AMF, as confirmed by root staining, and all control plants were non-mycorrhized. Microscopic observation of stained roots showed AMF fungal structures such as arbuscules, vesicles and hyphae (Fig. 1). To gain a comprehensive understanding of the role of bacteria and AMF in the activation of plant defense, it is also necessary to study the impact of bacteria on AMF germination and colonization in association with potato plants. As the objective of the present study was to look at the host defense response genes (5 d post infection), we did not expect to observe any R. solani symptoms because the lifecycle of R. solani indicates that even though the attachment to the plant root occurs within 12 h,³² symptom expression can take up to 2 - 3 weeks as observed in our previous studies. During this delay, the timely expression of defense genes is important for the control of R. solani which is why we chose to look at response factors 5 d post infection. In our study, the expression of ERF3 was higher in potato plantlets challenged with R. solani, compared to the control plants (albeit not significantly). We recognize that further experiments which examine different time point's post-infection and post symptom development, are critical in order to understand fully the plant molecular response.

Figure 1.

Microscopic observation of intraradical root colonization of AMF in Solanum tuberosum L cv Unica planlets. (A) Close up of the non-mycorrhized plant and (B) the mycorrhized plant showing AM fungal structures such as arbuscules (black arrows) and vesicles (white arrow) (C) Clear field of view of non-mycorrhized plant and (D) the mycorrhized plant showing hyphae crossing root intersection (white arrow).

Conclusion and Perspectives

The economic success of many crops relies on well-developed biochemical defense response mechanisms acting in plant parts both above and below the ground in order to withstand attack from plant pathogens. Research into the complex interactions that occur between plant roots and the surrounding microflora, is in its infancy. Plant survival depends on its capacity to distinguish between pathogenic and beneficial microorganisms and respond accordingly and, ideally, pathogens need to be evaded and inhibited and growth of beneficial microorganisms promoted. Therefore, understanding the molecular interactions between plants and microorganisms contribute not only to the development of methods that manipulate plant defenses, but also to the development of strategies which promote the growth of beneficial rhizosphere microflora. Although the cellular signaling processes that underpin ISR and MIR have become better understood, not least since the development of high-throughput molecular technologies, translation of theoretical knowledge into practical strategies in the field has yet to be fully accomplished. The protection provided by biological agents is not always as robust as chemical treatments and the benefits of these agents may differ between the field and controlled laboratory conditions. Nevertheless, there has been considerable progress in the commercial development of resistance-inducing agents and their incorporation into crop production and protection technology. For instance, by combining the Bacillus sp. GB03 and IN937a (Bioyield®), ISR was elicited in peppers, tomatoes, and cucumbers, indicating that dual combinations can induce ISR.⁵ It may therefore be useful to test different combinations of bacteria or bacteria and AMF. Indeed, soybean plants inoculated with rhizobia and/or AMF showed plant defense system activation that inhibited red crown rot by increasing expression of various PR genes.²² Bacteria/AMF-induced ISR (RMISR) may therefore provide a viable alternative to single agent or chemical strategies for natural plant disease management. Given its potential, RMISR, may be considered a good strategy for plant disease management. RMISR may manifest differently, depending on the environmental conditions. Ideally, experiments need to be conducted under different field conditions at different times (i.e.,, to assess spatial and temporal effects) and in the laboratory. Most studies tend to use model plants instead of crops to comprehensively analyze the interactions between plants and microorganisms and the knowledge derived, contributes to formulating new strategies to engineer broad-spectrum resistance, underpinned by rational biotechnological approaches. The efficiency of defense bioprimers can be influenced by environmental factors, while plant-inoculant interactions can largely be determined by genotype;³⁰ consequently, it is necessary to conduct trials that assess both host and environmental compatibility to confirm the efficiency of inoculants with different plant genotypes. Establishing the priming efficiency for agriculture, requires further research, but the promise of the use of bioprimers for crop plant protection, may intensify the search for soil microorganisms that can improve plant resistance and minimise pathogen-induced production losses. This is important not only to enhance RMISR, but also to prevent overexpression of defense elements, which results in allocation costs related to crop yield. To achieve the strongest impact on pathogens, defense responses must be precisely activated. However, we need to improve our knowledge of compatibility of RMISR-inducing agents with general crop production and protection practices to improve the use and commercialisation of RMISR inducers. The practical application of RMISR for crop protection has been challenging, mainly due to inconsistent effects, and further consideration of the timing and method of implementation is needed.

In conclusion, we show that ERF3 is induced in mycorrhized potato plantlets inoculated with beneficial bacteria. The expression of ERF3 was lower in mycorrhized and bacterised potato plantlets challenged with R. solani, compared to the unchallenged mycorrhized potato plantlets inoculated with beneficial bacteria (albeit not significantly). The significance of ethylene response factors involved in pathogen defense has been well documented in the literature, as outlined earlier in this discussion. The results of the present study suggest that the dual inoculation of PGPR and AMF may induce a faster and stronger activation of cellular defense responses via ERF3 in the potato cultivar used here. We recognize that this can only be fully determined by using plant signaling mutants and also by carrying out a full screening of expression profiles of JA, SA, and ET-dependent defense genes in both susceptible and wild type cultivars at different time points. In addition, future work should focus on the co-inoculation of the AMF and the PGPR in potato, in glasshouse and open-field trials, where the efficacy of these agents on ameliorating the impact of R. solani and possibly other pathogens of potato should also be examined.

Material and Methods

Biological material

A root organ culture (ROC) of Rhizophagus irregularis (Błaszk., Wubet, Renker & Buscot) C. Walker & A. Schüßler comb. nov. MUCL 41833 was provided by the Glomeromycota in vitro collection (GINCO – www.mycorrhiza.be/ginco-bel). This AMF was used in the mycorrhizal donor plant (MDP) in vitro culture system,³⁷ used in the present study (see experimental design). This AMF was grown in association with Ri T-DNA transformed carrot (Daucus carota L.) roots clone DC1 (approximately 70 mm length) on Petri plates (90 mm diameter) containing the modified Strullu-Romand (MSR) medium,³⁸ supplemented with 10 g L⁻¹ sucrose, 3 g L⁻¹ phytagel and adjusted to pH 5.5.³⁹ The Petri plates were incubated for 3 months in the dark in an inverted position at 27°C. Several thousand spores were produced during this period.

The rhizobacterial strain Pseudomonas sp R41805 used in this study was previously isolated from the rhizosphere of Solanum tuberosum (potato) plants in Andean Highlands of Bolivia.³⁰ Bacterial stock cultures were maintained in tryptic soy broth (TSB) supplemented with 70% glycerol at −40°C. For routine use, the rhizobacterial strain was streaked onto tryptic soy agar (TSA).

The fungal strain, Rhizoctonia solani _EC-1 was supplied by the International Potato Center (CIP), Quito, Ecuador. For short-term maintenance and for routine use, the fungus was cultivated every fortnight on potato dextrose agar (PDA) at 25°C.

Potato (Solanum tuberosum L., var. Unica) in vitro plantlets were supplied by the School of Biological, Earth and Environmental Sciences, University College Cork, Ireland. The plantlets were sub-cultured every 4–5 weeks by placing nodal cuttings in sterile tissue culture boxes (90 × 60 × 50 mm) containing 50 ml of 4.412 g L⁻¹ Murashige and Skoog (MS) medium, supplemented with 20 g L⁻¹ sucrose, 3 g L⁻¹ phytagel and adjusted to pH 5.9 before sterilization (121°C for 15 min). The plantlets were kept in a growth chamber at 22°C with a photoperiod of 16 h d⁻¹ and a photosynthetic photon flux (PPF) of 225 μmol m⁻¹ s⁻¹.

Seeds of M. truncatula Gaertn. cv. Jemalong A 17 (SARDI, Australia) were surface disinfected by immersion in sodium hypochlorite (8% active chloride) for 10 min and rinsed in deionized sterile water. Seeds were germinated in Petri plates (90 mm diameter) containing 35 ml of the MSR medium without sucrose and vitamins,⁴⁰ solidified with 3 g L⁻¹ phytagel and adjusted to pH 5.5 before sterilization (121°C for 15 min). The Petri plates were incubated at 27°C in the dark. Seedlings were ready to use 4 d following germination.

Experimental design: The mycelium donor plant (MDP) in vitro culture system

Mycelium Donor Plant (MDP) in vitro culture systems were set up with M. truncatula seedlings following the protocol described by Voets et al.,³⁷ with slight modifications. Briefly, the base of a small Petri plate (55 mm diameter) was placed in a larger Petri plate (140 mm diameter) in order to physically separate a root compartment (RC), i.e. the small Petri plate from the hyphal compartment (HC), i.e., the large Petri plate. Both compartments were filled with 20 and 110 ml MSR medium, respectively, without sugar and vitamins. A diagonal hole (5 mm diameter) was made in the lid and the base of the large Petri plate. Four-day old M. truncatula germinated seedlings (see biological material) were transferred to the RC, with the roots placed on the surface of the 20 ml MSR medium and the shoot extending outside the Petri plate via the above-mentioned hole. Plates were inoculated with an approximate of 100 spores of R. irregularis MUCL 41833 (see biological material) placed in the close vicinity of the roots. The holes were carefully plastered with sterilized (121°C for 15 min.) silicon grease (VWR International, Belgium) to avoid contaminations and the Petri plates subsequently sealed with Parafilm. The Petri plates were then wrapped with opaque plastic bags to keep the AMF and M. truncatula roots in the dark, while the shoots developed under light conditions. The Petri plates were incubated in a growth chamber set at 22/18°C (day/night), 70% relative humidity, photoperiod of 16 h d⁻¹, and an average photosynthetic photon flux of 225 μmol m⁻¹ s⁻¹. Starting from week 2, MSR medium (20 ml) without vitamins and sucrose was added weekly to the RC. After six weeks of incubation, the AMF started to cross the partition wall separating the RC from the HC and developed profusely in the HC containing MSR medium. After two additional weeks, 10 potato nodal cuttings of 10 d old potato plantlets (see biological material) were placed in close contact with the extraradical mycelium of the AMF developing on the HC of each Petri plate and 20 ml of additional MSR medium was added to cover the roots of the cuttings. The MDP in vitro culture systems were covered with modified lids where the upper part of a colorless plastic container (100 mm diameter) without the base was placed over a new Petri plate lid (140 mm diameter) where a circular hole in the middle (100 mm diameter) was made. Both parts were glued together with silicon and sterilized with gamma radiation. The MDP in vitro culture systems were sealed with Parafilm and silicon grease and placed in a growth chamber under the above-mentioned conditions. The potato plantlets remained in the MDP in vitro culture systems for 4 weeks. Control plant systems were setup with identical conditions described above but without the AMF associated to M. truncatula. After four weeks, 2 randomly selected mycorrhizal and non-mycorrhizal plantlet from each MDP in vitro culture systems were harvested, stained and roots mounted on microscopic slides to ascertain the presence of AMF structures (i.e., arbuscules, vesicles and hyphae) under a compound microscope (10–40×) before transferring from MDP in vitro culture system to pots (see growth room experiments). Roots were cleared in 10% KOH (Sigma, P5958) at 50°C for 1 h, rinsed with distilled water, and stained with 5% Ink-Vinegar (Parker Quink – Blue-Black) solution at 50°C for 1 h.

Growth room experiments

Pots (10 cm diameter) were filled with sterilized soil and sand (Westland Horticulture ltd, Ireland) at a ratio of 1:1. The pH was measured to 6.1 ± 2 . Under sterile conditions, both AMF-colonized and non-colonized individual potato plantlets were gently transferred from MDP in vitro culture systems to the pots. Plantlets were acclimatized under growth room conditions of 23°C, and a 16 h d⁻¹ photoperiod and an average photosynthetic photon flux of 40 μmol m⁻¹ s⁻¹. Plantlets were mist sprayed with Long Ashton nutrient solution every one week. After two weeks in the growth room, the rhizosphere of the mycorrhizal and non- mycorrhizal plantlets was subjected to drench application of Pseudomonas sp R41805 (1 × 10⁷ CFU ml⁻¹). After one week bacterization, plantlets were infected with R. solani by gently pushing the soil at the base of potato plantlets to expose portion of the root system. Five fungus infected oat seeds were then placed directly in contact with uncovered roots at 5 points equidistant from the stem. Roots were covered with soil immediately after infestation. Control plantlets were setup but with sterilized oats seeds. In summary, 8 treatments were considered: mycorrhizal plantlets (M) subjected or not to drench application of bacteria (B) and infected or not with R. solani (R) (+M+B+R, +M+B−R, +M−B+R, +M−B−R, respectively) and non-mycorrhizal plantlets subjected or not to drench application of bacteria (B) and infected or not with R. solani (R) (−M+B+R, −M+B−R, −M−B+R, −M−B−R, respectively).

RNA extraction, reverse transcription and Real-Time quantitative PCR

The total leaf RNA was extracted 5 d after pathogen challenge (and for those plants not challenged with R. solani, RNA was extracted at the same time point). Each sample was ground rapidly in liquid nitrogen and stored at −80°C until use. Total RNA was extracted from 80 mg of frozen material with the RNeasy plant mini kit (Qiagen, USA) according to the manufacturer‘s instructions. The total RNA was subsequently treated with RNase-Free DNase Set (Qiagen, USA) according to the manufacturer recommendations. Concentration and purity of total RNA were determined in a NanoDrop Spectrophotometer (Thermo Scientific, USA) using a 1.5 μl aliquot of the sample. RNA purity was estimated from the A260/A280 and A260/A230 absorbance ratios. Total RNA quality was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA) according to manufacturer recommendations.

Following total RNA extraction, reverse transcription (RT) was performed with the High Capacity cDNA Reverse Transcription KIT (Applied Biosystems, USA) according to manufacturer's instructions with 60 ng of total RNA in 20 μl reactions. Real time PCR was carried out on a 7900HT Fast Real Time PCR System (Applied Biosystems, USA). Three reference genes were selected: Actin - X55746, Elongation factor 1-α (EF-1α) - AB061263, β-tubilin - Z33382 and 5 target genes were studied: Gluthatione-S-transferase 1 (GST1) - JO3679, Class II Chitinase - AF024537, Lipoxygenase (Lox) - Y18548, Ethylene response factor 3 (ERF3) - EF091875 and Basic Pathogenesis Related 1 (PR1b) - AJ250136. The Primers and TaqMan probe sets (assays) used in this study were designed and purchased from Life technologies (Table 1). Real-time (RT) PCR reactions were performed in a volume of 10 μl containing 3.5 μl nuclease-free water, 0.5 μl of 20X gene expression assay mix (forward and reverse primers and labeled probe), 1 μl cDNA and 5 μl TaqMan® universal PCR master mix (2X) (Applied Biosystems, USA). All genes were run in triplicate and 4 biological replicates of each treatment were performed. RT-PCR was run on 7900HT Fast Real Time PCR System using the following conditions: 2 min at 50°C for optimal AmpErase® UNG activity, 10 min at 95°C to activate AmpliTaq® Gold DNA polymerase, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Normalization was performed using 2 stably expressed reference genes (Actin and, Elongation factor 1-α (EF-1α)) validated using the geNorm function in qbase^PLUS software.

Table 1.

Primers and TaqMan Probes used in this study

Gene and Accession number	Forward and Reverse primer (5’ – 3’)	Probe (5’ -3’) (6FAM – MGBNFQ)
GST1 - JO3679	TCGCGCTTTAGCACGATTTTG CTTTCTCTTGTTCCTCTCCTTTCGA	CTGCCCCCTTATCTTCG
Class II Chitinase - AF024537	GGCAAATAGATCAGTCGGAAAGATACT CTTGTCCAGCTCGTTCGTAGTT	TCCAATTGACACACCAATCT
Lox - Y18548	CTAACGGTTGATGAGGCGATGA TTTTCGTTATTGTAGTGTTTATCCTCCTCAA	ATGATGGTTCAATATGAAAAGTTT
ERF3 - EF091875	CCTGTTAAAAATGAAATCAATCGGAGTCC CGGCGATGATGAATCAACCATAAC	TCAGACTAGTACTGTTGAATCG
PR1b - AJ250136	CCAACTCAAGAACTGGTGATTGTAAC CTCCCCGTGAAATCACCACTT	TTGGCAAGGTTCTCTCC
Actin - X55746	TTCAGGCAGTCTTGTCTCTTTACG CATCACCAGAATCCAGCACAATAC	CAGTGGCCGTACAACAG
EF-1α - AB061263	ACAAGGGACCAACCCTCCTT GGGTTTGTCTGATGGCCTCTT	ACGCTCTTGACCAGATTAA
β-tubilin - Z33382	GTCCTTGACAACGAAGCTCTATATGATAT TGCAGAGATCAAATGGTTCAAGTCA	CTCACTACTCCAAGCTTTG

Statistical Analysis

Relative gene expression levels were calculated and analyzed statistically using one-way ANOVA (p < 0.05), with the software qbase^PLUS (Biogazelle, Ghent University, Belgium). Three-way ANOVA (SPSS® Statistics 21) was used to detect statistically significant (p < 0.05) effects of Rhizophagus irregularis MUCL 41833 Pseudomonas sp R41805 and Rhizoctonia solani and their interactions.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed

Funding

The research project “VALORAM - Valorizing Andean microbial diversity through sustainable intensification of potato-based farming systems” was supported by European Commission's Seventh Framework Program FP7/2007–2013 under grant agreement No 227522, 01/02/2009–31/01/2014.