PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation

Abstract

Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na⁺) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na⁺ level, respectively. All the varieties and transgenic lines of rice accumulate differential Na⁺ ions in root and shoot. However, roots accumulate high Na⁺ as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na⁺ transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na⁺ transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

Introduction

Salinity stress negatively impacts and reduces rice productivity; the effect is especially severe on high yielding varieties. A comprehensive understanding of salinity stress at molecular level is essential to develop high yielding salinity tolerant varieties, which can be effectively grown in salt-affected areas. Rice is the main staple crop and provides essential daily calories to over half of the world population.^1,2 In recent era, helicases have evolved as an important and emerging player in the abiotic stress tolerance, including salinity stress.^3-9 Among helicases, pea DNA helicase, PDH45 is a unique member, which contains DESD and SRT instead of the typical DEAD/H and SAT in motifs V and VI, respectively.¹⁰ In earlier reports, overexpression of salt-inducible PDH45 in tobacco and rice (IR64 and PB1) leads to the salinity stress tolerance without compromising yield.^11-13 Although the detailed mechanism of helicase, in salinity resistance, remains unclear but recently it was reported in rice (PB1 variety) that overexpression of PDH45 mediates salinity tolerance by generating induced reactive oxygen species (ROS) and also protects photosynthetic machinery.¹¹

Recently, it was reported that hydrophobic barrier formation in roots further reduces bypass flow in high salt concentration.¹⁴ The casparian bands and suberin lamellae are the usual apoplastic barriers inside endodermis and exodermis of plant roots¹⁵ owing to the deposition of hydrophobic suberin and/or lignin in the pores of the radial and anticlinal walls and also deposition of lignin as secondary wall thickenings on the inner face of the primary cell walls.¹⁶ Further, bypass flow closely paralleled the extent of suberin deposition over the course of exposure to salinity stress and is negatively correlated with suberin deposits.¹⁷

CoroNa Green AM binds with sodium (Na⁺) and is specific Na⁺ indicator that shows increase in fluorescence intensity indicates increasing Na⁺ accumulation. In this study, role of PDH45 helicase in salinity stress was investigated using CoroNa Green AM dye specific to Na⁺ localization. The present study also reports CoroNa Green based Na⁺ accumulation in root and shoot of tobacco as well as different rice varieties and transgenic lines along with WT, i.e., IR64 (moderate salinity tolerant), overexpressing PDH45 transgenic lines (PDH45 L1 and L2), salinity tolerant (FL478) and salinity susceptible (Pusa-44).

Results

CoroNa Green, fluorescent Na⁺ specific dye provides a valuable means for non-destructive monitoring to detect the spatial and temporal distribution of Na⁺. To investigate the Na⁺ accumulation, root and shoot were analyzed using CoroNa Green dye in tobacco and rice transgenics.

Na⁺ localization in roots and shoots of tobacco transgenic plants

CoroNa Green based comparative analysis reveals that the roots (Fig. 1A) and shoot (Fig. 1B) of WT accumulates less Na⁺ as compared to PDH45 transgenic line. Moreover, on comparative analysis among root and shoot of WT and PDH45 transgenic plants showed the higher accumulation of Na⁺ ions in root as compared to shoot. Therefore, further to elucidate the role of PDH45, different rice varieties and transgenic lines were analyzed using CoroNa Green along with WT.

Figure 1.

CoroNa Green based Na⁺ accumulation in PDH45 tobacco transgenic and wild type (WT) plants. (A) Root tips. (B) Shoot.

Comparative Na⁺ localization in root and shoot of different rice varieties and transgenic lines

The root anatomical study demonstrated that the epidermis, mesenchyma and vascular bundle of IR64 and Pusa-44 accumulate highest Na⁺ level. On the other hand, epidermis, mesenchyma and vascular bundle of PDH45 transgenic lines (L1 and L2) and FL478 contain moderate and lowest level of Na⁺ while the vascular bundle had similar Na⁺ level. The moderate Na⁺ term is used for transgenic lines because the accumulation was less than the wild type (IR64) and Pusa-44. Overall, comparative root anatomical study revealed that the highest Na⁺ accumulation was observed in the IR64 (moderately salinity tolerant) and Pusa-44 (salinity susceptible) varieties. The similar trend for Na⁺ accumulation was observed in the 2 PDH45 transgenic lines (L1 and L2), whereas it was less than wild type (IR64) (Fig. 2 and Table 1).

Figure 2.

CoroNa Green based Na⁺ accumulation in root of 3 rice varieties and 2 transgenic lines. Transverse section of root (1 cm from root tip). Scale bar 100 μm. (B) Enlarged view of vascular bundle. Scale bar 50 μm. WT: Wild type. (C) Labeling transverse section of root. ep: Epidermis, ex: exodermis, me: mesodermis, en: endodermis, ae: aerenchyma, and vb: vascular bundle.

Table 1.

Na⁺ accumulation in root and shoot of rice transgenic lines and varieties

		IR64	PDH45 L1	PDH45 L2	FL478	Pusa-44
Root*	Epidermis	High	Moderate	Moderate	Low	High
	Mesenchyma	High	Moderate	Moderate	Low	High
	Vascular Bundle	High	Moderate	Moderate	Low	High
Shoot	1 cm from shoot base	High	Low	Low	Low	High
	3 cm from shoot base	High	Low	Low	Low	High

^*Root florescence intensity is high as compared to shoot.

Comparative shoot anatomy at 1 cm from the shoot base (border between root-shoot), showed that IR64 and Pusa-44 accumulate high Na⁺ while PDH45 transgenic lines L1 and L2 had similar Na⁺ level. However as compared to the wild type (IR64) the Na⁺ was less in the case of transgenic lines. The lowest Na⁺ was observed in the case of salinity tolerant variety, FL478. Similar comparative shoot anatomical results were also observed for the 3 varieties and 2 transgenic lines at 2-3 cm from the shoot base (Fig. 3 and Table 1). It was observed that the Na⁺ accumulation was always higher in root as compared to shoot in all the rice varieties and transgenics studied in which experiments were performed in triplicates (Supplementary Figs. S1 and S2). The duplicate data of 2 times are shown in Supplementary Figs. S1 and S2.

Figure 3.

CoroNa Green based Na⁺ accumulation in shoot of 3 rice varieties and 2 transgenic lines. Transverse section of shoot (A). 1 cm from shoot base. (B) 3 cm from shoot base. Scale bar 200 μm. WT:-Wild type. (C) Labeling of Shoot transverse section. ep: Epidermis, en: endodermis, ae: aerenchyma, vb: vascular bundle, S: Stem, and LS: Leaf sheath.

Discussion

In rice shoots, the Na⁺ majorly enters through apoplastic bypass and is transported by apoplastic pathway using solvent drag and bypassing casparian bands.^18,19 Although exposing the rice under salinity stress leads to the deposition of suberin that further provides strength to the apoplastic barriers and such barriers block Na⁺ transport to shoots.¹⁶ The salinity tolerant variety (Pokkali) revealed more extensive hydrophobic barriers in its roots as compared to the salinity susceptible variety (IR20).^17,20

The PDH45 overexpression enhances salinity tolerance without compromising yield as compared to WT (IR64).¹¹ The results of this study, revealed differential accumulation of Na⁺ in salinity stress in 3 rice varieties and 2 transgenic lines analyzed. The comparative root Na⁺ localization analysis shows that the salinity tolerant variety (FL478) and salinity susceptible varieties (IR64 and Pusa-44) accumulate lowest and highest Na⁺, respectively. However, the PDH45 transgenic lines (L1 and L2) accumulate less Na⁺ as compare to WT (IR64). Similarly, differential Na⁺ level was also observed in shoots of all 5 rice transgenics/varieties analyzed, though the Na⁺ concentration in case of root was found higher as compared to the shoot (Fig. 2 and 3).

In salinity stress, different plant varieties respond differently via a plethora of biochemical, physiological and molecular mechanisms. Kanai et al.²¹ using CoroNa Green dye in common reed (Phragmites australis) demonstrates that the starch granule increased in response to salinity stress at shoot base and binds with Na⁺ consequently leads to the decrease in free cytosolic Na ⁺. Therefore, it was proposed that the site-specific production of Na⁺-binding starch granules constitutes a novel salt tolerance mechanism. In another report, Kavitha et al.²² found that the root protoplast of salinity tolerant variety (Pokkali) accumulate less Na⁺ compared to the salinity susceptible variety (IR20) using CoroNa Green dye. While Zhang et al.²³ reported that salinity tolerant genotypes (FL478 and IR651) accumulates less Na⁺ and also maintained lower ratios of Na⁺/K⁺, Na⁺/Ca²⁺ and Na⁺/Mg²⁺ when compared to the salinity susceptible genotypes (IR29 and Azucena) under salinity stress. Similarly in this study it was observed that salinity tolerant (FL478) and PDH45 transgenic lines accumulate less Na⁺ then salinity susceptible varieties (IR64 and Pusa-44).

The findings of present study showed that PDH45 overexpressing plants maintained comparatively lower levels of Na⁺ toxicity in roots than shoots under salinity stress might be due to the Na⁺ efflux from the roots, which is suggested earlier also.²⁴ In many dicots, Na⁺ can be retrieved and stored in leaf petioles and in stems, whereas in monocots Na⁺ ions may be retrieved and accumulated in leaf sheaths and in stems elongating regions.^25,26

The cytochrome P450, CYP86A1, ASFT, FAR1, FHT and ESB1 genes coding for a suberin biosynthetic enzyme,²⁷ which develop apoplastic barriers in roots and thereby provide tolerance in response to salt stress.¹⁴ In the present study, the differential Na⁺ accumulation in root and shoot of WT and PDH45 overexpressing transgenic lines suggested that pea DNA helicase is probably involved in the inhibition of Na⁺ entry inside root and also in Na⁺ transport from root to shoot that leads to the salinity stress tolerance via its role in the deposition of additional apoplastic barriers to block the Na⁺ entry into the cytosol. Here, findings of less Na⁺ accumulation in shoots in the tolerant rice varieties/ transgenic lines are similar with finding of Krishnamurthy et al.¹⁷ who reported that additional suberized hydrophobic barriers and reduced entry of Na⁺ into shoots under salt stress conditions. Therefore, our findings in sustaining least Na⁺ in shoot suggest that PDH45 gene may be involved similar salinity tolerance mechanism in defined tobacco (dicot) and rice (monocot) transgenic plants in response to salinity stress. However, further study is needed to investigate the precise mechanism of salinity tolerance in plant mediated via PDH45 helicase.

Materials and Methods

Plasmids construction and transformation of tobacco and rice plants

The complete ORF of PDH45 cDNA (1.2 kb; Accession number Y17186.1) was PCR amplified using the gene specific primers (Forward: GGAATTCCGGATGGCGACAACTTCTGTG Reverse: GGGGTACCCCTTATATAAGATCACCAATATTCATTGG) and cloned into pCAMBIA series of vector as described earlier.²⁸ The transgenic tobacco and IR64 rice plants overexpressing PDH45 transgenics were raised as described earlier.^29,30

Plant growth and salinity stress

WT and PDH45 transgenic plants of Tobacco were grown in vermiculite pots for 15 days. The rice varieties FL478 (salinity tolerant), salinity susceptible (Pusa-44) and WT (IR64) along with PDH45 overexpressing salinity tolerant transgenic lines (PDH45 L1 and L2) were grown in vermiculite pots for 15 days. Further, these plants were subjected to salinity stress using 200 mM NaCl for 24 hour in triplicate.

Comparative anatomy and CoroNa Green based Na⁺ localization

After imposing the salinity stress, the primary root and shoot of tobacco were sectioned using razor blade. While rice crown roots (1 cm from the root tip) and shoot (1 and 3 cm from the shoot base) of the rice transgenic/varieties were cut by free hand sectioning method using razor blade. Further, these sections were subjected to CoroNa Green AM dye (Invitrogen, Ltd., Carlsbad, CA, USA) according to the method adopted by Huda et al.³¹ Na⁺ fluorescence and image was analyzed using confocal microscopy (Model Nikon A1R). The confocal settings were as follows: excitation 488 nm, emission 510–530 nm, frame 512x 512. All the analysis was conducted in triplicate.

Authors’ Contributions

MN designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. BG designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. RKS conducted the experiments. NT designed the experiments, interpreted the results, analyzed the data and drafted the manuscript.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We thank Dr. Alok Sinha for critical reading of the manuscript.

Funding

The work on stress tolerance in N. T.'s laboratory is partially supported by Department of Biotechnology, Government of India.