Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jun 1.
Published in final edited form as: Mol Oral Microbiol. 2015 Jan 11;30(3):242–252. doi: 10.1111/omi.12089

Porphyromonas gingivalis RagB is a pro-inflammatory STAT4 agonist

Justin A Hutcherson 1, Juhi Bagaitkar 1, Keiji Nagano 2, Fuminobu Yoshimura 2, Huizhi H Wang 1,3, David A Scott 1,3,*
PMCID: PMC4624316  NIHMSID: NIHMS731725  PMID: 25418117

Summary

Periodontal diseases are semi-ubiquitous and caused by chronic, plaque-induced inflammation. The 55kDa immunodominant RagB outer membrane protein of Porphyromonas gingivalis, a keystone periodontal pathogen, has been proposed to facilitate nutrient transport. However, potential interactions between RagB and the innate response have not been examined. We determined that RagB exposure led to the differential and dose-related expression of multiple genes encoding pro-inflammatory mediators (IL-1α, IL-1β, IL-6, IL-8 and CCL2; all, p < 0.05) in primary human monocytes and to the secretion of TNF and IL-8, but not IFN-γ or IL-12. RagB was shown to be a TLR2 and TLR4 agonist that activated STAT4 and NFκB signaling. In keeping, a ΔragB mutant similarly exhibited reduced inflammatory capacity which was rescued by ragB complementation. These results suggest that RagB elicits a major pro-inflammatory response in primary human monocytes and, thus, could play an important role in the etiology of periodontitis and systemic sequelae.

Keywords: inflammation, monocyte, periodontitis, Porphyromonas gingivalis, STAT4, TLR

Introduction

Chronic periodontitis, characterized by the destruction of the hard and soft tissues surrounding the teeth, is predominantly caused by the immune response to pathogenic bacteria present in dental plaque. Porphyromonas gingivalis, a Gram negative, asaccharolytic, anaerobe, is a causative agent of chronic periodontitis and a keystone pathogen of the sub-gingival biofilm (Hajishengallis et al., 2012).

The rag locus of P. gingivalis is comprised of receptor antigen gene A (ragA, PG0185), encoding a 115 kDa TonB-dependent receptor, and ragB (PG0186), encoding a 55 kDa putative lipoprotein, related to the SusD starch utilization protein of gut Bacteroidetes (Martens et al., 2009, Hanley et al., 1999), although it has been hypothesized to function in iron acquisition in P. gingivalis (Curtis et al., 1999). The rag genes are co-transcribed, flanked by insertion sequences, and consist of a lower G+C ratio than the rest of the genome, suggesting the Rag locus is a pathogenicity island that arose from horizontal transfer (Hanley et al., 1999). While host-RagB interactions are poorly understood, RagB is the most immunodominant P. gingivalis antigen, and so is clearly recognized by the immune system (Curtis et al., 1999, Nagano et al., 2007, Imai et al., 2005). Recent data suggest that the rag operon may be essential to P. gingivalis (Klein et al., 2012).

Comparative genomics have identified RagB as potentially important in epithelial cell invasion (Dolgilevich et al., 2011) while ragB mutants exhibit reduced virulence in murine soft tissue infection models (Shi et al., 2007, Nagano et al., 2007). Furthermore, RagB has been proposed to aid P. gingivalis survival in severe forms of periodontitis (Imai et al., 2005). Thus, RagB is under investigation as a potential periodontitis vaccine (Zheng et al., 2013). Rag locus homologs found in gut Bacteroides sp. have also been shown to be associated with inflammatory bowel disease (Wei et al., 2001b).

We set out to determine the inflammatory potential of RagB and underlying mechanisms. Herein, we show, for the first time, that the RagB protein of P. gingivalis is an unusual TLR agonist that is recognized both by human monocytic TLR2 and -4, induces STAT4, activates NFκB and promotes multiple mediators of inflammation at the transcriptional and protein levels.

Results

RagB induces multiple pro-inflammatory cytokines in a dose-related manner

Recombinant RagB induces the secretion of multiple pro-inflammatory cytokines (IL-8, TNF, IL-6, all p < 0.05) from primary human monocytes in a dose-related manner, as shown in Figure 1 and Supplemental Figure 1. A RagB-induced IFN-γ or IL-12 p70 signal was not observed, while IL-10 was minimal (data not shown). Heat-treated (boiled) or denatured (SDS-treated) RagB did not induce a cytokine signal, indicating that the recombinant protein was free from immunologically significant contamination with TLR agonists including LPS, or other pyrogens, from the E. coli expression system (data not shown).

Figure 1. RagB induces pro-inflammatory cytokines.

Figure 1

Open in a new tab

Primary human monocytes were untreated or treated with E. coli LPS (0.1, or 1 μg/ml) or with RagB (0.1, 1, or 10 μg/ml). IL-8 concentrations in 20 hr cell-free supernatants were determined by ELISA. Similar results were found for IL-6 and TNF (Supplementary Figure 2).

*p<0.05, **p<0.01, ***p<0.001.

RagB induces multiple pro-inflammatory genes

Five genes were upregulated in monocytes by RagB, as determined using TLR Signaling Pathway RT2 Profiler PCR arrays, as presented in Table 1. As canonical TLR-signaling was not strongly suggested by these data, whole genome arrays were performed, with key target molecules confirmed by RT-PCR. The top inflammation-related genes induced by RagB [(i) 1.0 μg/ml > 0.1 μg/ml > 0.0 μg/ml; (ii) > 2x induction; (iii) p < 0.05; and (iv) confirmed by RT-PCR) are presented in Table 2. The full array data set is provided in Supplemental Table 2. There was considerable overlap between RagB differential monocyte genes identified in the focused TLR and genome–wide arrays (IL-1β, IL-8, IL-6). IL-8, TNF and IL-6 regulation by RagB was also seen at the protein level (Figure 1 and Supplemental Figure 1).

Table 1.

RagB induces multiple TLR-related genes in primary human monocytes.

Gene Description Fold change
IL-1β Interleukin 1, beta 83.4
IL-8 Interleukin 8 35.3
IL-1A Interleukin 1, alpha 18.7
CCL2 Chemokine (C-C motif) ligand 2 7.1
IL-6 Interleukin 6 5.8
Open in a new tab

RNA was harvested 4 hr post treatment and reverse transcribed for hTLR RT-PCR array. The 2 −ΔΔct method was used to determine significant differences from the control (unstimulated) group. 5 of the 84 genes in the TLR Signaling Pathway RT2 Profiler PCR array were upregulated, as noted above.

Table 2.

RagB induces multiple pro-inflammatory genes in dose-related manner.

Gene Fold Change
Array RT-PCR
1vs0 10vs0 1vs0
IL-6 612 800 153
CCL20 380 449 34
IL-1β 295 311 113
IL-12β 146 765 2.8
STAT4 35 51 6
TNF 24 32 9
IL-8 7.3 7.5 2.7
Open in a new tab

Primary human monocytes were stimulated with 0, 1 or 10 μg/ml of rRagB. RNA was harvested 4 hr post-stimulation and used for microarray analysis. 243 genes were differentially regulated, as determined by Bonferroni correct p-value, and also exhibited a dose-related response (10 > 1 > 0 μg/ml RagB). Selected genes were verified by RT-PCR. The complete array data set is presented in Supplemental Table 1 (*.xls file). Primers used for PCR-verification of array data are presented in Supplemental Table 2.

RagB activates TLR2 and -4

RagB induction of cytokines in monocytes was initiated by engagement of TLR2 or TLR4, as indicated by the inhibition of IL-8 release by anti-TLR antibodies and also by TLR gene silencing, as presented in Figures 2 and 3.

Figure 2. RagB signals through TLR2.

Figure 2

Figure 2

Figure 2

Figure 2

Open in a new tab

Primary human monocytes were untreated or exposed to combinations of RagB (1 μg/ml); the TLR2 agonist, Pam3CSK (1 μg/ml), anti-TLR2 (1 μg/ml, 1 hr pre- treatment) and control (IgA2, 1μg/ml, 1 hr pre-treatment) antibodies. In an alternative strategy, TLR2 gene silencing was performed, as described in the text.

(A) IL-8 concentrations in 20 hr cell-free supernatants were determined by ELISA. TLR2 knockdown was confirmed by (B) Western blot and (C) densitometry. (D) Inhibition of RagB-induced IL-8 on TLR2 gene silencing was determined by ELISA.

*p<0.05, **p<0.01, ***p<0.001. (B) and (C) represent typical data.

Figure 3. RagB signals through TLR4.

Figure 3

Figure 3

Figure 3

Figure 3

Open in a new tab

Primary human monocytes were untreated or exposed to combinations of RagB (1 μg/ml); the TLR2 agonist, E. coli LPS (1μg/ml), anti-TLR4 (1μg/ml), 1 hr pre- treatment) and control (IgG1, 1μg/ml), 1 hr pre- treatment) antibodies. In an alternative strategy, TLR4 gene silencing was performed, as described in the text.

(A) IL-8 concentrations in 20 hr cell-free supernatants were determined by ELISA. TLR4 knockdown was confirmed by (B) Western blot and (C) densitometry. (D) Inhibition of RagB-induced IL-8 on TLR4 gene silencing was determined by ELISA.

*p<0.05, **p<0.01, ***p<0.001. (B) and (C) represent typical data.

Inflammatory activity of RagB is STAT4-related

As array data suggested STAT4 may be an important regulator of RagB-induced inflammation, we examined the influence of the pharmaceutical STAT4 inhibitor, LSF, and stat4 gene silencing on RagB-induced cytokine production. Both strategies were highly effective in suppressing RagB, but not LPS-stimulated, IL-8 production (Figure 4), indicating potentially divergent signaling pathways between RagB and a classical TLR-agonist.

Figure 4. RagB-induction of IL-8 is STAT-dependent.

Figure 4

Figure 4

Figure 4

Figure 4

Open in a new tab

Primary human monocytes were untreated or exposed to combinations of RagB (1 μg/ml) and the STAT4 inhibitor, LSF (25 and 100 μM, 1 hr pre- treatment). STAT4 gene silencing was performed, as described in the text.

(A) IL-8 concentrations in 20 hr cell-free supernatants were determined by ELISA. STAT4 knockdown was confirmed by (B) Western blot and (C) densitometry. (D) Inhibition of RagB-induced IL-8 on STAT4 gene silencing was determined by ELISA.

***p<0.001. (B) and (C) represent typical data.

Inflammatory activity of RagB is p65-related

A similar approach was taken to determine the importance of the primary inflammatory gene activity regulator, p65, in RagB-induced cytokine production. Both pharmaceutical p65 inhibition, using a p65 decoy peptide, and stat4 gene silencing were potent suppressors of RagB- and, as expected, LPS-induced cytokine production (Figure 5).

Figure 5. RagB-induction of IL-8 is NfκB (p65)-dependent.

Figure 5

Figure 5

Figure 5

Figure 5

Open in a new tab

Primary human monocytes were untreated or exposed to combinations of RagB (1 μg/ml) and a p65 peptide inhibitor set (100μM, 1 hr pre- treatment). p65 gene silencing was performed, as described in the text.

(A) IL-8 concentrations in 20 hr cell-free supernatants were determined by ELISA. p65 knockdown was confirmed by (B) Western blot and (C) densitometry. (D) Inhibition of RagB-induced IL-8 on p65 gene silencing was determined by ELISA.

***p<0.001. (B) and (C) represent typical data.

RagB stimulates phosphorylation of p65 and STAT4

As shown in Figure 6, RagB induces the rapid phosphorylation of p65 (within 15 minutes) followed by the transient phosphorylation of STAT4 (within 60 – 120 minutes).

Figure 6. RagB induces the phosphorylation of STAT4 and p65.

Figure 6

Open in a new tab

Monocytes were treated with 1μg/ml rRagB. Western blot of proteins harvested at 0, 15, 30, 60, 90, 120, and 180 mins.

Results represent typical data.

Cytokine induction by whole P. gingivalis is RagB-dependent

As shown in Figure 7, a ΔragB strainP. of gingivalis induces a significantly reduced IL-8 response from primary human monocytes, compared to WT (p < 0.001). The same phenomenon was apparent for IL-6 and TNF; p < 0.001 and p < 0.01, respectively - data not shown). The introduction of ragB-expressing plasmid rescued cytokine release. These data, therefore, suggest that RagB is key to the induction of the innate response, in the context of the whole bacterium.

Figure 7. Mutation of ragB reduces P. gingivalis-induction of IL-8 production in monocytes.

Figure 7

Open in a new tab

Monocytes were incubated with fixed WT, ΔragB and pTCBex2: ragBW83-complemented P. gingivalis cells (MOI 1:10) for 18 h and IL-8 monitored in cell free supernatants by ELISA.

***p<0.001 compared to WT (W83).

Discussion

RagB is a predominant, highly antigenic, environmentally regulated, surface-exposed outer membrane protein of P. gingivalis (Bonass et al., 2000, Zeller et al., 2013, Zheng et al., 2013, Bagaitkar et al., 2009). RagB expression is temperature regulated, with increased temperature a hallmark of plaque-induced periodontal inflammation. Tobacco smoke, a major risk factor for periodontitis, promotes P. gingivalis infection (Zeller et al., 2013, Bagaitkar et al., 2008) and alters the inflammatory capacity of P. gingivalis through suppression of capsule generation, enhancement of fimbrial protein expression and augmentation of biofilm formation (Bergstrom, 2003, Bagaitkar et al., 2010, Bagaitkar et al., 2009). Tobacco smoke is also a potent inducer of RagB expression (Bagaitkar et al., 2009). RagB is homologous to the SusD group of polysaccharide uptake proteins of other Bacteroidetes species, including Bacteroides fragilis NanU (Hall et al., 2005, Phansopa et al., 2013, Bolam & Koropatkin, 2012). A Rag homologue in Bacteroides caccae (OmpW) has been associated with inflammatory bowel disease (Wei et al., 2001a, Iltanen et al., 2006). Subcutaneous inoculation of RagB mutant P. gingivalis into mice resulted in attenuated virulence, assessed as soft tissue lesion size and survival (Shi et al., 2007). Furthermore, the ability of RagB mutants to invade transformed epithelial-like cells is curtailed (Dolgilevich et al., 2011). Despite such data implicating RagB as an important immunomodulatory molecule, RagB-innate interactions have not, to the best of our knowledge, been previously examined mechanistically.

We show RagB to be a strong but unusual TLR agonist. As has been reported for P. gingivalis-derived LPS (Kocgozlu et al., 2009), RagB can engage both TLR2 and -4, resulting in the induction of multiple pro-inflammatory cytokines. This innate activation occurs in a STAT4-dependent manner, as determined using the pharmaceutical inhibitor, lisofylline, and gene silencing. STAT4 is best known as an important transcription factor in non-antigenic induction of cytokines in T-cells, type I interferon signaling, and IL-12-mediated development of Th1 cells from naive CD4+ T cells (Remoli et al., 2007, Ronnblom, 2011, Guo et al., 2009). More recently, STAT4 has been shown to be expressed in other immune cells, particularly activated monocytic cells (Remoli et al., 2007). TLR2, -3 and -4 agonists have been shown or suggested to activate STAT4 in innate immune cells, with STAT4 suggested as potential therapeutic target for various inflammatory diseases, including shock (Matsukawa et al., 2001, Kim & Chung, 2012, Kim et al., 2007, Shirota et al., 2005, Kamezaki et al., 2004, Frucht et al., 2000, Remoli et al., 2007). Whole microbial induction of STAT4 expression in innate cells has been established for Mycobacterium tuberculosis and Candida albicans (Remoli et al., 2007). STAT4 has been reported to bind to MyD88, the TLR-associated signal transducer, and also to the TNF promoter (Good et al., 2009). Indeed, microbial STAT4 activation has been shown to result in the induction of classic NFκB-regulated cytokines, but not IFNγ, in dendritic cells (Remoli et al., 2007). Similarly, we could not detect an IFN-γ signal in RagB-exposed cells, despite STAT4 upregulation. It has been reported that the activation of STAT4 by IL-12, well-defined in T cells, does not occur in innate cells of monocytic lineage (Frucht et al., 2000), indeed monocytic cell expression of IL-12 receptors is contentious (Remoli et al., 2007, Grohmann et al., 2001), and that the STAT4 promoter contains an NF-κB binding site −969/−959 bp upstream from the transcriptional start site that binds p65/p50 and p50/p50 dimers (Remoli et al., 2007). In addition to STAT4-dependence, RagB induction of pro-inflammatory cytokines requires NFκB (p65), as determined using both pharmaceutical and siRNA approaches. Thus, RagB activation of the innate response in human monocytes exhibits both classical and atypical elements of TLR signaling pathways.

Clearly, recombinant RagB may differ from the natural protein, particularly as it is not anchored in the cell membrane. With this in mind, we also examined IL6 and IL-8 production in monocytes exposed to WT, ragB mutant and complemented P. gingivalis cells. These data support a pro-inflammatory role for RagB in the context of the whole bacterium, similar to the recombinant protein.

RagB, then, seems to have two roles in P. gingivalis that could promote sub-gingival colonization. Firstly, it is assumed that the RagB, along with RagA, facilitates polysaccharide, or other nutrient, transport. As P. gingivalis is considered asaccharolytic, however, the physiological relevance of sugar uptake is not immediately transparent. Secondly, RagB, as a promoter of inflammation, is likely to contribute to the availability of protein, required by P. gingivalis as a carbon source.

It must be remembered that there is considerable antigenic variation at the rag locus, with at least four non-cross reactive RagB proteins identified (Hall et al., 2005). It is possible, then, that RagB produced by different P. gingivalis strains may have altered inflammatory activities and, thus, exhibit differing virulence potential. Indeed, the highly virulent P. gingivalis lab strains W83 (used herein) and W50 each carry rag1, which has been clinically associated with deep periodontal pockets, along with 26% of 168 isolates. The less pathogenic strain, ATCC 33277, carries rag4, along with 14% of isolates, which cross reacts poorly with W83-specific RagB antibodies (Hall et al., 2005, Imai et al., 2005, Hanley et al., 1999). This may be important in the drive to develop RagB-based vaccines for periodontal disease prevention (Zheng et al., 2013).

Established immunomodulatory virulence factors of P. gingivalis include LPS, fimbrial proteins (FimA and Mfa1), capsular polysaccharides and gingipains (Bagaitkar et al., 2010, Bostanci & Belibasakis, 2012, Guo et al., 2010, Curtis et al., 1999). It appears that RagB, which induces multiple pro-inflammatory cytokines in a dose-related, TLR-, STAT4- and p65-dependent manner, may now be added to this list.

Experimental Procedures

Materials

P. gingivalis W83 was purchased from the American Type Culture Collection (Manassas, VA); Gifu Anaerobe Medium (GAM) from Nissui Pharmaceutical (Tokyo, Japan); ΔragB and pTCBex2:ragBW83-carrying complemented P. gingivalis strains were kindly provided by Dr. Fuminobu Yoshimura (Aichi-Gakuin University, Nagoya, Japan) and have been described previously (Nagano et al., 2007) and; lymphocyte separation medium (LSM; Fischer Scientific, Pittsburgh, PA); CD14 microbeads from Miltenyi Biotec (Auburn, CA); Escherichia coli TOP10, TOPO expression kits and 5-Prime RNA kits from 5-Prime (Gaithersburg, MD); cytokine ELISAs came from R&D systems (Minneapolis, MN) and eBioscience (San Diego, CA); Human Toll-Like Receptor (TLR) Signaling Pathway RT2 Profiler PCR array and RT2 SYBR Green ROX qPCR Mastermix came from Quiagen (Valencia, CA); whole genome microarrays were from Affymetrix (Santa Clara, CA); siRNA (TLR4, sc-40260: TLR2, sc-40256: p52, sc-29409: p65, sc-29410; STAT4, sc-36568: control, sc-37007) from Santa Cruz Biotechnology (Santa Cruz, CA); ultrapure E. coli K12 LPS, anti-TLR2 and -4 antibodies (clones B4H2 and W7C11, respectively), qScript cDNA SuperMix from Quanta BioSciences Inc. (Gaithersburg, MD); THP1-XBlue NF-kB/AP-1 SEAP Reporter cells and TLR-transfected HEK293 cells came from InvivoGen (Santa Clara, CA); the STAT4 inhibitor, lysofylline (1-[(5R)-5-Hydroxyhexyl]-3,7-dimethyl-3,7-dihydro-1H-purine-2,6-dione; LSF), was from Cayman Chemical Co (Ann Arbor, MI); the p65 (Ser276) inhibitory peptide set came from Novus Biologicals (Littleton, CO); while LB agar, kanamycin, arabinose, imidazole, RPMI 1640, fetal bovine serum (FBS), penicillin G, streptomycin, proteinase K, polymyxin B and agarose came from Sigma-Aldrich (St. Louis, MO).

P. gingivalis culture

P. gingivalis was maintained as frozen stock culture, grown in GAM under anaerobic conditions (80% N2, 10% H2, 10% CO2) at 37°C in a Coy Laboratories (Grass Lake Charter Township, MI) anaerobic chamber and harvested at an OD600 of 1 (1 × 109 bacteria/ml). Purity of the cultures was routinely screened by Gram stain.

Isolation and maintenance of primary blood mononuclear cells (PBMCs) and monocytes

Whole blood was isolated from anonymized consenting, healthy donors (≥ 18 years; ≥ 49.9 kg; free of any chronic health problems; medication free; hemoglobin ≥ 12.5 gr/dl; not pregnant). Buffy coat was collected from an LSM gradient, washed in PBS (10mM, pH 7.2) and monocytes isolated from PBMCs using CD14 microbeads. Purified monocytes were maintained in RPMI 1640 containing 10% FBS, 100 μg/ml penicillin G, 100 μg/ml streptomycin, 37°C, 5% CO2. Monocyte preparations were routinely > 95% pure and > 96% viable. For siRNA transfection, monocytes were isolated by negative selection. Blood collection was approved by the Institutional Research Board of the University of Louisville.

Production and purification of RagB

Genomic DNA was isolated from P. gingivalis W83 and the ragB gene was amplified by PCR (Fwd: CACCGAGCTTGACCGCGACCCC; Rev: TATCGGCCAGTTCTTTATTAACTGCGG). The ragB gene product was purified by electrophoresisis 1% agarose gel and transformed into E.coli TOP10 using the pBAD202D-TOPO vector and the TOPO expression kit, according to the manufacturer’s instructions. Transformants were selected by screening using LB agar plates containing 50 μg/ml kanamycin and PCR confirmation of ragB uptake. RagB expression was induced by arabinose and the full length, his-tagged protein collected by column purification (300mM imidazole fraction; HiTrap Chelating HP column) and dialyzed in PBS. Purity confirmed by SDS-PAGE and sequencing by mass spectrometry. Sequence comparison, using UNIPROTKB (Consortium, 2014), and structural prediction, using the Phyre2 server at Imperial College London, UK (Kelley & Sternberg, 2009), were employed to confirm RagB identity, both with 100% confidence (P. gingivalis W83 RagB and Bacteroidetes SusD-like protein, respectively; Supplemental Figure 2).

Quantification of RagB-induced cytokines

PBMCs and primary monocytes were rested overnight in 96 (300,000 cells/well) or 6 well (3 × 106 cells/well) plates, 37°C, 5% CO2. Innate cells were incubated with RagB and various agonists and inhibitors, under the conditions described in the figure legends. Cytokine release was determined by ELISA. Lack of biologically meaningful recombinant protein contamination with vector TLR agonists was confirmed by analysis of cytokine release from monocytes exposed to denatured (SDS-treated), heat-treated (boiled) and polymyxin B-treated RagB preparations (data not shown).

Quantification of RagB-induced genes

RNA was harvested from primary human monocytes 4 hr after stimulation with RagB. RagB-induced genes were determined by (a) TLR Signaling Pathway RT2 Profiler PCR arrays (0 vs 1 μg/ml RagB) and (b) whole genome microarrays (0 vs 1 vs 10 μg/ml RagB), with (c) activation of promising candidate genes confirmed by qPCR. (a) Human TLR Signaling Pathway RT2 Profiler PCR arrays (100ng of total RNA per array) were performed, according to the manufacturer’s instructions, with RT-PCR performed using the ABI 7500 system (Life Technologies, Grand Island, NY). PBS control and RagB stimulations were compared using the ΔΔCT method. (b) GeneChip® 3’ IVT Express kits were used to prepare RNA for microarray analyses. Human PrimeView arrays (100 ng of total RNA per array) were scanned using Command Console 3.2 (Affymetrix, St. Clara CA), according to the manufacturer’s instructions, and files imported into Genomics Suite 6.6 (Partek Inc., Saint Louis, MO) for summarization and background correction using RNA. One way ANOVA was conducted to compare the individual treatment conditions. FDR was conducted along with the Bonferroni corrected p-value test. Ingenuity IPA software (Redwood City, CA) was used to select for genes: ± 2 fold change, p<0.001, RagB 10 μl treatment group > fold change than 1 μl treatment group when compared with negative control. (c) For qPCR of selected RagB regulated monocyte genes, RNA concentration was measured using Nanodrop Spectrophotometer ND-1000 (Wilmington, DE) and cDNA reverse transcribed using qScript cDNA SuperMix, according to manufacturer’s protocol. RT2 SYBR Green ROX qPCR Mastermix along with 1/10th of cDNA synthesis reaction was added to PCR tubes with total volume of 25 μl. The primers used are listed in Supplementary Table 1 and were employed at a final concentration of 25 pM per tube. RT-PCR was conducted using ABI 7500 system with the following cycle conditions: 2 mins at 50°C; 10 mins at 95°C; 15 sec at 95°C, 1 min at 55°C for 40 cycles.

Gene silencing

TLR2, TLR4, p65 and STAT4 genes were individually silenced in human monocytes by siRNA transfection using the 4D-Nucleofactor system (Lonza Group, Allendale, NJ), according to the manufacturer’s P3 primary cell protocol. Briefly, ~4 million cells were suspended in 100μl transfection reagent in single nucleocuvettes and 3μL (30 pM) of siRNA added. Transfected monocytes were rested in RPMI 1640 containing 10% FBS for 48 h at 37°C prior to stimulation with RagB and other agonists, as described in the Figure legends.

Induction of cytokines by whole P. gingivalis

P. gingivalis (WT, ragB and ragB complemented strain) was fixed in 1% paraformaldehyde for one hour and washed with PBS. Monocytes were stimulated with MOI 1:10 fixed P. gingivalis strains for 18 h and cytokines (Il-6, IL-8) measured in cell free supernatants by ELISA.

Quantitative Data and Statistical Analyses

All experiments were performed in triplicate. All results are presented as mean (± s.d.), unless otherwise stated. Comparisons between groups were analyzed by t-test or one-way ANOVA using Prism 5 software (GraphPad, La Jolla, CA). Significance was accepted at p ≤ 0.05.

Supplementary Material

Acknowledgments

This work was kindly supported by NIDCR (R01DE019826; DAS).

Footnotes

Conflict of Interest

The authors have no conflict of interest to declare.

References

  1. Bagaitkar J, Demuth DR, Daep CA, Renaud DE, Pierce DL, Scott DA. Tobacco upregulates P. gingivalis fimbrial proteins which induce TLR2 hyposensitivity. PLoS One. 2010;5:e9323. doi: 10.1371/journal.pone.0009323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bagaitkar J, Demuth DR, Scott DA. Increased susceptibility to bacterial infections in tobacco smokers. Tobacco Induced Diseases. 2008;4 [Google Scholar]
  3. Bagaitkar J, Scott DA, Williams LR, Renaud DE, Daep C, Martin M, Demuth DR. Tobacco-induced alterations to Porphyromonas gingivalis-host interactions. Environmental Microbiology. 2009;11:1242–1253. doi: 10.1111/j.1462-2920.2008.01852.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bergstrom J. Tobacco smoking and risk for periodontal disease. J Clin Periodontol. 2003;30:107–113. doi: 10.1034/j.1600-051x.2003.00272.x. [DOI] [PubMed] [Google Scholar]
  5. Bolam DN, Koropatkin NM. Glycan recognition by the Bacteroidetes Sus-like systems. Curr Opin Struct Biol. 2012;22:563–569. doi: 10.1016/j.sbi.2012.06.006. [DOI] [PubMed] [Google Scholar]
  6. Bonass WA, Marsh PD, Percival RS, Aduse-Opoku J, Hanley SA, Devine DA, Curtis MA. Identification of ragAB as a temperature-regulated operon of Porphyromonas gingivalis W50 using differential display of randomly primed RNA. Infect Immun. 2000;68:4012–4017. doi: 10.1128/iai.68.7.4012-4017.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett. 2012;333:1–9. doi: 10.1111/j.1574-6968.2012.02579.x. [DOI] [PubMed] [Google Scholar]
  8. Consortium TU. Activities at the Universal Protein Resource (UniProt) Nucleic Acids Research. 2014;42:D191–D198. doi: 10.1093/nar/gkt1140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Curtis MA, Hanley SA, Aduse-Opoku J. The rag locus of Porphyromonas gingivalis: a novel pathogenicity island. J Periodontal Res. 1999;34:400–405. doi: 10.1111/j.1600-0765.1999.tb02273.x. [DOI] [PubMed] [Google Scholar]
  10. Dolgilevich S, Rafferty B, Luchinskaya D, Kozarov E. Genomic comparison of invasive and rare non-invasive strains reveals Porphyromonas gingivalis genetic polymorphisms. J Oral Microbiol. 2011;3 doi: 10.3402/jom.v3i0.5764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Frucht DM, Aringer M, Galon J, Danning C, Brown M, Fan S, Centola M, Wu CY, Yamada N, El Gabalawy H, O’Shea JJ. Stat4 is expressed in activated peripheral blood monocytes, dendritic cells, and macrophages at sites of Th1-mediated inflammation. J Immunol. 2000;164:4659–4664. doi: 10.4049/jimmunol.164.9.4659. [DOI] [PubMed] [Google Scholar]
  12. Good SR, V, Thieu T, Mathur AN, Yu Q, Stritesky GL, Yeh N, O’Malley JT, Perumal NB, Kaplan MH. Temporal induction pattern of STAT4 target genes defines potential for Th1 lineage-specific programming. J Immunol. 2009;183:3839–3847. doi: 10.4049/jimmunol.0901411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Grohmann U, Belladonna ML, Vacca C, Bianchi R, Fallarino F, Orabona C, Fioretti MC, Puccetti P. Positive regulatory role of IL-12 in macrophages and modulation by IFN-gamma. J Immunol. 2001;167:221–227. doi: 10.4049/jimmunol.167.1.221. [DOI] [PubMed] [Google Scholar]
  14. Guo L, Wei G, Zhu J, Liao W, Leonard WJ, Zhao K, Paul W. IL-1 family members and STAT activators induce cytokine production by Th2, Th17, and Th1 cells. Proc Natl Acad Sci U S A. 2009;106:13463–13468. doi: 10.1073/pnas.0906988106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guo Y, Nguyen KA, Potempa J. Dichotomy of gingipains action as virulence factors: from cleaving substrates with the precision of a surgeon’s knife to a meat chopper-like brutal degradation of proteins. Periodontol 2000. 2010;54:15–44. doi: 10.1111/j.1600-0757.2010.00377.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hajishengallis G, Darveau RP, Curtis MA. The keystone-pathogen hypothesis. Nat Rev Microbiol. 2012 doi: 10.1038/nrmicro2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hall LM, Fawell SC, Shi X, Faray-Kele MC, Aduse-Opoku J, Whiley RA, Curtis MA. Sequence diversity and antigenic variation at the rag locus of Porphyromonas gingivalis. Infect Immun. 2005;73:4253–4262. doi: 10.1128/IAI.73.7.4253-4262.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hanley SA, Aduse-Opoku J, Curtis MA. A 55-kilodalton immunodominant antigen of Porphyromonas gingivalis W50 has arisen via horizontal gene transfer. Infect Immun. 1999;67:1157–1171. doi: 10.1128/iai.67.3.1157-1171.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Iltanen S, Tervo L, Halttunen T, Wei B, Braun J, Rantala I, Honkanen T, Kronenberg M, Cheroutre H, Turovskaya O, Autio V, Ashorn M. Elevated serum anti-I2 and anti-OmpW antibody levels in children with IBD. Inflamm Bowel Dis. 2006;12:389–394. doi: 10.1097/01.MIB.0000218765.84087.42. [DOI] [PubMed] [Google Scholar]
  20. Imai M, Murakami Y, Nagano K, Nakamura H, Yoshimura F. Major outer membrane proteins from Porphyromonas gingivalis: strain variation, distribution, and clinical significance in periradicular lesions. Eur J Oral Sci. 2005;113:391–399. doi: 10.1111/j.1600-0722.2005.00235.x. [DOI] [PubMed] [Google Scholar]
  21. Kamezaki K, Shimoda K, Numata A, Matsuda T, Nakayama K, Harada M. The role of Tyk2, Stat1 and Stat4 in LPS-induced endotoxin signals. Int Immunol. 2004;16:1173–1179. doi: 10.1093/intimm/dxh118. [DOI] [PubMed] [Google Scholar]
  22. Kelley LA, Sternberg MJ. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc. 2009;4:363–371. doi: 10.1038/nprot.2009.2. [DOI] [PubMed] [Google Scholar]
  23. Kim HS, Chung DH. TLR4-mediated IL-12 production enhances IFN-gamma and IL-1beta production, which inhibits TGF-beta production and promotes antibody-induced joint inflammation. Arthritis Res Ther. 2012;14:R210. doi: 10.1186/ar4048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kim YK, Oh SY, Jeon SG, Park HW, Lee SY, Chun EY, Bang B, Lee HS, Oh MH, Kim YS, Kim JH, Gho YS, Cho SH, Min KU, Kim YY, Zhu Z. Airway exposure levels of lipopolysaccharide determine type 1 versus type 2 experimental asthma. J Immunol. 2007;178:5375–5382. doi: 10.4049/jimmunol.178.8.5375. [DOI] [PubMed] [Google Scholar]
  25. Klein BA, Tenorio EL, Lazinski DW, Camilli A, Duncan MJ, Hu LT. Identification of essential genes of the periodontal pathogen Porphyromonas gingivalis. BMC Genomics. 2012;13:578. doi: 10.1186/1471-2164-13-578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kocgozlu L, Elkaim R, Tenenbaum H, Werner S. Variable cell responses to P. gingivalis lipopolysaccharide. J Dent Res. 2009;88:741–745. doi: 10.1177/0022034509341166. [DOI] [PubMed] [Google Scholar]
  27. Martens EC, Koropatkin NM, Smith TJ, Gordon JI. Complex glycan catabolism by the human gut microbiota: the Bacteroidetes Sus-like paradigm. J Biol Chem. 2009;284:24673–24677. doi: 10.1074/jbc.R109.022848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Matsukawa A, Kaplan MH, Hogaboam CM, Lukacs NW, Kunkel SL. Pivotal role of signal transducer and activator of transcription (Stat)4 and Stat6 in the innate immune response during sepsis. J Exp Med. 2001;193:679–688. doi: 10.1084/jem.193.6.679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nagano K, Murakami Y, Nishikawa K, Sakakibara J, Shimozato K, Yoshimura F. Characterization of RagA and RagB in Porphyromonas gingivalis: study using gene-deletion mutants. J Med Microbiol. 2007;56:1536–1548. doi: 10.1099/jmm.0.47289-0. [DOI] [PubMed] [Google Scholar]
  30. Phansopa C, Roy S, Rafferty JB, Douglas CW, Pandhal J, Wright PC, Kelly DJ, Stafford GP. Structural and functional characterisation of NanU, a novel high-affinity sialic acid-inducible binding protein of oral and gut-dwelling Bacteroidetes spp. Biochem J. 2013 doi: 10.1042/BJ20131415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Remoli ME, Ragimbeau J, Giacomini E, Gafa V, Severa M, Lande R, Pellegrini S, Coccia EM. NF-kB is required for STAT-4 expression during dendritic cell maturation. J Leukoc Biol. 2007;81:355–363. doi: 10.1189/jlb.0506319. [DOI] [PubMed] [Google Scholar]
  32. Ronnblom L. The type I interferon system in the etiopathogenesis of autoimmune diseases. Ups J Med Sci. 2011;116:227–237. doi: 10.3109/03009734.2011.624649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shi X, Hanley SA, Faray-Kele MC, Fawell SC, Aduse-Opoku J, Whiley RA, Curtis MA, Hall LM. The rag locus of Porphyromonas gingivalis contributes to virulence in a murine model of soft tissue destruction. Infect Immun. 2007;75:2071–2074. doi: 10.1128/IAI.01785-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shirota H, Gursel I, Gursel M, Klinman DM. Suppressive oligodeoxynucleotides protect mice from lethal endotoxic shock. J Immunol. 2005;174:4579–4583. doi: 10.4049/jimmunol.174.8.4579. [DOI] [PubMed] [Google Scholar]
  35. Wei B, Dalwadi H, Gordon LK, Landers C, Bruckner D, Targan SR, Braun J. Molecular cloning of a Bacteroides caccae TonB-linked outer membrane protein identified by an inflammatory bowel disease marker antibody. Infect Immun. 2001a;69:6044–6054. doi: 10.1128/IAI.69.10.6044-6054.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wei B, Dalwadi H, Gordon LK, Landers C, Bruckner D, Targan SR, Braun J. Molecular cloning of a Bacteroides caccae TonB-linked outer membrane protein identified by an inflammatory bowel disease marker antibody. Infect Immun. 2001b;69:6044–6054. doi: 10.1128/IAI.69.10.6044-6054.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zeller I, Hutcherson JA, Lamont RJ, Demuth DR, Gumus P, Nizam N, Buduneli N, Scott DA. Altered Antigenic Profiling and Infectivity of Porphyromonas Gingivalis in Smokers and Non-Smokers With Periodontitis. J Periodontol. 2013 doi: 10.1902/jop.2013.130336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zheng D, Sun Q, Su Z, Kong F, Shi X, Tong J, Shen P, Peng T, Wang S, Xu H. Enhancing specific-antibody production to the ragB vaccine with GITRL that expand Tfh, IFN-gamma(+) T cells and attenuates Porphyromonas gingivalis infection in mice. PLoS One. 2013;8:e59604. doi: 10.1371/journal.pone.0059604. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS731725-supplement-supplement_1.pdf (155.4KB, pdf)

RESOURCES