Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2015 Oct 29;10(10):e0141792. doi: 10.1371/journal.pone.0141792

Genetic Differentiation and Spatial Structure of Phellinus noxius, the Causal Agent of Brown Root Rot of Woody Plants in Japan

Mitsuteru Akiba 1,*, Yuko Ota 1, Isheng J Tsai 2, Tsutomu Hattori 1, Norio Sahashi 1, Taisei Kikuchi 3
Editor: Sabrina Sarrocco4
PMCID: PMC4626371  PMID: 26513585

Abstract

Phellinus noxius is a pathogenic fungus that causes brown root rot disease in a variety of tree species. This fungus is distributed in tropical and sub-tropical regions of Southeast and East Asia, Oceania, Australia, Central America and Africa. In Japan, it was first discovered on Ishigaki Island in Okinawa Prefecture in 1988; since then, it has been found on several of the Ryukyu Islands. Recently, this fungus was identified from the Ogasawara (Bonin) Islands, where it has killed trees, including rare endemic tree species. For effective control or quarantine methods, it is important to clarify whether the Japanese populations of P. noxius are indigenous to the area or if they have been introduced from other areas. We developed 20 microsatellite markers from genome assembly of P. noxius and genotyped 128 isolates from 12 of the Ryukyu Islands and 3 of the Ogasawara Islands. All isolates had unique genotypes, indicating that basidiospore infection is a primary dissemination method for the formation of new disease foci. Genetic structure analyses strongly supported genetic differentiation between the Ryukyu populations and the Ogasawara populations of P. noxius. High polymorphism of microsatellite loci suggests that Japanese populations are indigenous or were introduced a very long time ago. We discuss differences in invasion patterns between the Ryukyu Islands and the Ogasawara Islands.

Introduction

Phellinus noxius (Corner) G. Cunn. (Hymenochaetaceae) is a pathogenic fungus that causes brown root rot disease in a variety of tree species [1–7]. The fungus is distributed in tropical and sub-tropical regions in Southeast and East Asia, Oceania, Australia, Central America and Africa [6,8–14]. Infection causes slow and reduced growth in trees, discolouration and wilting of leaves, defoliation, and dieback of branches [14,15]. Most affected trees eventually die, and in some cases, the fungus causes the rapid wilt and death of the tree within a few months of infection [8,11,12]. The host range of the fungus is very wide [1,6], showing little host specificity [5,7,16], and to date more than 200 woody plant species representing 59 families have been recorded as host plants[12]. The life cycle of P. noxius is similar to that of other important forest pathogens, such as Phellinus sulphurascens Pilát that causes laminated root rot of conifers [17] and Armillaria spp. that cause Armillaria root rot of woody plants [18]. The fungus infects host trees via root-to-root contact from adjacent infected trees, or from wood debris of dead trees where P. noxius can persist saprophytically more than ten years [19]. Basidiospores may function to establish new disease foci [1,14], but remain undocumented in P. noxius.

In Japan, brown root rot was first found in windbreaks composed of Casuarina equisetifolia L. on Ishigaki Island in Okinawa Prefecture in 1988 [20]. Since then, the disease has gained increasing attention as it has appeared on several islands of the Ryukyu Islands in both Okinawa and Kagoshima Prefectures, causing serious problems for shade, windbreak, and ornamental or landscape trees [14,21–23]. Amami-Oshima Island currently represents the northernmost distribution point of the disease [23]. In 2012, this fungus was identified on the Ogasawara (Bonin) Islands, oceanic islands located approximately 1,000 km south of Tokyo, where it killed trees, including rare species endemic to the islands (Sahashi et al. personal communication).

Phellinus noxius is suspected to be indigenous to many tropical or subtropical areas throughout the world [8]; however, whether P. noxius in Japan is indigenous or has been introduced from other areas remains unclear. Phellinus noxius on the Ogasawara Islands was possibly introduced from the Ryukyu Islands, as several tree species, including Bischofia javanica Blume and Pinus luchuensis Mayr were introduced to these islands from the Ryukyus as timber or fuel trees in the early 1900s [24]. To establish effective control or quarantine methods for brown root rot, it is important to first determine whether the Japanese populations are indigenous to the area or introduced from other areas.

Simple sequence repeats (SSRs) or microsatellites are a group of DNA sequences with repeating units of 2–6 base pairs (bp) that are abundant in most genomes exhibiting high levels of polymorphism [25,26]. Hence, SSRs are useful molecular markers for analysing genetic diversity and have recently been used for a robust assessment of population structure in various plant pathogens [27–30]. In this study, we developed microsatellite markers based on the de novo sequencing assembly of a Japanese isolate and then analysed genetic diversity or genetic structure in P. noxius in Japan. Although population genetics studies using microsatellite markers have been conducted for other similar root rot pathogenic fungi distributed in cool- or warm-temperate areas, including Armillaria spp. [31–33] and Heterobasidion spp. [29,34], this study is the first to examine the population genetics of wood-decay and tree pathogenic fungi in a tropical or subtropical area.

Materials and Methods

Isolates

The isolates of Phellinus noxius used in this study are listed in Table 1. We collected infected root samples or basidiocarps (for isolate KPN246 only) from 12 of the Ryukyu Islands in 1990–2010 [14] and from 3 of the Ogasawara Islands in 2012–2013 (Fig 1). Phellinus noxius was isolated using the methods described in Sahashi et al. (2012) [14]. Isolates were cultured on potato dextrose agar (PDA; Nissui, Tokyo, Japan) in test tubes and were maintained at 25°C using periodical subculture at the Forestry and Forest Products Research Institute (FFPRI, Tsukuba, Japan). Unless two isolates from the same region were found genetically incompatible, one isolate per disease foci was used for subsequent analysis. Moreover, one isolate (P919-02W.1) of P. noxius from Pohnpei Island, Federated Stated of Micronesia, isolated by Y. Ota and N. Sahashi in 2013 was included in the development of the microsatellite marker to guarantee the robustness of the markers for future worldwide analyses.

Table 1. Location, hosts, ploidy for Phellinus noxius isolates used in this study.

Isolate Year Prefecture, Country Island Latitude (°N) Longitude (°E) Host Ploidy a
KPN56 2004 Kagoshima, Japan Amami-Oshima 28.47552 129.70608 Cinnamomum yabunikkei Diploid
KPN21 b 2002 28.47152 129.71311 Amygdalus persica Haploid
KPN57 2004 28.47152 129.71311 Pittosporum tobira Diploid
KPN53 2004 28.44750 129.67508 Elaeocarpus zollingeri Haploid
KPN19 2002 28.43551 129.70814 Glochidion obovatum Diploid
KPN65 2005 28.41099 129.66938 Rhaphiolepis indica var. umbellata Haploid
KPN24 2003 28.41224 129.62836 Litsea japonica Diploid
KPN23 2003 28.47518 129.60858 Cinnamomum yabunikkei Diploid
KPN59 2006 Kikai 28.31838 129.92567 Cinnamomum yabunikkei Diploid
KPN92 b 2007 28.31838 129.92567 Casuarina equisetifolia Diploid
KPN62 2006 28.31017 129.98400 Cinnamomum yabunikkei Diploid
KPN63 2006 28.34193 130.00869 Cinnamomum yabunikkei Haploid
KPN64 2006 28.33032 129.99694 Cinnamomum yabunikkei Haploid
KPN98 2007 28.30613 129.98222 Cinnamomum yabunikkei Diploid
KPN9 2001 28.28914 129.96335 Cinnamomum yabunikkei Haploid
KPN84 2007 Tokunoshima 27.83103 128.88351 Rhaphiolepis indica var. umbellata Diploid
KPN87 2007 27.71696 128.89028 Rhaphiolepis indica var. umbellata Diploid
KPN90 2007 27.69066 128.99754 Cinnamomum yabunikkei Haploid
KPN13 2001 27.68011 128.97378 Casuarina equisetifolia Diploid
KPN1 b 1999 27.68651 128.93357 Ardisia sieboldii Haploid
KPN7 1999 27.84536 128.90158 Nandina domestica Haploid
KPN26 2003 Okinoerabu 27.40112 128.65975 Rhaphiolepis indica var. umbellata Diploid
KPN28 c 2003 27.39265 128.64336 Ficus microcarpa Haploid
KPN30 2003 27.39265 128.64336 Ficus virgata Haploid
KPN31 2003 27.38978 128.59201 Elaeocarpus zollingeri Diploid
KPN47 2004 Yoron 27.06370 128.43158 Litsea japonica Haploid
KPN49 2004 27.06370 128.43158 Cinnamomum yabunikkei Haploid
KPN46 2004 27.06193 128.42653 Cinnamomum yabunikkei Haploid
KPN50 2004 27.02536 128.45194 Hibiscus rosa-sinensis Haploid
KPN44 2004 27.03909 128.42886 Cinnamomum yabunikkei Haploid
KPN15 2001 unknown unknown Ficus microcarpa Haploid
KPN35 2003 Okinawa, Japan Okinawa 26.24259 127.68431 Hibiscus tiliaceus Diploid
KPN39 2003 26.59401 127.96972 Distylium racemosum Haploid
KPN41 2003 26.60516 127.99717 Litchi chinensis Haploid
KPN42 2003 26.68154 127.88200 Casuarina equisetifolia Diploid
KPN43 2003 26.11156 127.66983 Casuarina equisetifolia Diploid
KPN135 2010 26.61851 127.98339 Casuarina equisetifolia Diploid
KPN141 c 2010 26.62493 128.02231 Casuarina equisetifolia Diploid
KPN142 2010 26.69022 128.11341 Cinnamomum doederleinii Diploid
KPN145 b 2010 26.17121 127.78491 Casuarina equisetifolia Diploid
KPN147 2010 26.17121 127.78491 Casuarina equisetifolia Haploid
KPN449 2014 26.69177 127.87907 Ficus microcarpa Diploid
KPN169 2012 Iheya 27.04023 127.97202 Casuarina equisetifolia Diploid
KPN172 2012 27.08177 128.00682 Casuarina equisetifolia Diploid
KPN174 2012 27.06320 127.97353 Cinnamomum doederleinii Diploid
KPN175 2012 26.99897 127.92585 Casuarina equisetifolia Diploid
KPN178 2012 27.02864 127.96016 Machilus thunbergii Diploid
KPN127 2010 Kume 26.34267 126.81732 Machilus thunbergii Diploid
KPN128 2010 26.35952 126.80051 Cinnamomum doederleinii Diploid
KPN129 2010 26.36412 126.79836 Cinnamomum yabunikkei Diploid
KPN131 2010 26.38016 126.78082 Cerasus campanulata Diploid
KPN132 c 2010 26.31791 126.77623 Casuarina equisetifolia Haploid
KPN133 2010 26.31691 126.77556 Cinnamomum yabunikkei Diploid
KPN161 2012 Tokashiki 26.15993 127.35199 Cinnamomum doederleinii Diploid
KPN163 2012 26.15922 127.35211 Cinnamomum doederleinii Diploid
KPN164 2012 26.15922 127.35211 Broadleaf tree Diploid
KPN168 2012 26.15518 127.34779 Rhaphiolepis indica var. umbellata Diploid
KPN101 2009 Miyako 24.84565 125.29655 Calophyllum inophyllum Diploid
KPN104 2009 24.86451 125.29092 Acacia confusa Haploid
KPN106 2009 24.93732 125.23983 Casuarina equisetifolia Diploid
KPN110 2009 24.82459 125.31910 Casuarina equisetifolia Diploid
KPN112 2009 24.82365 125.31932 Leucaena leucocephala Diploid
KPN116 2009 24.81788 125.31527 Heliotropium foertherianum Diploid
KPN117 2009 24.80366 125.32783 Ceiba speciosa Diploid
KPN119 2009 24.79894 125.31681 Erythrina variegata Diploid
KPN121 b 2009 24.78544 125.35792 Casuarina equisetifolia Haploid
KPN122 2009 24.77356 125.38921 Casuarina equisetifolia Diploid
KPN123 2009 24.76292 125.39249 Casuarina equisetifolia Diploid
KPN124 2009 24.73607 125.36335 Casuarina equisetifolia Diploid
KPN126 2009 24.74007 125.30943 Broadleaf tree Haploid
KPN76 2007 Ishigaki 24.37751 124.19691 Eugenia uniflora Diploid
KPN78 2007 24.37654 124.19498 Garcinia subelliptica Diploid
KPN79 2007 24.34543 124.15974 Diospyros egbert-walkeri Diploid
KPN80 c 2007 24.34441 124.15791 Ehretia philippinensis Haploid
KPN82 2007 Iriomote 24.27107 123.87912 Melia azedarach Haploid
KPN149 2010 24.27181 123.87799 Melia azedarach Diploid
KPN152 2010 24.42700 123.77603 Casuarina equisetifolia Diploid
KPN156 2010 24.39858 123.77030 Leucaena leucocephala Diploid
KPN157 b , d 2010 24.40160 123.77489 Leucaena leucocephala Haploid
KPN159 2010 24.40160 123.77489 Macaranga tanarius var. tomentosa Diploid
KPN363 2013 24.39606 123.80214 Ceiba speciosa Diploid
KPN362 2013 24.29768 123.87156 Morus australis Diploid
KPN364 2013 24.27054 123.84159 Leucaena leucocephala Diploid
KPN365 2013 24.42606 123.79222 Calophyllum inophyllum Diploid
KPN259 2013 Tokyo, Japan Ani-jima 27.11748 142.20807 Terminalia catappa Diploid
KPN256 b 2013 27.11709 142.20885 Planchonella obovata Diploid
KPN261 2013 27.11665 142.21327 Distylium lepidotum Diploid
KPN264 2013 27.11064 142.20714 Rhaphiolepis indica var. umbellata Diploid
KPN179 2012 Chichi-jima 27.07750 142.21767 Neolitsea sericea var. aurata Diploid
KPN180 2012 27.08063 142.22117 Rhaphiolepis indica var. umbellata Diploid
KPN186 2012 27.08093 142.22260 Neolitsea sericea var. aurata Diploid
KPN190 2012 27.07420 142.22237 Planchonella obovata Diploid
KPN294 2013 27.08575 142.21750 Casuarina equisetifolia Diploid
KPN194 2012 27.05400 142.20829 Trema orientalis Diploid
KPN200 2012 27.05117 142.21042 Ardisia sieboldii Diploid
KPN247 2012 27.06806 142.20616 Ficus bengalensis Diploid
KPN280 c 2013 27.08678 142.21696 Ardisia sieboldii Diploid
KPN255 2012 27.09332 142.18943 Leucaena leucocephala Diploid
KPN267 2013 27.05783 142.21834 Cinnamomum pseudopedunculatum Diploid
KPN268 2013 27.05530 142.21658 Schima boninensis Diploid
KPN270 2013 27.05439 142.21645 Rhaphiolepis indica var. umbellata Haploid
KPN273 2013 27.07182 142.21712 Broadleaf tree Diploid
KPN276 2013 27.07217 142.21666 Rhaphiolepis indica var. umbellata Diploid
KPN278 2013 27.07228 142.21649 Mangifera indica Diploid
KPN289 c 2013 27.08087 142.21655 Osmanthus insularis Diploid
KPN299 2013 27.09527 142.20975 Rhaphiolepis indica var. umbellata Diploid
KPN308 2013 27.09522 142.20927 Rhaphiolepis indica var. umbellata Diploid
KPN332 2013 27.09688 142.19466 Rhaphiolepis indica var. umbellata Diploid
KPN333 2013 27.09688 142.19466 Rhaphiolepis indica var. umbellata Diploid
KPN257 2012 27.05830 142.19478 Morus australis Diploid
KPN203 2012 Haha-jima 26.65564 142.15241 Rhaphiolepis indica var. umbellata Diploid
KPN204 2012 26.67795 142.14669 Broadleaf tree Diploid
KPN205 2012 26.68171 142.14363 Rhaphiolepis indica var. umbellata Diploid
KPN206 2012 26.69794 142.14303 Morus australis Diploid
KPN207 2012 26.62729 142.17916 Trema orientalis Diploid
KPN309 2013 26.62324 142.17892 Planchonella obovata Diploid
KPN212 2012 26.62301 142.17853 Rhaphiolepis indica var. umbellata Diploid
KPN319 2013 26.62433 142.17750 Broadleaf tree Diploid
KPN229 2012 26.69555 142.14586 Rhaphiolepis indica var. umbellata Diploid
KPN231 2012 26.64387 142.15549 Leucaena leucocephala Diploid
KPN233 2012 26.64751 142.16940 Ligustrum micranthum Diploid
KPN238 2012 26.65098 142.15992 Cinnamomum pseudopedunculatum Diploid
KPN246 2012 26.65146 142.16913 Basidiocarp Diploid
KPN331 2013 26.65146 142.16913 Ficus elastica Diploid
KPN318 2013 26.62428 142.17763 Celtis boninensis Diploid
KPN321 2013 26.67099 142.15536 Broadleaf tree Diploid
KPN323 2013 26.67478 142.15578 Broadleaf tree Diploid
KPN328 2013 26.70242 142.14421 Broadleaf tree Diploid
KPN330 2013 26.70176 142.14467 Broadleaf tree Diploid
P919-02W.1 b , d 2013 Federated States of Micronesia Pohnpei 6.82381 158.17033 Ficus tinctoria Diploid
Open in a new tab

a Ploidy was determined from genotyping data.

b Isolates used in first and second screening of microsatellite markers.

c Isolates used in second screening of microsatellite markers.

d Isolates used only in screening of microsatellite markers.

Fig 1. Location of the sampling sites for P. noxius isolates used in this study.

Fig 1

Open in a new tab

Red circles indicate the sampling sites for each isolate.

DNA extraction

Fungal DNA was extracted from mycelia as described in Ota et al. (2014) [35]. Cultures were grown in 10 mL MYG medium (2% malt extract, 0.2% yeast extract, and 2% glucose) at 25°C in the dark and were harvested 7 days after inoculation. DNA was extracted from frozen mycelia using a DNeasy Plant Mini kit (Qiagen, Valencia, California) according to the manufacture’s instructions after grinding mycelia into a fine, dry powder using a mortar and pestle in liquid nitrogen.

Microsatellite marker development

Genomic DNA (1 μg) extracted from P. noxius KPN92 were used to construct standard 350 bp libraries using the TruSeq DNA Sample Preparation Kit (Illumina, San Diego, California). Libraries were sequenced on an Illumina HiSeq2000 following the manufacturer’s recommended protocol to produce 100 bp paired-end reads. Assemblies of P. noxious genome sequences were constructed from Illumina reads using an MaSuRCA assembler [36] with the following options: GRAPH_KMER_SIZE = auto, ovlMerSize = 30, cgwErrorRate = 0.15, utgErrorRate = 0.015, and KMER_COUNT_THRESHOLD = 1.

MISA (http://pgrc.ipk-gatersleben.de/misa/) was used to identify di- to tri-nucleotide microsatellite loci from the genome assemblies of P. noxius KPN92 with at least eight repeats of di- and tri-nucleotides and the maximum number of bases between two microsatellite loci set to 100 bp. The total number of microsatellites identified was 334 (232 di-nucleotide microsatellite with 8–33 repeats and 102 tri-nucleotide microsatellite with 8–23 repeats). Specific primer pairs to amplify those microsatellite loci with four classes of product size were designed using Primer3 2.3.6 (http://primer3.sourceforge.net/) with the following options: the ranges of product size were 100–200, 200–300, 300–400, and 400–500. Within designated primer pairs, 50–60 pairs for each of the four product size classes (220 pairs in total) were selected arbitrarily and synthesised with the tail sequence on the 5’ end of the forward primer: tail A (GCC TCC CTC GCG CCA) for product size classes of 100–200 and 300–400 and tail B (GCC TTG CCA GCC CGC) for product size classes of 200–300 and 400–500 [37]. These 220 primer pairs were tested for amplification on eight P. noxius isolates: KPN1, 21, 92, 121, 145, 157, 256, and P919-02W.1 for the first screening. PCR amplification was performed using a BIO-RAD iCycler (Hercules, California) with the following conditions: 5 min at 95°C followed by 35 cycles of 30 s at 95°C, 30 s at 55°C, and 45 s at 72°C, and a final extension of 10 min at 72°C. Each PCR reaction contained approximately 5 ng template DNA, 0.2 μM of each primer, and 1X Go Taq Green Master Mix (Promega, Madison, Wisconsin) in 25 μL total volume. PCR products were separated by electrophoresis on a 1% agarose gel in TAE buffer and visualised using ethidium bromide staining on a UV transilluminator.

For the second screening, 20 primer pairs in each of the four product size classes (80 primer pairs in total) were arbitrarily selected from the primer pairs that generated clear PCR products in all eight isolates in the first screening; these were combined into 20 multiplex PCR panels that included one primer set of each of the four classes. To test the amplification of multiplex PCR panels and the polymorphism of each microsatellite loci, 15 P. noxius isolates were used: the 8 isolates used in the first screening, plus KPN28, 80, 132, 141, 280 and 289. PCR amplifications using a Qiagen Multiplex PCR Kit were performed with a BIO-RAD iCycler following the manufacturer’s recommended conditions: 15 min at 95°C followed by 35 cycles of 30 s at 94°C, 90 s at 55°C, and 60 s at 72°C, and a final extension of 30 min at 60°C. Each PCR reaction contained approximately 5 ng template DNA, 0.1 μM forward primer, 0.2 μM reverse primer, 0.2 mM of each universal primer labelled with fluorescent dye (Tail A with 6-FAM and Tail B with VIC, [37]), and 5 μL Master Mix (from the kit) in 10 μL total volume. Amplified products were loaded on an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA), and genotype scoring was performed using the GeneScan 600 LIZ dye size standard (Applied Biosystems) and GeneMapper version 4.1 software (Applied Biosystems). Finally, we selected 20 primer sets in five multiplex PCR panels for further analysis of the 128 Japanese isolates of P. noxius.

Genetic diversity analysis

We defined isolates from the same island as a “population.” From the genotyping data, 102 isolates were observed as diploid, whereas 26 isolates were haploid. The number of alleles at each microsatellite locus was calculated using the program GenAlEx version 6.5.0.1 [38] for all 128 isolates. For further analysis of genetic diversity or genetic structure, haploid isolates were excluded. The number of alleles, Shannon’s information index (I), observed heterozygosity (Ho), expected heterozygosity (He), and Nei’s unbiased expected heterozygosity (uHe) for each locus were calculated using GenAlEx. Deviation from Hardy-Weinberg equilibrium (HWE) for each locus and linkage disequilibrium between loci were tested using the program Fstat version 2.9.3.2 [39] under the infinite allele model (IAM), and multiple testing with the Holm-Bonferroni method [40] was performed. Weir and Cockerham’s estimate of F IS [41] was calculated using Fstat. These analyses were conducted among populations (each island) as well as between the two groups of populations (the Ryukyu Islands and the Ogasawara Islands) inferred from the STRUCTURE analysis.

Genetic structure analysis

A Bayesian-based clustering method was applied to infer the genetic structure of Japanese P. noxius isolates using the program STRUCTURE version 2.3.4 [42]. An admixture model with correlated allele frequencies assuming no prior information of population origin was used. Twenty independent runs for K = 1 to 10 were performed at 100,000 Markov Chain Monte Carlo (MCMC) repetitions after a burn-in period of 50,000 iterations. The appropriate number of clusters (K) based on the ad hoc statics ΔK was determined using the method of Evanno et al. (2005) [43] with the program Structure Harvester [44].

Subsequently, analysis of molecular variance (AMOVA) was performed using the program Arlequin version 3.5.1.3 [45] to calculate the hierarchical distribution of genetic variation in Japanese isolates. All populations were initially combined into one hierarchical group, and then divided into two groups (the Ryukyu Islands and the Ogasawara islands) based on STRUCTURE analysis. The significance of components that showed variance was tested by performing 9,999 permutations.

Finally, the relationship between genetic structure and the isolation-by-distance (IBD) model was tested [46]. Values of F ST between populations were calculated using Fstat. Mantel’s test was performed using GenAlEx with 9,999 permutations and assuming a linear relationship between pairwise values of F ST/(1-F ST) and the natural logarithm of geographic distance (km) between all population pairs [47]. The central value between the maximum and minimum latitude and longitude of the isolates on the same island was used as the location of the population.

Results

Characteristics of microsatellite markers

Of the 220 microsatellite primer pairs designed from the assembly of the P. noxius genome (isolate KPN92), 20 primer pairs in five multiplex panels were selected for use in the population analysis (Table 2). The 20 microsatellite markers were distributed in 19 distinct scaffolds in the genome assembly and exhibited high polymorphisms at each locus (Table 3). The sequences of these microsatellite loci inferred from the KPN92 genome assembly have been deposited in DDBJ (accession numbers are shown in Table 2). The number of alleles at each locus was 21.7 on average and ranged from 7 at Pn155 to 45 at Pn111 (Table 3).

Table 2. Characteristics of 20 microsatellite loci developed for Phellinus noxius.

Locus Primer sequences (5' - 3') Motif repeat Tail label/ Multiplex panel a Allele size range (bp) Accession number
Pn8 F: TCGAGAACGAGGACGAGAGA (AG)15 A/IV 191–258 LC064122
R: ACCCTCTGCTTCTTCCTCCT
Pn11 F: GGAGGGACACTGGGTAGGAA (GAG)10 A/I 177–210 LC064123
R: TCCCCTGTATGATCATCGGAGT
Pn14 F: GAAAGGGGGAGACGGGAAAG (GA)9 A/III 161–238 LC064124
R: GGGGGAGTCGGTTTACATCC
Pn29 F: TCTGTTTTACGTTGAGTCTCACA (TCC)8 A/V 189–214 LC064125
R: TGACAGCAATAAAGATAAGACGGG
Pn44 F: TGCCAGTTTTGTAGTAGGCCT (GAT)13 A/II 173–232 LC064126
R: ACCACCTTGTCATTCGAGTGA
Pn71 F: AGGCGGGCTTACTGATATGC (TA)9 B/I 201–302 LC064127
R: ACCCCTCGCAAATCCCAAAT
Pn78 F: TTCCCCCTCCCCGAACTTAT (ACT)8 B/III 272–304 LC064128
R: CTTCGGACGACAAAGCTCCT
Pn83 F: GCAACGAAGAAATGGCCTGG (AG)18 B/IV 278–337 LC064129
R: TATGTCCCGGCTTTGGCTTT
Pn84 F: CTTGCTCTCCCGGAACCAAA (GTT)10 B/V 267–293 LC064130
R: CCAGGAGATCCGGGTATTAGA
Pn111 F: AAAAACCTCGCCTACGGTGT (GA)19 B/II 262–339 LC064131
R: GGAGAAGAGACGTGAAGCCC
Pn131 F: CTCAAGAACCCGAGGCTTGT (AT)12 A/I 369–438 LC064132
R: GTTCCGGACACAGTTCCCAT
Pn133 F: GTCACGTGACTGCTATTACTTAGT (TAT)9 A/III 323–357 LC064133
R: CGGATCTTTTCTGTCACATTCCA
Pn140 F: CGAGTTGGATCGGCTACTGG (AAC)9 A/IV 279–387 LC064134
R: GAGGGATGCGGTTAAGGCTT
Pn141 F: CAGTCCCATCCGATACGAGC (AT)9 A/V 368–408 LC064135
R: TTCGCAAGCCAACGTTTCTG
Pn155 F: TGGTGGTCAGGTTGAACGTC (CAA)9 A/II 298–315 LC064136
R: TATCGAAGCTTTCTGGCCGG
Pn175 F: TCCCTCGTTCGTTTTTCCGT (CT)17 B/IV 476–547 LC064137
R: GGCTACTGAGAGTGGGGGTA
Pn178 F: CCCTTCCTCACCCCACAAAA (CT)10 B/I 505–547 LC064138
R: GGGGCATGTTCTCACCTTCA
Pn210 F: TTCGCGGTATGTTCAGCTCT (CAT)9 B/III 405–465 LC064139
R: CGCCTTTTTGTCGCAACTCA
Pn213 F: AAAGAGGGCGTCTGGTTGTT (TAA)9 B/V 488–525 LC064140
R: TGGATTGTCATGGCGAGGTC
Pn214 F: GTGGTAGTGGTAGTGGTGCC (TGG)8 B/II 439–465 LC064141
R: AACCTCCTTAACAAGCCCCG
Open in a new tab

a Sequence of the tail labels: A = GCC TCC CTC GCG CCA; B = GCC TTG CCA GCC CGC

Table 3. Summary of standard population genetics analysis for isolates in the Ryukyu Islands and the Ogasawara Islands.

Total Ryukyu (n = diploid 58 +haploid 25) Ogasawara (n = diploid 44 +haploid 1)
Locus Na Nadi He Na Nadi Ho He Rs F IS (W&C) Na Nadi Ho He Rs F IS (W&C)
Pn8 25 24 0.876 23 22 0.638 0.908 20.0 0.305* 5 5 0.591 0.716 5.0 0.186
Pn11 12 12 0.860 11 11 0.607 0.871 10.3 0.311 7 7 0.297 0.717 7.0 0.594*
Pn14 28 28 0.892 25 25 0.696 0.914 22.1 0.246* 7 7 0.568 0.722 6.8 0.224
Pn29 9 9 0.669 9 9 0.138 0.773 8.6 0.824* 1 1 0.000 0.000 1.0 –
Pn44 17 15 0.674 17 15 0.672 0.756 13.1 0.119 5 5 0.432 0.527 5.0 0.192
Pn71 29 29 0.904 27 26 0.776 0.890 21.8 0.136 12 12 0.750 0.846 11.3 0.124
Pn78 12 11 0.789 11 10 0.638 0.755 8.7 0.163 5 5 0.727 0.712 5.0 -0.010
Pn83 37 34 0.933 36 32 0.931 0.937 27.9 0.016 17 16 0.705 0.857 15.3 0.189*
Pn84 16 16 0.748 16 16 0.586 0.867 13.9 0.331* 4 4 0.227 0.394 3.8 0.433
Pn111 45 45 0.966 38 37 0.948 0.952 30.6 0.012 28 28 0.886 0.948 26.8 0.077
Pn131 25 25 0.877 22 21 0.776 0.910 18.9 0.156* 11 11 0.568 0.561 10.3 -0.001
Pn133 16 14 0.816 15 13 0.655 0.831 11.5 0.220* 6 6 0.591 0.768 5.8 0.242
Pn140 30 28 0.892 30 28 0.793 0.892 23.0 0.120 6 6 0.750 0.799 6.0 0.073
Pn141 19 18 0.841 17 15 0.741 0.852 13.0 0.138 8 8 0.545 0.718 7.5 0.251
Pn155 7 7 0.585 7 7 0.362 0.360 6.1 0.004 2 2 0.023 0.022 1.8 0.000
Pn175 36 33 0.942 36 32 0.397 0.955 27.8 0.590* 14 14 0.409 0.885 13.6 0.546*
Pn178 13 13 0.752 12 12 0.552 0.629 10.3 0.131 5 5 0.386 0.465 4.8 0.180
Pn210 33 31 0.889 29 27 0.810 0.924 23.3 0.132 10 10 0.545 0.696 9.3 0.227
Pn213 15 14 0.723 14 13 0.552 0.845 11.5 0.355* 5 5 0.318 0.334 4.9 0.059
Pn214 10 9 0.809 10 9 0.690 0.825 8.5 0.172 7 7 0.568 0.760 6.7 0.263
All Loci 21.7 20.8 0.822 20.3 19.0 0.648 0.832 16.5 0.224* 8.3 8.2 0.495 0.623 7.9 0.217*
SE 2.4 2.3 0.023 2.2 2.0 0.043 0.031 1.7 0.044 1.4 1.3 0.053 0.059 1.3 0.040
Open in a new tab

Na, Nadi, Ho, He, and Rs refer to as the total number of alleles per locus in all isolates, the total number of alleles per locus in diploid isolates, the observed heterozygosity, the expected heterozygosity, and allelic richness respectively. F IS was calculated by Weir & Cockerham.

* indicates that the HWE test is significant after the Holm-Bonferroni correction method (α = 0.05).

–indicates that Fis was not calculated because the loci was monomorphic.

In all, 4 to 22 isolates of P. noxius from each island were tested using 20 microsatellite markers, and remarkably, all 128 isolates exhibited different genotypes. A total of 102 multilocus genotypes were interpreted as being diploid from the microsatellite analysis; however, 25 of 83 isolates from the Ryukyu Islands and 1 of 45 isolates from the Ogasawara Islands were judged to be haploid, because one single allele was detected at all loci in these isolates. Only diploid isolates were used for further analysis of genetic structure and diversity. In addition, the Yoron Island population was excluded because all of its isolates were haploid.

Genetic diversity

A summary of the genetic diversity for the 14 populations is presented in Table 4. Expected heterozygosity across all populations was 0.67 (±0.01 SD), ranging from 0.48 (±0.07) on Okinoerabu Island to 0.81 (±0.03) on Miyako Island. Unbiased expected heterozygosity exhibited the same trend as expected heterozygosity. Shannon’s diversity index (I) was 0.81–1.95 (mean = 1.46) for the 11 populations in the Ryukyu Islands and 0.96–1.30 (mean = 1.18) for the three populations in the Ogasawara Islands. There was a low number of isolates for some populations; therefore, for further analysis, each population was combined into two groups of islands (the Ryukyu Islands and the Ogasawara Islands) based on the STRUCTURE analysis. For the Ryukyu Islands (N = 58), the average observed and expected heterozygosity at each locus was 0.648 ± 0.043 and 0.832 ± 0.031, respectively. F IS at each locus ranged from 0.004 to 0.824, and significant deviation from HWE was detected at 9 of 20 loci after sequential Bonferroni correlation (α = 0.05). For the Ogasawara Islands (N = 44), the average observed and expected heterozygosity at each locus was 0.495 ± 0.053 and 0.623 ± 0.059, respectively. F IS at each locus ranged from -0.001 to 0.594, and significant deviation from HWE was detected at three loci after sequential Bonferroni correlation (α = 0.05). Allelic richness was 16.5 ± 1.7 in the Ryukyu Islands and 7.9 ± 1.3 in the Ogasawara Islands. No significant linkage disequilibrium was detected between each locus in any population after sequential Bonferroni correlation (α = 0.05).

Table 4. Genetic diversity across 16 populations (islands) of Phellinus noxius.

Island N Ndi I Ho He uHe
Ryukyu Islands
Amami-Oshima 8 5 1.49 ± 0.10 0.66 ± 0.07 0.71 ± 0.04 0.79 ± 0.05
Kikai 7 4 1.40 ± 0.08 0.70 ± 0.07 0.70 ± 0.03 0.80 ± 0.03
Tokunoshima 6 3 1.04 ± 0.10 0.48 ± 0.07 0.58 ± 0.05 0.70 ± 0.05
Okinoerabu 4 2 0.81 ± 0.12 0.58 ± 0.10 0.48 ± 0.07 0.63 ± 0.09
Yoron 6 0
Okinawa 11 8 1.82 ± 0.10 0.67 ± 0.05 0.79 ± 0.02 0.84 ± 0.03
Iheya 5 5 1.50 ± 0.11 0.69 ± 0.06 0.70 ± 0.04 0.78 ± 0.04
Kume 6 5 1.49 ± 0.09 0.70 ± 0.07 0.73 ± 0.03 0.81 ± 0.03
Tokashiki 4 4 1.42 ± 0.11 0.70 ± 0.06 0.70 ± 0.04 0.80 ± 0.04
Miyako 13 11 1.95 ± 0.1 0.58 ± 0.04 0.81 ± 0.03 0.84 ± 0.03
Ishigaki 4 3 1.43 ± 0.05 0.78 ± 0.04 0.73 ± 0.02 0.88 ± 0.02
Iriomote 9 8 1.71 ± 0.11 0.63 ± 0.06 0.76 ± 0.03 0.81 ± 0.04
Ogasawara Islands
Ani-jima 4 4 0.96 ± 0.14 0.53 ± 0.08 0.50 ± 0.07 0.57 ± 0.08
Chichi-jima 22 21 1.30 ± 0.16 0.53 ± 0.06 0.59 ± 0.06 0.61 ± 0.06
Haha-jima 19 19 1.27 ± 0.17 0.44 ± 0.05 0.61 ± 0.06 0.63 ± 0.06
Total 128 102 1.40 ± 0.03 0.62 ± 0.02 0.67 ± 0.01 0.75 ± 0.01
Open in a new tab

N, Ndi, I, Ho, He, and uHe refer to as number of all isolates, number of diploid isolates, Shannon's Information index, observed heterozygosity, expected heterozygosity, unbiased expected heterozygosity, respectively.

Genetic structure

Evanno’s method using Structure Harvester clearly indicated that ΔK at K = 2 was at a maximum and two was an appropriate number of clusters (Fig 2). The two clusters clearly exhibited structure between isolates of the Ryukyu Islands (composed of 11 islands from Amami-Oshima Island to Iriomote Island) and those of the Ogasawara Islands, containing the islands of Ani-jima, Chichi-jima, and Haha-jima (Fig 3).

Fig 2. A) Values of log likelihood of the data, ln P(X/K), as a function of the number of clusters, K, from STRUCTURE analysis. B) Value of ΔK, based on the rate of change in ln P(X/K) between successive K values generated from Structure Harvester.

Fig 2

Open in a new tab

Each bar indicates the standard deviation of 20 independent runs.

Fig 3. Bar plots of the coefficients of co-ancestry obtained from STRUCTURE analysis with K = 2.

Fig 3

Open in a new tab

Each bar corresponds to one individual isolate, and each cluster is represented by a particular colour.

When all populations were combined in one hierarchical group, AMOVA analysis indicated that most of the genetic variation could be explained by differences in individual isolates within populations (85.52%) rather than by variation among populations (14.48%, P < 0.0001, Table 5). When the populations were partitioned into two groups (the Ryukyu Islands and the Ogasawara Islands) established from the STRUCTURE analysis, most of the genetic variance could be explained by differences in individual isolates within a population (79.18%, P < 0.0001). Differences in isolates among groups and among populations within groups explained 16.65% (P = 0.0029) and 4.17% (P < 0.0001), respectively.

Table 5. Analysis of molecular variance (AMOVA) for Phellinus noxius populations using 20 microsatellite loci.

Source of variation df sum of squares variance component % of variation P value
Among population 13 295.96 1.15 Va 14.48 <0.0001
Within population 190 1290.74 6.79 Vb 85.52
Total 203 1586.70 7.94
F ST = 0.14478
Among groups 1 159.36 1.43 Va 16.65 0.0029
Among population within groups 12 136.60 0.36 Vb 4.17 <0.0001
Within population 190 1290.74 6.79 Vc 79.18 <0.0001
Total 203 1586.70 8.58
F SC = 0.05008, F ST = 0.20825, F CT = 0.16651
Open in a new tab

The analysis included all diploid isolates as one hierarchical group, and partitioning populations into two groups (the Ryukyu Islands and the Ogasawara Islands) inferred from STRUCTURE analysis.

A pairwise analysis of IBD among populations indicated a significant positive correlation between genetic distance and geographic distance (R 2 = 0.47193; P = 0.003, Fig 4). High F ST/(1-F ST) values above 1200 km (= ln7.1 km) were consistent with the pairwise analysis between the Ryukyu Islands and the Ogasawara Islands.

Fig 4. Relationship between the pairwise genetic distance, F ST/(1-F ST), and geographic distance among 14 populations (islands).

Fig 4

Open in a new tab

Discussion

We developed 20 microsatellite markers for P. noxius. Multiplex PCR for these markers (four of each primer pair in one reaction) successfully genotyped Japanese isolates as well as an isolate from Pohnpei Island, Federated States of Micronesia, indicating that these markers are useful to genotype isolates from other geographic regions. Moreover, these markers showed enough polymorphism to analyse the genetic or clone composition of P. noxius in local populations. For some Ryukyus Islands, we were unable to obtain a sufficient number of isolates to analyse differences between islands, because the number of sites where the disease occurred was too low and some isolates were haploid. However, the number of isolates was sufficient for comparisons between the Ryukyu Islands and the Ogasawara Islands.

Diploidy is the main ploidy for vegetative hyphae in Hymenochaetaceae, which is consistent with our microsatellite data for P. noxius. However, 26 of 128 isolates obtained from decayed woods or basidiocarps were judged to be haploid. Among the isolates from the Ryukyu Islands obtained between 1999 and 2014, 30.1% were haploid, whereas only one isolate was haploid among those isolated from the Ogasawara Islands during or after 2012 (Table 1). During the maintenance of the isolate cultures, we encountered cases in which some sub-cultures from a diploid isolate showed haploid microsatellite signals that had only one of two alleles of each microsatellite loci of diploid isolates. In Pholiota nameko, an edible basidiomycetous fungus, diploid mycelia often become haploid during storage via a mechanism known as monokaryotisation or dedikaryotisation [48,49]. Haploid mycelia of P. noxius may occur as primary mycelia that are derived from germinated basidiospores, however, basidiocarp formation of this fungus is very rare [3,12] and the primary mycelia are usually short lived [50]. Therefore, haploid P. noxius isolates in this study may have changed from diploid during periodical subculturing by monokaryotisation.

Phellinus noxius has two dissemination methods: asexual root-to-root contact from a diseased tree to a living tree and dispersal of sexually produced basidiospores [1,14]. Using somatic incompatibility tests, Hattori et al. [51] examined the clone distribution of P. noxius in windbreak trees on the Ishigaki Islands of Japan. They concluded that infection via both basidiospores and root-to-root contact occurred in the area. Some researchers, however, have suspected that infection by basidiospores is rare because basidiocarps are seldom seen in areas of disease propagation [3,12]. We found that all of the isolates exhibited unique genotypes, strongly indicating that basidiospore infection is the main dissemination method for the formation of new disease foci. In the Ryukyu Islands, basidiocarps were rarely seen in areas where the disease was spreading and forming forest gaps [14]; however, they were occasionally seen on dead or fallen trees in natural forests, where the disease was not spreading. Meanwhile, basidiocarps are more frequently observed on the Ogasawara Islands, although the reason is unclear (Hattori personal observation). In such areas, basidiospores may function to produce new disease foci. Although many unique genotypes have been observed, it is possible that a small number of genotypes dominates within a single disease focus, because P. noxius spreads asexually within disease foci like Phellinus sulphurascens and Armillaria spp [1,15,17,18]. More extensive sampling within disease foci are needed to clarify the clone distribution pattern of P. noxius.

Whether P. noxius is indigenous in Japan or introduced from other areas is unknown. Because brown root rot was first recognised in Japan as recently as the 1980s, the possibility of P. noxius as an introduced pathogen has been expected [23]. Ann et al. [12] suggested that P. noxius was likely introduced to Taiwan on diseased roots of exotic trees, based on observations that the distribution of P. noxius in Taiwan is limited to areas of human activity and the disease has never been found in undisturbed forests. In general, introduced pathogens have lower genetic diversity than indigenous pathogens because of the founder effect of small population sizes and subsequent bottlenecks [52]. Introduced diseases that have had devastating effects include chestnut blight caused by an ascomycetous fungus Cryphonectria parasitica (Murrill) M.E. Barr [27], ash dieback by Hymenoscyphus fraxineus (T. Kowalski) Baral, Queloz & Hosoya [53], sudden oak death by an oomycete Phytophthora ramorum Werres, De Cock & Man in't Veld [54], and alder decline due to P. alni Brasier & S.A. Kirk [28]. Population genetics studies using microsatellite markers have indicated that the genetic diversities of these species in the area of introduction are lower than in native areas [27,28,53]. In terms of root-rotting basidiomycetous fungi, Heterobasidion irregulare Garbel. & Otrosina in Italy [29] and Armillaria mellea (Vahl) P. Kumm in South Africa [55] are known as introduced pathogens. Heterobasidion irregulare in Italy, which is suspected to have been introduced by the US military during World War II, exhibits fewer alleles (1–7) at each microsatellite locus than native populations in North America. In our study, Japanese P. noxius isolates exhibited a high number of alleles per loci (21.7 on average), suggesting that P. noxius is indigenous to Japan or was introduced to the country a very long time ago. Further studies using isolates collected from other geographic region are needed to confirm the conclusion. Although the occurrence of brown root rot in Japan was only recognised recently (i.e., in the 1980s on the Ryukyu Islands and the 2010s on the Ogasawara Islands), basidiocarps of P. noxius were recorded on a broadleaved tree on the Ogasawara Islands in 1916 [56]. This suggests that P. noxius was present on these islands without causing a conspicuous decline of resident trees. The causes of the recent outbreak of this disease in Japan has not yet been determined, although several environmental changes, including irregular climatic events such as typhoons and droughts, as well as human disturbances may have contributed to the outbreak.

The STRUCTURE analysis strongly indicated genetic differentiation between the Ryukyu and Ogasawara populations of P. noxius. Additionally, the AMOVA and IBD analysis also supported the conclusion. These findings suggest minimal gene flow between the two island chains over a long period of time or a different origin of the two populations. The Ryukyu Islands and Taiwan are continental islands that were once connected to the Eurasian continent; thus, P. noxius was able to spread to and from the continent similar to other flora and fauna [57]. In contrast, the Ogasawara Islands are oceanic islands formed by volcanic activity and were never connected to a continent or other larger islands such as the main Japanese islands. Therefore, the origins of all flora and fauna on them are thought to be introductions from other continents or islands followed by their unique evolution. Because the dispersal modes for plants on the Ogasawara Islands are by air, bird, and oceanic drift [57], P. noxius was probably introduced via one of these methods. In general, basidiospores are ephemeral, and the majority of basidiospores fall within a short distance of the basidiocarps [58,59]. However, long-distance dispersal (1000 km) has also been reported in some wood-inhabiting basidiomycetous fungi [60]. The basidiospores might have been introduced from the Mariana Islands, the nearest oceanic islands to the Ogasawara Islands, by a typhoon, as many typhoons form around the Marianas and move to the Ogasawaras.

Phellinus noxius could serve as a suitable model for studying the evolutionary history of fungi and forest diseases on oceanic islands, because it is distributed in three geographically different categories: continents, continental islands, and oceanic islands. Further population genetics studies using isolates collected from around the world will be useful for understanding the evolutional history of P. noxius and its worldwide routes of dispersal.

Acknowledgments

We would like to thank Arleen Rosenkrans, Gibson Santos, and Rodasio Samuel of USDA NRCS Pohnpei Field Office for their help and consideration in collecting samples in Pohnpei; Ami Akasaka, Noriko Shimada, Kazuko Komaru, and Atsuko Matsumoto of FFPRI for their technical assistance; and Asako Matsumoto of FFPRI for her valuable suggestions on the development of SSR markers.

Data Availability

All relevant data are within the paper.

Funding Statement

This work was supported by Japan Society for the Promotion of Science KAKENHI Grant Number 25292096. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Bolland L. Phellinus noxius: cause of a significant root-rot in Queensland hoop pine plantations. Aust For. 1984;47:2–10. [Google Scholar]
  • 2. Neil PE. A preliminary note on Phellinus noxius root rot of Cordia alliodora plantings in Vanuatu. Eur J Forest Pathol. 1986;16:274–280. [Google Scholar]
  • 3. Nandris D, Nicole M, Geiger JP. Root rot diseases of rubber trees. Plant Dis. 1987;71:298–306. [Google Scholar]
  • 4. Nandris D, Nicole M, Geiger JP. Variation in virulence among Rigidoporus lignosus and Phellinus noxius isolates from West Africa. Eur J Forest Pathol. 1987;17:271–281. [Google Scholar]
  • 5. Chang TT. Decline of nine tree species associated with brown root rot caused by Phellinus noxius in Taiwan. Plant Dis. 1995;79:962–965. [Google Scholar]
  • 6. Ivory MH. Diseases of forest trees caused by the pathogen Phellinus noxius In: Raychaudhuri SP, Maramorosch K, editors. Forest trees and palms: diseases and control. Lebanon: Science Publishers; 1996. pp. 111–133. [Google Scholar]
  • 7. Ann PJ, Lee HL, Huang TC. Brown root rot of 10 species of fruit trees caused by Phellinus noxius in Taiwan. Plant Dis. 1999;83:746–750. [DOI] [PubMed] [Google Scholar]
  • 8. Hodges CS, Tenorio JA. Root disease of Delonix regia and associated tree species in the Mariana Islands caused by Phellinus noxius . Plant Dis. 1984;68:334–336. [Google Scholar]
  • 9. Larsen MJ, Cobb-Poule LA. Phellinus (Hymenochaetaceae). A survey of the world taxa. Synopsis Fungorum. 1990;3:1–206. [Google Scholar]
  • 10. CABI/EPPO Phellinus noxius. Distribution maps of plant diseases No.104. Wallingford: CAB International; 1997. [Google Scholar]
  • 11. Chang TT, Yang WW. Phellinus noxius in Taiwan: distribution, host plants and the pH and texture of the rhizosphere soils of infected hosts. Mycol Res. 1998;102:1085–1088. [Google Scholar]
  • 12. Ann PJ, Chang TT, Ko WH. Phellinus noxius brown root rot of fruit and ornamental trees in Taiwan. Plant Dis. 2002;86:820–826. [DOI] [PubMed] [Google Scholar]
  • 13. Brooks F. Brown root rot disease in American Samoa’s tropical rain forest. Pac Sci. 2002;56:377–387. [Google Scholar]
  • 14. Sahashi N, Akiba M, Ishihara M, Ota Y, Kanzaki N. Brown root rot of trees caused by Phellinus noxius in the Ryukyu Islands, subtropical areas of Japan. For Pathol. 2012;42:353–361. [Google Scholar]
  • 15. Sahashi N, Akiba M, Takemoto S, Yokoi T, Ota Y, Kanzaki N. Phellinus noxius causes brown root rot on four important conifer species in Japan. Eur J Plant Pathol. 2014;140:867–873. [Google Scholar]
  • 16. Sahashi N, Akiba M, Ishihara M, Miyazaki K, Kanzaki N. Cross inoculation tests with Phellinus noxius isolates from nine different host plants in the Ryukyu Islands, southwestern Japan. Plant Dis. 2010;94:358–360. [DOI] [PubMed] [Google Scholar]
  • 17. Lewis KJ. Laminated and tomentosus root rots In: Gonthier P, Nicolotti G, editors. Infectious forest diseases. Wallingford: CAB International; 2013. pp. 178–196. [Google Scholar]
  • 18. Guillaumin JJ, Legrand P. Armillaria root rots In: Gonthier P, Nicolotti G, editors. Infectious forest diseases. Wallingford: CAB International; 2013. pp. 159–177. [Google Scholar]
  • 19. Chang TT. Survival of Phellinus noxius in soil and in the roots of dead host plants. Phytopathology. 1996;86:272–276. [Google Scholar]
  • 20. Abe Y, Onuki M, Hattori T, Tsurumachi M. Brown root rot caused by Phellinus noxius in windbreaks on Ishigaki Island, Japan. Incidence of disease, pathogen and artificial inoculation. Annu Phytopathol Soc Jpn. 1995;61:425–433. [Google Scholar]
  • 21. Kobayashi T, Abe Y, Kawabe Y. Brown root rot disease: a new threat found in windbreaks in Okinawa Prefecture, Japan. For Chem. 1991;118:1–7 (in Japanese). [Google Scholar]
  • 22. Kawabe Y, Kobayashi T, Usugi T. Brown root rot of woody plants caused by Phellinus noxius in Okinawa Prefecture. For Pests. 1993;42:176–179 (in Japanese). [Google Scholar]
  • 23. Sahashi N, Akiba M, Ishihara M, Abe Y, Morita S. First report of the brown root rot disease caused by Phellinus noxius, its distribution and newly recorded host plants in the Amami Islands, southern Japan. For Pathol. 2007;37:167–173. [Google Scholar]
  • 24. Toyoda T. Flora of Bonin Islands (Enlarged & Revised) Kamakura: Aboc; 2003. (in Japanese). [Google Scholar]
  • 25. Jarne P, Lagoda PJL. Microsatellites, from molecules to populations and back. Trends Ecol Evol. 1996;11:424–429. [DOI] [PubMed] [Google Scholar]
  • 26. Powell W, Machray GC, Provan J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996;1:215–222. [Google Scholar]
  • 27. Dutech C, Barrès B, Bridier J, Robin C, Milgroom MG, Ravigné V. The chestnut blight fungus world tour: successive introduction events from diverse origins in an invasive plant fungal pathogen. Mol Ecol. 2012;21:3931–3946. 10.1111/j.1365-294X.2012.05575.x [DOI] [PubMed] [Google Scholar]
  • 28. Aguayo J., Adams GC, Halkett F, Catal M, Husson C, Nagy ZÁ, et al. Strong genetic differentiation between North American and European populations of Phytophthora alni subsp. uniformis . Phytopathology. 2013;103:190–199. 10.1094/PHYTO-05-12-0116-R [DOI] [PubMed] [Google Scholar]
  • 29. Garbelotto M, Guglielmo F, Mascheretti S, Croucher PJP, Gonthir P. Population genetics analyses provide insights on the introduction pathway and spread patterns of the North American forest pathogen Heterobasidion irregulare in Italy. Mol Ecol. 2013;22:4855–4869. 10.1111/mec.12452 [DOI] [PubMed] [Google Scholar]
  • 30. Zerillo MM, Caballero JI, Woeste K, Graves AD, Hartel C, Pscheidt JW, et al. Population structure of Geosmithia morbida, the causal agent of thousand cankers disease of walnut trees in the United States. PLoS One. 2014;9:e112847 10.1371/journal.pone.0112847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Worrall JJ, Sullivan KF, Harrington TC, Steimel J. Incidence, host relations and population structure of Armillaria ostoyae in Colorado campgrounds. For Ecol and Manage. 2004;192:191–206. [Google Scholar]
  • 32. Baumgartner K, Grubisha LC, Fujiyoshi P, Garbelotto M, Bergemann SE. Microsatellite markers for the diploid basidiomycete fungus Armillaria mellea . Mol Ecol Resour. 2009;9:943–946. 10.1111/j.1755-0998.2008.02494.x [DOI] [PubMed] [Google Scholar]
  • 33. Prospero S, Jung E, Tsykun T, Rigling D. Eight microsatellite markers for Armillaria cepistipes and their transferability to other Armillaria species. Eur J Plant Pathol. 2010;127:165–170. [Google Scholar]
  • 34. Oliva J, Gonthier P, Stenlid J. Gene flow and inter-sterility between allopatric populations of Heterobasidion abietinum and H. parviporum in Europe. For Pathol. 2011;41: 243–252. [Google Scholar]
  • 35. Ota Y, Hattori T, Nakamura H, Terashima Y, Lee SS, Miyuki Y, et al. Taxonomy and phylogenetic position of Fomitiporia torreyae, a causal agent of trunk rot on Sanbu-sugi, a cultivar of Japanese cedar (Cryptomeria japonica) in Japan. Mycologia. 2014;106:66–76. 10.3852/13-045 [DOI] [PubMed] [Google Scholar]
  • 36. Zimin AV, Marçais G, Puiu D, Roberts M, Salzberg SL, Yorke JA. The MaSuRCA genome assembler. Bioinformatics. 2013;29:2669–2677. 10.1093/bioinformatics/btt476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Blacket MJ, Robin C, Good RT, Lee SF, Miller AD. Universal primers for fluorescent labelling of PCR fragments—an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour. 2012;12:456–463. 10.1111/j.1755-0998.2011.03104.x [DOI] [PubMed] [Google Scholar]
  • 38. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research- an update. Bioinformatics. 2012;28:2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Goudet J. FSTAT (version 1.2): a computer program to calculate F-statics. J Hered. 1995;86:485–486 [Google Scholar]
  • 40. Holm S. A simple sequentially rejective multiple test procedure. Scand J Stat. 1979;6:65–70. [Google Scholar]
  • 41. Weir BS, Cockerham CC. Estimating F-statics for the analysis of population structure. Evolution. 1984;38:1358–1370. [DOI] [PubMed] [Google Scholar]
  • 42. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software structure: a simulation study. Mol Ecol. 2005;14:2611–2620. [DOI] [PubMed] [Google Scholar]
  • 44. Earl DA, von Holdt BM. Structure Harvester: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour. 2012;4:359–361. [Google Scholar]
  • 45. Excoffier L, Kischer HEL. Arlequin suite ver 3.5: A new series of program to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10:564–567. 10.1111/j.1755-0998.2010.02847.x [DOI] [PubMed] [Google Scholar]
  • 46. Mantel NA. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967;27:209–220. [PubMed] [Google Scholar]
  • 47. Rousset F. Genetic differentiation and estimation of gene flow from F statics under isolation by distance. Genetics. 1997;145:1219–1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Arita I. The mechanism of spontaneous dedikaryotization in hyphae of Pholiota nameko . Mycologia. 1979;71:603–611. [Google Scholar]
  • 49. Masuda P, Yamanaka K, Sato Y, Kitamoto Y. Nuclear selection in monokaryotization of dikaryotic mycelia of Pholiota nameko as described by leading and following nuclei. Mycoscience. 1995;36:413–420. [Google Scholar]
  • 50. Hansen EM, Hamelin RC. Population structure of basidiomycetes In: Worrall JJ, editor. Structure and dynamics of fungal populations. Dordrecht: Kluwer Acad Publ; 1999. pp. 251–281. [Google Scholar]
  • 51. Hattori T, Abe Y, Usugi T. Distribution of clones of Phellinus noxius in a windbreak on Ishigaki Island. Eur J Forest Pathol. 1996;26:69–80. [Google Scholar]
  • 52. Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA, et al. The population biology of invasive species. Annu Rev Ecol Syst. 2001;32:305–332. [Google Scholar]
  • 53. Gross A, Hosoda T, Queloz V. Population structure of the invasive forest pathogen Hymenoscyphus pseudoalbidus . Mol Ecol. 2014;23:2943–2960. 10.1111/mec.12792 [DOI] [PubMed] [Google Scholar]
  • 54. Croucher P, Mascheretti S, Garbelotto M. Combining field epidemiological information and genetic data to comprehensively reconstruct the invasion history and the microevolution of the Sudden Oak Death agent Phytophthora ramorum (Stramenopila: Oomycetes) in California. Biol Invasions. 2013;15:2281–2297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Coetzee MPA, Wingfield DB, Harrington TC, Steimel J, Coutinho TA, Wingfield MJ. The root rot fungus Armillaria mellea introduced into South Africa by early Dutch settlers. Mol Ecol. 2001;10:387–396. [DOI] [PubMed] [Google Scholar]
  • 56. Yasuda A. Miscellaneous note of Fungi (56) Botanical Magazine, Tokyo: 1916;30:350 (in Japanese). [Google Scholar]
  • 57. Ito M. Origin and evolution of endemic plants of the Bonin (Ogasawara) Islands. Res Popul Ecol. 1998;40:205–212. [Google Scholar]
  • 58. Wolfenbarger DO. Dispersion of small organisms. Am Midl Nat. 1946;35:1–152. [Google Scholar]
  • 59. Lacey J. Spore dispersal—its role in ecology and disease: the British contribution to fungal aerobiology. Mycol Res. 1996;100:641–660. [Google Scholar]
  • 60. Hallenberg N, Küffer N. Long-distance spore dispersal in wood-inhabiting Basidiomycetes. Nord J Bot. 2001;21:431–436. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES