Skip to main content
PLOS One logoLink to PLOS One
. 2015 Nov 5;10(11):e0142348. doi: 10.1371/journal.pone.0142348

Two Novel Y-Type High Molecular Weight Glutenin Genes in Chinese Wheat Landraces of the Yangtze-River Region

Yanchun Peng 1,2,3,#, Kan Yu 1,#, Yujuan Zhang 2,3, Shahidul Islam 2,3, Dongfa Sun 1,4,*, Wujun Ma 2,3,*
Editor: Guangxiao Yang5
PMCID: PMC4635010  PMID: 26540300

Abstract

High molecular weight glutenin subunits (HMW-GSs) are key determinants for the end-use quality of wheat. Chinese wheat landraces are an important resource for exploring novel HMW-GS genes to improve the wheat baking quality. Two novel Glu-1Dy HMW-GSs (designated as 1Dy12.6 and 1Dy12.7) were identified and cloned from two Chinese wheat landraces Huazhong830 and Luosimai. The 1Dy12.6 and 1Dy12.7 subunits were deposited as the NCBInr Acc. No KR262518, and KR262519, respectively. The full open reading frames (ORFs) of 1Dy12.6 and 1Dy12.7 were 2022 bp and 1977 bp, encoding for proteins of 673 and 658 amino acid residues, respectively. Each contains four typical primary regions of HMW-GSs (a signal peptide, N- and C-terminal regions, and a central repetitive region). Their deduced molecular masses (70,165 Da and 68,400 Da) were strikingly consistent with those identified by MALDI-TOF-MS (69,985Da and 68,407 Da). The 1Dy12.6 is the largest 1Dy glutenin subunits cloned in common wheat up to date, containing longer repetitive central domains than other 1Dy encoded proteins. In comparison with the most similar active 1Dy alleles previously reported, the newly discovered alleles contained a total of 20 SNPs and 3 indels. The secondary structure prediction indicated that 1Dy12.6 and 1Dy12.7 have similar proportion of α-helix, β-turn, and β-bend to those of 1Dy10 (X12929). The phylogenetic analysis illustrated that the x- and y-type subunits of glutenins were well separated, but both 1Dy12.6 and 1Dy12.7 were clustered with the other Glu-1Dy alleles. Our results revealed that the 1Dy12.6 and 1Dy12.7 subunit have potential to strengthen gluten polymer interactions, and are valuable genetic resources for wheat quality improvement.

Introduction

Wheat (Triticum aestivum L.) is a significantly distinctive cereal crop by forming flour dough with visco-elastic properties that can be processed to produce a vast variety of foodstuffs such as steamed buns, cakes, biscuits, noodles, sour dough breads and pizzas. It is a staple food containing premium dietary fiber and vegetable protein of great nutritional value for human healthy diet. The viscous and elastic properties derived from two main protein groups, monomeric gliadins and polymeric glutenins, each containing various components of low and high molecular weight subunits [1]. A great progress has been achieved in understanding the structure, function, genetic expression, regulation and evolution of glutenin subunits in wheat and its related species [2–15]. High molecular weight glutenin subunits with relative molecular masses ranging from 60,000 Da to 90,000 Da are key constituents in their ability to form wheat dough strength, substantially influencing the end-use quality of wheat flour for bread-making [16–20]. In common wheat, they are encoded by Glu-1 loci located on the long arms of chromosomes 1A, 1B and 1D [21]. Each locus contains two tightly linked genes encoding larger x-type and smaller y-type subunits with relative molecular masses in the 82,000–90,000 Da and 60,000–80,000 Da range, respectively [20, 21]. The y-type subunits generally exhibit relatively faster electrophoretic mobility on SDS-PAGE [20,21]. Both x- and y-type subunits possess similar primary structures, containing a signal peptide, a non-repetitive N-terminal region, a non-repetitive C-terminal region, and a long repetitive central region [22]. Differences in their molecular mass mainly result from the peptide length variation of their repetitive regions [23]. In the long repetitive central regions, three primary repeat units, tripeptides (GQQ), hexapeptides (PGQGQQ), and nonapeptides (GYYPTSLQQ) are identified [24]. Both x- and y-type subunits possess hexapeptide and nonapeptide unit, however the tripeptide units only exist in the x-type subunits [24]. Usually, seven and four cysteine residues conserved in y- and x-type subunits, respectively [24]. The y-type glutenin subunits possess more cysteine residues than x-type subunits, therefore are capable of forming more inter- and intra-molecular disulfide bonds, which aggregate HMW-GSs with each other and with LMW-GSs, resulting in improving dough quality [25].

In 1987, Payne et al. [16] demonstrated that allelic variation of the HMW-GSs composition in common wheat is associated with dough visco-elastic properties related to bread-making quality, which has stimulated great interests to identify and characterize novel HMW-GSs with different molecular structures [2–15]. Some HMW-GSs such as 1Ax1, 1Ax2*, 1Bx7OE, and 1Bx17 + 1By18 are found to possess positive effects on dough characteristics, while 1AxNull, 1Bx20, 1Bx6 + 1By8, 1Dx2 +1Dy12 have negative effects on gluten quality and bread-making quality [24,26–30]. Different HMW-GSs were endowed certain quality scores, and are widely applied as markers in wheat quality breeding programs to help selecting specific lines for different end-uses [31].

Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) has been employed widely for separation and identification of HMW and LMW subunits based on their different electrophoretic mobility [21,32–33]. However, some HMW-GSs possessing nearly identical relative molecular mass and electrophoretic mobility, such as 1Dx2 and 1Ax2*, 1Bx7 and 1Bx7*, 1Bx14 + 1By15 and 1Bx20, cannot be reliably distinguished from each other using SDS-PAGE [25,30,34]. Currently, a number of novel HMW-GSs have been found from common wheat and its relatives using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology, which represented a powerful high throughput and time saving tool for accurately and sensitively analyzing wheat glutenin subunits [35–41].

The HMW-GSs encoded by the Glu-1D locus are found to be responsible for major wheat dough quality variances, particularly elasticity and strength, and have been successfully employed in wheat quality improvement [42,43]. Up to now, only five active Glu-1Dy genes have been cloned and characterized from bread wheat [44]. Recently, we characterized the allelic variation at the Glu-1 locus in 485 Chinese wheat landraces using MALDI-TOF-MS method, and identified several novel Glu-1 subunits [41]. In the present research, we cloned two novel Glu-1Dy genes from Chinese wheat landraces. Their molecular characterizations were analyzed. The evolutionary biology of the Glu-1 genes, and their potential value in common wheat processing quality were explored.

Material and Methods

2.1 Plant Material and Field Trials

Two Chinese wheat landraces Huazhong830 and Luosimai containing novel candidate 1Dy subunits [20,41], originally collected from the Yangtze-River region, were used for cloning the novel HMW-GS genes. We confirmed that no permissions were needed for the original collection. The hexaploid wheat cv. Chinese spring (Null, 1Bx7 + 1By8, 1Dx2 + 1Dy12) was used as the control to compare the electrophoretic mobility of HMW-GSs on SDS-PAGE. The field trials acquired the approval of Huazhong Agricultural University, and were carried out on the experimental wheat farm of Huazhong Agricultural University, Wuhan (30°33′03″N 114°16′59″E), China. The land used belongs to Huazhong Agricultural University, which is not privately owned. The two landraces used were collected by professor Dongfa Sun in Wuhan (Huazhong830) and Yichang (Luosimai), China, and no any protected or endangered landraces were sampled in the field studies. The landraces were planted at the end of October in 2012, in three rows with 2 m in length and 20 cm between rows, and 12 plants in each row.

2.2 Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS) Analysis of HMW-GSs

HMW-GSs were extracted from seeds according to the protocol of Liu et al. with some modifications [20]. Seeds were crushed and extracted in 1.5 ml of 55% propanol-1-ol (v/v) for 1 hour, followed by incubation for 30 min at 65°C, vortexing for 5 min, and centrifugation for 5 min at 9,000 g. These steps were repeated three times to eliminate gliadin proportion. The HMW-GS present in the precipitation was treated with 55% propanol-1-ol, 0.08 M Tris-HCl solution containing 1% dithiothreitol (DTT), after which glutenin was precipitated in the 40% acetone.

MALDI-TOF-MS was done at the State Agriculture Biotechnology Centre, Murdoch University, Australia. The air-dried HMW-GS pellets were dissolved in 60 μl acetonitrile (ACN)/H2O (v/v, 50:50) with 0.05% v/v trifluoroacetic acid (TFA) for 1 h at room temperature. HMW-GS preparation was performed based on the dried droplet procedure [45], and sinapinic acid (SA) was employed as matrix. The matrix solution contains 10 mg SA in 1 mL 50% ACN/0.05% TFA (w/w). The prepared HMW-GS solution (total 60 μl) was mingled with SA solution at the ratio of 1:9 (v/v), and 2 μl of the glutenin–SA mixture was spotted onto a MALDI-TOF Voyager DE Pro 100 sample size plate, and dried at room temperature.

MALDI-TOF-MS was carried out on a Voyager DE-PRO TOF mass spectrometer (Applied Bio-systems, Foster City, CA, USA) equipped with a 337 nm nitrogen laser. The experiments were performed on a positive linear ion mode with the following parameters: mass range 50–100 kDa, laser intensity 2500, acceleration voltage 25 kV, delay time 850 ns, grid voltage 92%, guide wire 0.3%, bin size 20 ns and input bandwidth 20 MHz. Spectra were averaged from 50 laser shots in order to improve the signal-to-noise level.

2.3 SDS-PAGE Analysis of HMW-GSs

The extraction of HMW-GSs and their SDS-PAGE analysis were performed based on the methods of Liu et al. [20]. Single crushed seed (20mg) was suspended in 1 ml of 62.5 mM Tris-HCl solution (pH 6.8), containing 0.002% (w/v) bromophenol blue, 1.5% (v/v) dithiothreitol, 2% (w/v) SDS and 10% (v/v) glycerol for 3 min with continuous vortexing and followed by incubation for 5 min at 100°C. After centrifugation at 18,000 g for 3 min, the supernatant was used for SDS-PAGE analysis. HMW-GSs were separated using 10% SDS-PAGE with Tris-Glycine-SDS running buffer as described previously [20].

2.4 DNA Extraction and PCR Amplification

Genomic DNA was extracted from dry seeds using a CTAB method [20]. Two PCR primers were designed based on the sequences of the published HMW-GS genes to amplify the complete ORF (P1: 5’-ATGGCTAAGCGGTTGGTCCT-3’, and P2: 5’-TCACTGGCTAGCCGACAATG-3’) [20]. PCR was accomplished in a 50 μL reaction mixture, containing 1× GC buffer Ⅰ, 0.3 μM of each primer, 200 μM of each dNTP, 2.5 U LA Taq polymerase and 500 ng of genomic DNA. The PCR amplification condition included an initial step at 94°C for 3 min, followed by 28 cycles of 94°C denaturation for 1 min, 62°C annealing for 1 min and 72°C extension for 2 min, and a final step at 72°C for 10 min. The PCR product was separated on 1.5% agarose gel. Electrophoresis was carried out at 60 V for 40 min at room temperature.

2.5 Molecular Cloning and Sequencing

The target DNA fragments were purified from agarose gel using the Gel Extraction Kit (Omega) and then ligated into the pGEM-T easy vector (Promega, USA). The ligation mixture was transformed into Escherichia coli JM109 competent cells. The full length sequence of Glu-1Dy ORF was obtained by primer walking. The three positive clones for each 1Dy gene were sequenced commercially by the State Agriculture Biotechnology Centre, Perth, Australia.

The gene sequences were assembled, and compared among different HMW-GS genes using DNAMAN Version 6.0.3.99 software. The translation of nucleotide sequences was carried out using DNASTAR software suite (Version 7.1.0). The SSpro8 (http://scratch.proteomics.ics.uci.edu/) was performed to predict the secondary structure of deduced amino acid sequences.

In order to analyze phylogenetic relationships among HMW-GS gene alleles, a multiple alignment was carried out with the ClustalW program. A phylogenetic tree was constructed using neighbour-joining (NJ) method in MEGA6.06 [46] based on the deduced amino acid sequences from the novel cloned two 1Dy and other Glu-1 genes from different genomes, including 1Ax1 (X61009), 1Ax2* (M22208), 1Ax2*B (EF055262), 1Ax1.1 (JN172932), 1Bx7 (X13927), 1Bx7OE (DQ119142), 1Bx13 (EF540764), 1Bx14 (AY367771), 1Bx20 (AJ437000), 1Dx2 (X03346), 1Dx5 (X12928), 1By8 (AY245797), 1By9 (X61026), 1By15 (EU137874), 1By16 (EF540765), 1Dy10 (X12929), 1Dy10.1 (AY695379), 1Dy12.3 (EF472958), 1Sy18* (JQ680980), Sy9* (HQ380223), 1Dy12.4*t (KC196061), 1Dy12.1 (AY248704), 1Dy10.5t (FJ499503), and 1Dy12 (X03041). The number of bootstrap replicates was 500 [47].

Results

3.1 Characterization of 1Dy12.6 and 1Dy12.7 Subunits by MALDI-TOF-MS and SDS-PAGE

HMW-GS profiles of the two Chinese wheat landraces were obtained by MALDI-TOF-MS (Fig 1). Both Huazhong830 and Luosimai have four HMW-GS peaks with relative molecular masses ranging from 65,000 to 90,000 Da. In comparison with the study of Liu et al. [20], two novel candidate 1Dy subunits with relative molecular mass of 69,985 Da (designated as 1Dy12.6) and 68407 Da (designated as 1Dy12.7) were larger than or close to that of 1Dy12 (68300 Da, GenBank: X03041), one of common HMW-GS reported previously [20]. In order to further characterize the two 1Dy subunits, SDS-PAGE method was carried out to separate HMW-GS composition of Huazhong830 and Luosimai. The SDS-PAGE analysis showed that 1Dy12.7 possessed similar electrophoretic mobility to 1Dy12 in Chinese Spring; the mobility of subunit 1Dy12.6 from Huazhong830 was slower than that of the subunit 1Dy12 from Chinese Spring (Fig 2A). The MALDI-TOF-MS profiles were consistent with the electrophoretic mobility order of SDS-PAGE results.

Fig 1. MALDI-TOF analysis of HMW-GS components in Chinese wheat landraces.

Fig 1

a. Luosimai; b. Huazhong830.

Fig 2. a. SDS-PAGE analysis of HMW-GS components in two Chinese wheat landraces. b. PCR amplification of the 1Dy genes.

Fig 2

3.2 Molecular Cloning and Characterization of the 1Dy12.6 and 1Dy12.7 genes

Since HMW-GS genes do not contain intron [24–25], the wheat genomic DNA can be used as a template to amplify the ORF region. A single amplified fragment about 2.0 kb in Huazhong830 was amplified using primers P1 and P2 (Fig 2B). The amplified PCR products from Luosimai consisted of two different fragments in size, about 2.2 kb and 2.0 kb, respectively (Fig 2B). The size of about 2.0 kb in length from the two Chinese wheat landraces, designated as 1Dy12.6 and 1Dy12.7 genes, respectively, were close to the size of 1Dy ORFs previously published. The length of their nucleotide sequences were 2022 bp and 1977 bp, containing 673 and 658 amino acid residues, respectively. Their deduced mature protein relative molecular masses (70,165 Da and 68,400 Da) were consistent with those identified by MALDI-TOF-MS (69,985 Da and 68,407 Da). The nucleotide and deduced amino acid sequences of the two novel Glu-D1-2 genes have been deposited in the GenBank with the accession number KR262518 for 1Dy12.6 and KR262519 for 1Dy12.7. To our knowledge, 1Dy12.6 was the largest active Glu-1Dy gene cloned up to date [44].

The deduced amino acid sequences of both 1Dy12.6 and 1Dy12.7 showed typical similar primary structural characteristics for HMW-GSs, which include a signal peptide of 21 amino acids removed from mature protein during the protein transportation to endoplasmic reticulum, followed by a non-repetitive conserved N-terminal region with 104 amino acids in both subunits, a long repetitive central domain of 506 and 491 residues for 1Dy12.6 and 1Dy12.7, respectively, and a conserved C-terminal region with 42 amino acids in both subunits. Both 1Dy12.6 and 1Dy12.7 have seven cysteine residues at the conserved positions, five in the N-terminal region, one in the central repetitive region close to the C-terminus and one in the C-terminal region. The central repetitive region of 1Dy12.6 and 1Dy12.7 is mainly composed of repeats of hexapeptide (consensus PGQGQQ) and nonapeptide (consensus GYYPTSLQQ) motifs, but without tripeptide (consensus GQQ). There are 48 hexapeptide and 20 nonapeptide repeat units in 1Dy12.6 subunit, in which hexapeptide units are contiguous or separated by other repeat motifs, and all nonapeptide units are separated by a hexapeptide unit or a PGQQ tetrapeptide. A total of 48 hexapeptide and 19 nonapeptide repeat units in 1Dy12.7 subunit were identified, hexapeptide motifs present in tandem or are separated by nonapeptide repeat units, and all nonapeptide units are separated by either a hexapeptide unit or a PGQQ tetrapeptide.

3.3 Comparison of 1Dy12.6 and 1Dy12.7 with Other Glu-1-2 Alleles

Sequences comparison revealed that gene sequences of 1Dy12.6 and 1Dy12.7 were homologous to the 1Dy type (Table 1). The sequences of both the 1Dy12.6 and 1Dy12.7 display higher identities (from 90.52% to 99.70%) with 13 1Dy alleles than with other 13 y-type HMW-GS genes on A and B genomes (from 80.08% to 91.60%). In comparison with the 13 1Dy alleles retrieved from the GenBank, the sequence of 1Dy12.6 is similar to the sequence EU266533 from Slovak wheat variety ‘Trebišovská 76’, with identity of 99.70%, and 1Dy12.7 is similar to the sequence JF736016 from wheat cultivar Shinchunaga (97.44%) [44]. The length of both 1Dy12.6 and EU266533 sequences is 2022 bp, and longer than other sequences of 1Dy allele (Table 1) [44].

Table 1. Identities of sequences among the 1Dy12.6, 1Dy12.7 and 26 other y-type HMW-GS genes from Triticum aestivum.

HMW-GS alleles GenBank accession Genome Gene Expression The length of ORF (bp) Deduced AA length Deduced relative molecular mass (Da) Identities of 1Dy12.6 Identities of 1Dy12.7
1Dy12* EU266533 AABBDD inactive 2022 673 70201 99.70% 94.23%
1Dy12 JF736016 AABBDD active 1977 658 68528 97.63% 97.44%
1Dy12 BK006459 AABBDD active 1977 658 68528 97.58% 97.39%
1Dy12 AY486484 AABBDD active 1977 658 68526 97.43% 97.24%
1Dy12 X03041 AABBDD active 1983 660 68713 97.29% 97.05%
1Dy12.2* FJ226583 AABBDD active 1977 658 68523 96.84% 97.19%
1Dy12.3 EF472958 AABBDD active 1959 652 67884 96.54% 96.39%
1Dy10.1 AY695379 AABBDD active 1968 655 68195 96.39% 96.49%
1Dy12* EU495302 AABBDD active 1977 658 68513 96.14% 96.14%
1Dy11 EU528008 AABBDD active 1914 637 66224 94.52% 90.98%
1Dy10 X12929 AABBDD active 1947 648 67475 94.31% 90.67%
1Dy10 AB281268 AABBDD active 1947 648 67547 94.26% 90.62%
1Dy10 EU287437 AABBDD active 1947 648 67602 94.16% 90.52%
1By15* KJ579440 AABBDD active 2109 702 73201 91.60% 89.20%
1By8.1 HQ731654 AABBDD inactive 2155 0 0 90.19% 90.01%
1By9 X61026 AABBDD active 2118 705 73517 90.08% 82.78%
1By15 EU137874 AABBDD active 2154 718 75150 88.22% 87.87%
1By15 KF733215 AABBDD active 2154 718 74738 88.09% 87.94%
1By16 EF540765 AABBDD active 2217 739 77283 87.57% 84.53%
1By15 DQ086215 AABBDD active 2172 724 75735 87.16% 83.88%
1By8 JF736014 AABBDD active 2163 720 75131 86.52% 83.94%
1By8 KF430649 AABBDD active 2163 720 75187 86.46% 83.88%
1By8xym7 KF855989 AABBDD active 2163 720 75131 86.34% 83.77%
1Ay JF736012 AABBDD inactive 1752 0 0 84.09% 80.76%
1Ay X03042 AABBDD inactive 1809 0 0 81.22% 81.03%
1Ay KC545955 AABBDD inactive 1791 0 0 80.42% 80.08%

3.4 Single Nucleotide Polymorphisms (SNPs) and Indels Identification

The ORF of 1Dy12.6 and 1Dy12.7 sequences was compared with that of the 1Dy active allele. A total of 20 SNPs and 3 Indels were detected at different positions along the sequences (Tables 2 and 3, S1 and S2 Figs). The 13 SNPs are transitions (A-G and T-C accounting for 65%) and 7 are transversions (A-C, A-T, and G-T accounting for 35%), which lead to 13 non-synonymous mutations, resulting in amino acid residue substitutions. In comparison with JF736016, a 45 bp insertion at the position of 958–1002 in the 1Dy12.6 was found, encoding a typical tandem nonapeptide and hexapeptide repetitive units (GHYPASQQQPGQGQQ). Only three SNPs between 1Dy12.6 and JF736016 were found at positions 368 (T→C, isoleucine→threonine), 1469 (G→A, arginine→glutamine), and 1687 (A→C, threonine→proline). Compared with JF736016, a 18 bp deletion at the position 540–541 coding a hexapeptide unit (QIGKGK) and a 18 bp insertion at the position from 700 to 717 encoding a hexapeptide unit (RQIGQG) were identified in the 1Dy12.7. Seventeen SNPs between JF7360166 and 1Dy12.7 were detected. Of which, ten were non-synonymous mutation at position 482 (T→C, leucine→proline), position 500 (A→G, glutamic acid→tryptophan), position 522 (T→G, histidine→glutamine), position 526 (T→C, serine→proline), position 556 (T→A, serine→threonine), position 571 (T→C, serine→proline), position 634 (C→A, proline→threonine), position 656 (G→T, glycine→valine), position 692 (G→A, glycine→glutamic acid), and position 1001 (G→A, arginine→glutamine).

Table 2. SNPs and Indels analysis of 1Dy12.6 gene compared with its most similar active allele JF736016.

Gene 368 958–1002 1469 1687
1Dy12.6 T(I) Indel1 G(R) A(T)
JF736016 C(T) ***(*) A(Q) C(P)

Note: Indel1

GGGCCCAGCTTCTCAGCAGCAGCCAGGACAAGGGCAACAA (GHYPASQQQPGQGQQ)

The Indels were marked by the asterisks “*”. The letters and “*” in parentheses were the substitutions and deletions of amino acids derived from the corresponding SNPs and Indels, respectively.

Table 3. SNPs and Indels analysis of 1Dy12.7 compared with its most similar active allele JF736016.

Gene 465 482 483 499 500 522 526 537 540–541 556 564 571 634 656 666 692 700–717 1001 1227
1Dy12.7 A T(L) G G A(E) T(H) T(S) A ***(*) T(S) A T(S) C(P) G(G) G G(G) Indel3 G(R) G
JF736016 T C(P) A T G(W) G(Q) C(P) G Indel2 A(T) G C(P) A(T) T(V) A A(E) ***(*) A(Q) A

Note: Indel2, CAGATAGGAAAAGGGAAA (QIGKGK); Indel3, CGGCAAATAGGACAAGGG (RQIGQG)

The Indels were marked by the asterisks “*”. The letters and “*” in parentheses were the substitutions and deletions of amino acids derived from the corresponding SNPs and Indels, respectively.

3.5 Secondary Structure of 1Dy12.6, 1Dy12.7, 1Dy10 and 1Dy12

The secondary structures of the 1Dy12.6, 1Dy12.7, 1Dy10 (associated with good bread-making quality) and 1Dy12 (associated with poor bread-making quality) subunits were analyzed using SSpro8 system and the results were given in Table 4.

Table 4. The secondary structure prediction of four HMW-GSs.

HMW-GS Motifs Content (%) Total (No.) NT Content (%) CR Content (%) CT Content (%) NT (No.) CR (No.) CT (No.)
1Dy12.6 alpha-helix 5.21 2 5.21 0 0 2 0 0
beta-turn 7.67 43 1.23 6.13 0.31 6 36 1
beta-bend 0.15 1 0 0 0.15 0 0 1
the rest 85.89 47 9.2 71.47 5.21 8.5 36 2.5
beta-strand 1.07 2 0.31 0 0.77 1 0 1
3-10-helix 0 0 0 0 0 0 0 0
pi-helix 0 0 0 0 0 0 0 0
beta-bridge 0 0 0 0 0 0 0 0
1Dy12.7 alpha-helix 5.34 2 4.4 0 0.94 1 0 1
beta-turn 8.01 47 1.57 6.28 0.16 8 38 1
beta-bend 0.31 2 0.31 0 0 2 0 0
the rest 86.34 50 10.04 70.81 5.49 9.5 38 2.5
beta-strand 0 0 0 0 0 0 0 0
3-10-helix 0 0 0 0 0 0 0 0
pi-helix 0 0 0 0 0 0 0 0
beta-bridge 0 0 0 0 0 0 0 0
1Dy10 alpha-helix 5.51 3 5.51 0 0 3 0 0
beta-turn 8.59 39 1.3 6.32 0.97 6 36 5
beta-bend 0.32 2 0.16 0 0.16 1 0 1
the rest 85.25 51 9.89 70.02 5.35 7.5 36 7.5
beta-strand 0.32 1 0 0 0.32 0 0 1
3-10-helix 0 0 0 0 0 0 0 0
pi-helix 0 0 0 0 0 0 0 0
beta-bridge 0 0 0 0 0 0 0 0
1Dy12 alpha-helix 4.38 1 4.38 0 0 1 0 0
beta-turn 7.82 46 1.56 5.95 0.31 8 36 2
beta-bend 0.16 1 0 0 0.16 0 0 1
the rest 87.32 49 10.02 71.21 6.1 10 36 3.5
beta-strand 0.31 1 0.31 0 0 1 0 0
3-10-helix 0 0 0 0 0 0 0 0
pi-helix 0 0 0 0 0 0 0 0
beta-bridge 0 0 0 0 0 0 0 0

Note: NT: N-terminal region; CT: C-terminal region; CR: central repetitive domain.

As shown in Table 4, 1Dy12.6 subunit possesses four kinds of secondary structure motifs, including α-helix (5.21%), β-turn (7.67%), β-bend (0.15%) and β-strand (1.07%), and the rest (85.89%). The β-turns are distributed in each of the three domains, mainly in central repetitive domain (6.13%), two α-helices only exist in the N-terminal, one β-bend exists in the C-terminal domain, and two β-strand are distributed in the N-terminal and C-terminal domain. 1Dy12.7 subunit has three kinds of secondary structure motifs, viz., 2 α-helices, 47 β-turns and 2 β-bends, and 50 the rests. In comparison with the 1Dy12, high proportion of α-helix is identified in the 1Dy12.6, 1Dy12.7 and 1Dy10. The content of β-turns in the four subunits is similar (approximately 8%). None of 3-10-helix, pi-helix, β-bridge were present in the four subunits.

3.6 Phylogenetic Analysis

To investigate the evolutionary relationships among the two novel 1Dy genes and other representative HMW-GS alleles, a phylogenetic tree was constructed based on the deduced amino acid sequences of 26 Glu-1 alleles, which included the novel 1Dy12.6 and 1Dy12.7 genes cloned in this research and other 24 HMW-GS genes retrieved from the GenBank. As shown in Fig 3, the phylogenetic tree clearly separated the 26 Glu-1 sequences into two groups, the x-type alleles of Glu-1-1 in one group and the y-type Glu-1-2 alleles in another group. Within the x-type allele group, the alleles from same genome were grouped together, clearly formed A, B and D genome subgroups. The x-type genes on A genome was sister to the genes on the D genomes. The y-type alleles were divided into two subclades, one comprised of the alleles from B genome and another comprised of the alleles from S and D genome. The 1Dy12.6 gene was closely related with 1Dy12, 1Dy12.4*t, Sy9* and 1Sy18*, whereas 1Dy12.7 gene was separated from Sy and other 1Dy alleles.

Fig 3. The phylogenetic tree of 26 HMW-GSs based on deduced amino acid sequences.

Fig 3

1Dy10.5t, 1Dy12.1 and 1Dy12.4*t from Aegilops tauschii; Sy9* and 1Sy18* from Aegilops speltoides; and 21 genes from Triticum aestivum.

Discussion

Wheat is an unique cereal crop due to the elasticity and viscosity conferred by wheat dough. Based on these special rheological properties, wheat flour has been used to produce a vast variety of foods, making it one of the staple foods for human diet. The viscous and elastic properties are mainly derived from two main storage protein groups, monomeric gliadins and polymeric glutenins in the endosperm, notably HMW-GSs [48]. In our study, two novel HMW-GS genes (1Dy12.6 and 1Dy12.7) from Chinese wheat landraces have been cloned and characterized.

The deduced protein sequences of two novel genes possess the typical feature of y-type glutenin subunit. Comparative sequence analysis showed that 1Dy12.6 and 1Dy12.7 genes are more similar to the glutenin genes on D genome. The phylogenetic tree showed that they obviously separated from the 1Dy subgroup, confirming that they belong to y-type subunit.

Previous studies proposed that a long repetitive central domain has a positive influence on dough visco-elastic properties since they can form more polymer–polymer interactions conferring elasticity to the protein polymers [48–51]. Molecular characterization revealed that 1Dy12.6 contains 673 amino acids with a 15 amino acid residue insertion in the central repetitive domain (one hexapeptide and one nonapeptide) compared with JF736016, which might be due to slip mismatching or unequal crossover event. The sequence of 1Dy12.6 is longer than other active 1Dy allele, and is the longest active 1Dy allele reported up to date [17]. The 1Dy12.6 subunit with a relative molecular mass of 69,985 Da possesses longer central repetitive domain than other 1Dy subunit, which may play a positive role in improving dough visco-elastic properties.

Some research have revealed that a set of intrachain and interchain disulphide bonds existed in HMW-GSs, including one interchain disulphide bond within the N-terminal region of an x-type subunit, two disulphide bonds between the N-terminal region of y-type subunits, one disulphide bond between LMW-GSs and y-type subunits, and one disulphide bond linking the x-type and y-type HMW-GSs [29,52–53]. These bonds form giant polymers [29,52–53]. The distribution and number of cysteine residues in HMW-GSs were believed to be important factors influencing wheat bread making quality [29,53]. In comparison with 1Bx7 subunit, two cysteine residues present in the N-terminal domain of 1Bx20 subunit, which were believed to be responsible for its negative effect on dough strength, and decrease the number of intrachain bonds and change the disulphide bond linking patterns in the wheat glutenin polymers [29]. However, an extra cysteine residue in the central repetitive domain of 1Dx5 subunit was considered to be responsible for its positive effect on quality property [53]. In this study, both novel genes displayed the same number of cysteine residues and distribution as other typical y-type HMW-GSs do, containing five in the N-terminal domain, one in the central domain close to the C-terminus and one in the C-terminal domain, which may be important for forming the normal gluten polymers.

The positive relationship between glutamine content in HMW-GS and its effect on dough strength has been revealed previously [49,54]. Theoretically, the high glutamine residue content helps form more hydrogen bonds in protein–protein interactions (“loop and train” model hypothesis) and maintain the structure of glutenin polymers [49,54–56]. In this study, although 1Dy12.6, 1Dy12.7, 1Dy10 and 1Dy12 possess different relative molecular masses and amino acids length, they contained very similar number and content of glutamine residues, which may form similar number of hydrogen bonds in polymers.

In this study, the secondary structures of 1Dy12.6 and 1Dy12.7 were predicted (Fig 3). The results showed that 1Dy12.6 and 1Dy12.7 subunits have similar content of α-helix, β-turn, and β-bend compared with the secondary structure of 1Dy10, which might be beneficial to the formation of wheat gluten polymers [28,49,57–58].

As HMW-GSs play a significant role in wheat bread making quality, the two novel genes can be used as special genetic resources for wheat quality breeding. In the future, it is important to explore the two novel HMW-GS alleles affecting end use value. We are under the way to create transgenic wheat that specifically expresses these novel 1Dy alleles in the endosperm to verify the function of these two novel HMW-GS alleles.

Supporting Information

S1 Fig. Alignment of the predicted primary structure of 1Dy12.6 and 1DyJF736016 HMW-GSs.

The dots indicate the deletion of amino acids relative to the 1Dy12.6 sequence. Substitutions are indicated by white and nattier blue background colors.

(TIF)

S2 Fig. Alignment of the predicted primary structure of 1Dy12.7 and 1DyJF736016 HMW-GSs.

The dots indicate the deletion of amino acids relative to the other sequence. Substitutions are indicated by white and nattier blue background colors.

(TIF)

Abbreviations

HMW-GS

high molecular weight glutenin subunit

MALDI-TOF-MS

matrix-assisted laser desorption/ionization time of flight mass spectrometry

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

PCR

polymerase chain reaction

Data Availability

All gene sequences are available from the gene bank database (accession numbers: KR262518 and KR262519).

Funding Statement

Funded by the “863” China High-Tech Research Program grant # 2011AA10A106 DFS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Payne PI, Lawrence GJ. Catalogue of alleles for the complex gene loci, Glu-A1, Glu-B1, and Glu-D1 which code for high-molecular-weight subunits of glutenin in hexaploid wheat. Cereal Res. Commun. 1983;11:29–35. [Google Scholar]
  • 2. Altpeter F, Vasil V, Srivastava V, Vasil IK. Integration and expression of the high-molecular-weight glutenin subunit 1Ax1 gene into wheat. Nat. Biotechnol. 1996;14:1155–1159. [DOI] [PubMed] [Google Scholar]
  • 3. Ma W, Zhang W, Gale KR. Multiplex-PCR typing of high molecular weight glutenin alleles in wheat. Euphytica 2003;134: 51–60. [Google Scholar]
  • 4. Anderson OD, Greene FC, Yip RE, Halford NG, Shewry PR, Malpica-Romero JM. Nucleotide sequences of the two high-molecular-weight glutenin genes from the D-genome of a hexaploid bread wheat, Triticum aestivum L. cv Cheyenne. Nucleic Acids Res.1989;17:461–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. D’ovidio R, Masci S, Porceddu E. Development of a set of oligonucleotide primers specific for genes at the Glu-1 complex loci of wheat. Theor. Appl. Genet. 1995;91:189–194. 10.1007/BF00220876 [DOI] [PubMed] [Google Scholar]
  • 6. D’ovidio R, Lafiandra D, Porceddu E. Identification and molecular characterization of a large insertion within the repetitive domain of a high-molecular-weight glutenin subunit gene from hexaploid wheat. Theor. Appl. Genet. 1996;93:1048–1053. 10.1007/BF00230123 [DOI] [PubMed] [Google Scholar]
  • 7. D’ovidio R, Simeone M, Masci S, Porceddu E, Kasarda DD. Nucleotide sequence of a γ -type glutenin gene from a durum wheat: correlation with a γ -type glutenin subunit from the same biotype. Cereal Chem. 1995;72:443–449. [Google Scholar]
  • 8. D’ovidio R, Masci S, Porceddu E, Kasarda DD. Duplication of the Bx7 high-molecular-weight glutenin subunit gene in bread wheat (Triticum aestivum L.) cultivar ‘Red River 68’. Plant Breed. 1997;116:525–531. [Google Scholar]
  • 9. Lukow OM, Forsyth SA, Payne PI. Over-production of HMW [High Molecular Weight] glutenin subunits coded on chromosome 1B in common wheat Triticum aestivum . J. Genet. Breed. 1992;46:187–192. [Google Scholar]
  • 10. Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia XC, et al. Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J. Cereal Sci. 2006;43: 94–101. [Google Scholar]
  • 11. Wrigley CW. Biopolymers-giant proteins with flour power. Nature 1996;381:738–739. [DOI] [PubMed] [Google Scholar]
  • 12. Yan ZH, Wan YF, Liu KF, Zheng YL, Wang DW. Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits. Chin Sci. Bull. 2002;47:222–226. [Google Scholar]
  • 13. Tatham AS, Drake AF, Shewry PR. Conformational studies of synthetic peptides corresponding to the repetitive regions of the high molecular weight (HMW) glutenin subunits of wheat. J. Cereal Sci. 1990;11:189–200. [Google Scholar]
  • 14. Wang JR, Yan ZH, Jiang QT, Wei YM, Baum BR, Zheng YL. Sequence variations and molecular phylogenetic analyses of the HMW-GS genes from different genomes in Triticeae. Biochem. Syst. Ecol. 2007;35: 421–433. [Google Scholar]
  • 15. Yan YM, Jiang Y, An XL, Pei YH, Li XH, Zhang YZ, et al. Cloning, expression and functional analysis of HMW glutenin subunit 1By8 gene from Italy pasta wheat (Triticum turgidum L. ssp. durum). J. Cereal Sci. 2009;50: 398–406. [Google Scholar]
  • 16. Payne PI, Nightingale MA, Krattiger AF, Holt LM. The relationship between HMW glutenin subunit composition and the bread-making quality of British-grown wheat varieties. J. Sci. Food Agric. 1987;40:51–65. [Google Scholar]
  • 17. Anderson OD, Greene FC. The characterization and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor. Appl. Genet. 1989;77:689–700. 10.1007/BF00261246 [DOI] [PubMed] [Google Scholar]
  • 18. Gupta RB, Paul JG, Cornish GB, Palmer GA, Bekes F, Rathjen AJ. Allelic variation at glutenin subunit and gliadin loci, Glu-1, Glu-3 and Gli-1, of common wheats. I. Its additive and interaction effects on dough properties. J. Cereal Sci. 1994;19:9–17. [Google Scholar]
  • 19. Butow BJ, Ma W, Gale KR, Cornish GB, Rampling L, Larroque O, et al. Molecular discrimination of Bx7 alleles demonstrates that a highly expressed high-molecular-weight glutenin allele has a major impact on wheat flour dough strength. Theor. Appl. Genet. 2003;107: 1524–1532. [DOI] [PubMed] [Google Scholar]
  • 20. Liu L, Wang AL, Appels R, Ma JH, Xia XC, Lan P, et al. A MALDI-TOF based analysis of high molecular weight glutenin subunits for wheat breeding. J. Cereal Sci. 2009;50: 295–301. [Google Scholar]
  • 21. Lawrence GJ, Shepherd KW. Chromosomal location of genes controlling seed proteins in species related to wheat. Theor. Appl. Genet. 1981;59: 25–31. 10.1007/BF00275771 [DOI] [PubMed] [Google Scholar]
  • 22. Shewry PR, Halford NG, Tatham AS. High molecular weight subunits of wheat glutenin. J. Cereal Sci. 1992;15: 105–120. [Google Scholar]
  • 23. Shewry PR, Tatham AS, Barro F, Barcelo P, Lazzeri P. Biotechnology of breadmaking: Unraveling and manipulating the multi-protein gluten complex. Bio/Technolgy. 1995;13: 1185–1190. [DOI] [PubMed] [Google Scholar]
  • 24. Shewry PR, Halford NG, Tatham AS. The high molecular weight subunits of wheat glutenin and their role in determining wheat processing properties. Adv. Food Nutr. Res. 2003;45: 219–302. [DOI] [PubMed] [Google Scholar]
  • 25. Shewry PR, Halford NG. Cereal seed storage proteins: structures, properties and role in grain utilization. J. Exp. Bot. 2002;53: 947–958. [DOI] [PubMed] [Google Scholar]
  • 26. Payne PI, Corfield KG, Holt LM, Blackman JA. Correlations between the inheritance of certain high-molecular weight subunits of glutenin and bread-making quality in progenies of six crosses of bread wheat. J. Sci. Food Agric. 1981;32: 51–60. [Google Scholar]
  • 27. Lukow OM, Payne PI, Tkachuk R. The HMW glutenin subunit composition of Canadian wheat cultivars and their association with bread-making quality. J. Sci. Food Agric. 1989;46: 451–460. [Google Scholar]
  • 28. Cornish GB, Békés F, Allen HM, Martin DJ. Flour proteins linked to quality traits in an Australian doubled haploid wheat population. Aust. J. Agric. Res. 2001;52: 1339–1348. [Google Scholar]
  • 29. Shewry PR, Gilbert S, Savage A, Tatham A, Wan YF, Belton P, et al. Sequence and properties of HMW subunit 1Bx20 from pasta wheat (Triticum durum) which is associated with poor end use properties. Theor. Appl. Genet. 2003;106: 744–750. [DOI] [PubMed] [Google Scholar]
  • 30. Marchylo BA, Lukow OM, Kruger JE. Quantitative variation in high molecular weight glutenin subunit 7 in some Canadian wheats. J. Cereal Sci. 1992;15:29–37. [Google Scholar]
  • 31. Payne PI. Genetics of wheat storage proteins and the effect of allelic variation on bread-making quality. Annu Rev Plant Biol. 1987;38: 141–153. [Google Scholar]
  • 32. Zhao XL, Xia XC, He ZH, Gale KR, Lei ZS, Appels R, et al. Characterization of three low-molecular-weight Glu-D3 subunit genes in common wheat. Theor. Appl. Genet. 2006;113: 1247–1259. [DOI] [PubMed] [Google Scholar]
  • 33. Liu L, Ikeda TM, Branlard G, Peña RJ, Rogers WJ, Lerner SE, et al. Comparison of low molecular weight glutenin subunits identified by SDS-PAGE, 2-DE, MALDI-TOF-MS and PCR in common wheat. BMC Plant Biol. 2010;10, 124 10.1186/1471-2229-10-124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Gianibelli MC, Gupta RB, Lafiandra D, Margiotta B, MacRitchie F. Polymorphism of high Mrglutenin subunits in Triticum tauschii: Characterisation by chromatography and electrophoretic methods. J. Cereal Sci. 2001;33: 39–52. [Google Scholar]
  • 35. Gao LY, Ma WJ, Chen J, Wang K, Li J, Wang SL, et al. Characterization and comparative analysis of wheat high molecular weight glutenin subunits by SDS-PAGE, RP-HPLC, HPCE, and MALDI-TOF-MS. J. Agric. Food Chem. 2010;58: 2777–2786. 10.1021/jf903363z [DOI] [PubMed] [Google Scholar]
  • 36. Chen J, Lan P, Tarr A, Yan YM, Francki M, Appels R, et al. MALDI-TOF based wheat gliadin protein peaks are useful molecular markers for wheat genetic study. Rapid Commun. Mass Spectrom. 2007;21: 2913–2917. [DOI] [PubMed] [Google Scholar]
  • 37. Cunsolo V, Foti S, Saletti R, Gilbert S, Tatham AS, Shewry PR. Structural studies of glutenin subunits 1Dy10 and 1Dy12 by matrix-assisted laser desorption/ionisation mass spectrometry and high-performance liquid chromatography/electrospray ionisation mass spectrometry. Rapid Commun. Mass Spectrom. 2003;17: 442–454. [DOI] [PubMed] [Google Scholar]
  • 38. Cunsolo V, Foti S, Saletti R, Gilbert S, Tatham AS, Shewry, PR. Structural studies of the allelic wheat glutenin subunits 1Bx7 and 1Bx20 by matrix-assisted laser desorption/ionization mass spectrometry and high-performance liquid chromatography/electrospray ionization mass spectrometry. J. Mass Spectrom 2004;39: 66–78. [DOI] [PubMed] [Google Scholar]
  • 39. Muccilli V, Cunsolo V, Saletti R, Foti S, Masci S, Lafiandra D. Characterization of B- and C-type low molecular weight glutenin subunits by electrospray ionization mass spectrometry and matrix-assisted laser desorption/ionization mass spectrometry. Proteomics. 2005;5: 719–728. [DOI] [PubMed] [Google Scholar]
  • 40. Wang K, An XL, Pan LP, Dong K, Gao LY, Wang SL, et al. Molecular characterization of HMW-GS 1Dx3 t and 1Dx4 t genes from Aegilops tauschii and their potential value for wheat quality improvement. Hereditas. 2012;149: 41–49. 10.1111/j.1601-5223.2011.02215.x [DOI] [PubMed] [Google Scholar]
  • 41. Zheng W, Peng YC, Ma JH, Appels R, Sun DF, Ma WJ. High frequency of abnormal high molecular weight glutenin alleles in Chinese wheat landraces of the Yangtze-River region. J. Cereal Sci. 2011;54: 401–408. [Google Scholar]
  • 42. Shewry PR, Powers S, Field JM, Fido RJ, Jones HD, Arnold GM, et al. Comparative field performance over 3 years and two sites of transgenic wheat lines expressing HMW subunit transgenes. Theor. Appl. Genet. 2006;113: 128–136. [DOI] [PubMed] [Google Scholar]
  • 43. Pierucci VRM, Tilley M, Graybosch RA, Blechl AE, Bean SR, Tilley KA. Effects of overexpression of high molecular weight glutenin subunit 1Dy10 on wheat tortilla properties. J. Agric. Food Chem. 2009;57: 6318–6326. 10.1021/jf900629s [DOI] [PubMed] [Google Scholar]
  • 44. Mihálik D, Nogová L, Ondreičková K, Gubišová M, Gubiš J, Gregová E, et al. A new high-molecular-weight glutenin subunit from the slovak wheat (Triticum aestivum L.) cultivar ‘Trebišovská 76’. Food Sci. Biotechnol. 2013;22: 33–37. [Google Scholar]
  • 45. Kussmann M, Nordhoff E, Rahbek-Nielsen H, Haebel S, Rossel-Larsen M, Jakobsen L, et al. Matrix-assisted laser desorption/ionization mass spectrometry sample preparation techniques designed for various peptide and protein analytes. J Mass Spectrom. 1997;32: 593–601. [Google Scholar]
  • 46. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013;30: 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Subburaj S, Chen GX, Han CX, Lv DW, Li XH, Zeller FJ, et al. Molecular characterisation and evolution of HMW glutenin subunit genes in Brachypodium distachyon L. J. Appl. Genet. 2014;55: 27–42. 10.1007/s13353-013-0187-4 [DOI] [PubMed] [Google Scholar]
  • 48. Gianibelli MC, Larroque OR, MacRitchie F, Wrigley CW. Biochemical, genetic, and molecular characterization of wheat glutenin and its component subunits. Cereal Chem. 2001;78: 635–646. [Google Scholar]
  • 49. Belton PS. Mini review: on the elasticity of wheat gluten. J. Cereal Sci. 1999;29: 103–107. [Google Scholar]
  • 50. Masci S, D’ovidio R, Lafiandra D, Kasarda DD. A 1B-coded low-molecular-weight glutenin subunit associated with quality in durum wheats shows strong similarity to a subunit present in some bread wheat cultivars. Theor. Appl. Genet. 2000;100: 396–400. [Google Scholar]
  • 51. Tatham AS, Miflin BJ, Shewry PR. The beta-turn conformation in wheat gluten proteins: relationship to gluten elasticity. Cereal Chem. 1985;62: 405–412. [Google Scholar]
  • 52. Kohler P, Keck B, Muller S, Wieser H. Disulphide bonds in wheat gluten In: Wheat kernel proteins, molecular and functional aspects. Viterbo, Italy: University of Tuscia; 1994; pp. 45–54. [Google Scholar]
  • 53. Lafiandra D, D'ovidio R, Porceddu E, Margiotta B, Colaprico G. New data supporting high M r glutenin subunit 5 as the determinant of quality differences among the pairs 5 + 10 vs. 2 + 12. J. Cereal Sci. 1993;18: 197–205. [Google Scholar]
  • 54. Belton PS, Colquhoun IJ, Grant A, Wellner N, Field JM, Shewry PR, et al. FTIR and NMR studies on the hydration of a high-M r subunit of glutenin. Int. J. Biol. Macromol. 1995;17:74–80. [DOI] [PubMed] [Google Scholar]
  • 55. Belton PS, Gil AM, Grant A, Alberti E, Tatham AS. Proton and carbon NMR measurements of the effects of hydration on the wheat protein ω-gliadin. Spectrochim Acta A 1998;54:955–966. [Google Scholar]
  • 56. Gilbert SM, Wellner N, Belton PS, Greenfield JA, Siligardi G, Shewry PR, et al. Expression and characterisation of a highly repetitive peptide derived from a wheat seed storage protein. Biochim. Biophys. Acta. 2000;1479:135–146. [DOI] [PubMed] [Google Scholar]
  • 57. Li XH, Zhang YZ, Gao LY, Wang AL, Ji KM, He ZH, et al. Molecular cloning, heterologous expression, and phylogenetic analysis of a novel y-type HMW glutenin subunit gene from the G genome of Triticum timopheevi . Genome. 2007;50:1130–1140. [DOI] [PubMed] [Google Scholar]
  • 58. Pandey R, Mishra A, Garg GK. Plant promoter driven heterologous expression of HMW glutenin gene(s) subunit in E. coli . Mol. Biol. Rep. 2008;35:153–162. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Alignment of the predicted primary structure of 1Dy12.6 and 1DyJF736016 HMW-GSs.

The dots indicate the deletion of amino acids relative to the 1Dy12.6 sequence. Substitutions are indicated by white and nattier blue background colors.

(TIF)

S2 Fig. Alignment of the predicted primary structure of 1Dy12.7 and 1DyJF736016 HMW-GSs.

The dots indicate the deletion of amino acids relative to the other sequence. Substitutions are indicated by white and nattier blue background colors.

(TIF)

Data Availability Statement

All gene sequences are available from the gene bank database (accession numbers: KR262518 and KR262519).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES