Skip to main content
NCBI home page
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Oct 19;112(44):13478–13483. doi: 10.1073/pnas.1511482112

A distinct pathway for tetrahymanol synthesis in bacteria

Amy B Banta 1,1, Jeremy H Wei 1,1, Paula V Welander 1,2
PMCID: PMC4640766  PMID: 26483502

Significance

Sterols and sterol-like lipids have critical physiological roles in both eukaryotes and bacteria. These cyclic lipids are also well preserved in ancient rocks and can function as microbial molecular fossils. Gammacerane is one such lipid that is used as an indicator of water column stratification deep in time. However, a proper interpretation of gammacerane biosignatures requires a full understanding of the biosynthesis and taxonomic distribution of one of its potential precursors, tetrahymanol, in modern microbes. Here we establish that bacterial tetrahymanol producers are more diverse than previously thought and demonstrate that bacteria have evolved a biochemical mechanism distinct from eukaryotes for synthesizing tetrahymanol.

Keywords: gammacerane, tetrahymanol, biomarkers, methanotrophs, sterols

Abstract

Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

Sterols are cyclic triterpenoid lipids that are ubiquitous and essential in eukaryotes and which play a key role in various cellular functions including maintaining membrane integrity, stress tolerance, and phagocytosis (1–3). However, not all eukaryotes are capable of producing sterols de novo (4). Tetrahymena pyriformis, a ciliated protozoan commonly found in aquatic environments, is a sterol auxotroph that must obtain these lipids through its diet (5). However, T. pyriformis is also capable of thriving in anoxic ecosystems where sterol biosynthesis is restricted due to a lack of oxygen. Under these sterol-starvation conditions, T. pyriformis produces the polycyclic triterpenoid tetrahymanol which is thought to function as a sterol surrogate (Fig. 1A) (6, 7).

Fig. 1.

Fig. 1.

Open in a new tab

Tetrahymanol biosynthesis requires a hypothetical protein of unknown function. (A) Structure of tetrahymanol and its proposed diagenetic product gammacerane. (B) Left shows growth of M. alcaliphilum over 5 d and represents one growth curve done in triplicate (error bars represent biological triplicate samples and may be smaller than markers). Open circles represent time points when cells were harvested for lipid analysis. Right shows eightfold increase in tetrahymanol in stationary phase cells versus late exponential phase cells. (C) GC-MS extracted ion chromatograms (m/z 191) demonstrating loss of tetrahymanol (IV) and 3-methyltetrahymanol (V) after deletion of locus MEALZ_1626 in M. alcaliphilum. Other lipids identified: I, 4-dimethylsterol; II, hopenes; and III, 3-methylhopenes.

Tetrahymanol was first discovered in T. pyriformis (8) and has subsequently been detected in other eukaryotes including numerous marine and freshwater ciliates, an anaerobic free-living protist, an anaerobic rumen fungus, and a fern plant (9–11). Tetrahymanol has also been detected directly in freshwater and marine sediments (12, 13), and it is recognized as a biological precursor of gammacerane (Fig. 1A), a polycyclic hydrocarbon detected in sedimentary rocks dating as far back as the late Proterozoic (∼850 Mya) (14–16). Based on the common occurrence of tetrahymanol in stratified aquatic environments today, the gammacerane index—a relative measurement of the prevalence of gammacerane in a sample—is used as an indicator for water column stratification (possibly linked to hypersalinity) during source rock deposition (12, 13, 17, 18).

Tetrahymanol is also a minor component of the lipidome of two α-Proteobacteria belonging to the Bradyrhizobiaceae family, Rhodopseudomonas palustris and Bradyrhizobium japonicum (19–21), and it is uncertain how significant this bacterial production of tetrahymanol is for interpreting gammacerane biosignatures. Although a direct correlation between sterol starvation and tetrahymanol production has been established in ciliates (6), the physiological role of tetrahymanol in bacteria is unknown. Recent studies have highlighted increased tetrahymanol production in R. palustris TIE-1 under certain physiological conditions (e.g., photoautotrophic growth) and also when cellular hopanoid lipid profiles are altered in gene deletion mutants (22, 23), but the physiological significance of these changes is not known. Further, the biochemical mechanism of tetrahymanol synthesis in bacteria is unclear. In ciliates, squalene-tetrahymanol cyclase (Stc) catalyzes the cyclization of squalene directly to tetrahymanol (24), but neither of the two known bacterial tetrahymanol producers harbor a copy of Stc (10, 24). R. palustris and B. japonicum do possess an evolutionarily related cyclase, squalene-hopene cyclase (Shc), whose main function is the cyclization of squalene to the hopanoid diploptene (25). It has been proposed that bacterial Shc in tetrahymanol-producing bacteria is a low-fidelity enzyme (26) that could conditionally produce tetrahymanol in addition to hopanoids. In support of this, deletion of shc in R. palustris and B. japonicum eliminates both hopanoid and tetrahymanol production (27, 28). However, Shc alone cannot convert squalene to tetrahymanol in vitro (29, 30), suggesting that another protein could be involved in its biosynthesis.

Consequently, our lack of understanding of tetrahymanol function and biosynthesis in bacteria has led to the assumption that tetrahymanol is not widespread in the bacterial domain. However, our knowledge of the diversity of extant tetrahymanol producers relies on direct observation of a lipid that may be conditionally produced in organisms that are not well studied. Therefore, in this study, we set out to identify bacterial tetrahymanol biosynthesis genes that could function as genetic markers that would allow us to assess the potential for tetrahymanol synthesis in the bacterial domain in a culture-independent manner.

Results

Tetrahymanol Production in a γ-Proteobacterium.

Methylomicrobium alcaliphilum is an obligate aerobic methanotroph isolated from sediments of a hypersaline alkaline lake (31) whose genome encodes homologs of several hopanoid and sterol biosynthesis genes (32). Lipid analysis of M. alcaliphilum revealed tetrahymanol and a putative 3-methyltetrahymanol in addition to an array of aminohopanoids, 3-methylaminohopanoids, and 4-methylsterols typically found in γ-Proteobacterial methanotrophs (Figs. S1 and S2) (33, 34). The presence of tetrahymanol was unexpected because M. alcaliphilum is neither physiologically nor phylogenetically close to the Bradyrhizobiaceae family, the only bacteria known to synthesize tetrahymanol. M. alcaliphilum not only produces significantly more tetrahymanol than what is typically observed in the α-Proteobacterial species (20, 21, 30) but also varies the amount of tetrahymanol under different culture conditions (Fig. 1B). Specifically, we observed an eightfold increase in tetrahymanol in stationary phase cells (day 5 of growth) compared with late exponential phase cells (day 1.5 of growth). Given the higher levels of tetrahymanol production in M. alcaliphilum, this organism seemed ideal for pursuing studies to uncover potential tetrahymanol biosynthesis proteins.

Fig. S1.

Fig. S1.

Open in a new tab

Initial GC-MS and LC-MS analyses of Methylomicrobium alcaliphilum 20Z lipid extracts. (A) GC-MS combined extracted ion chromatogram (m/z 191, 205, and 456) run on a DB5-HT column showing the production of dimethylsterol, hopenes (such as diploptene), tetrahymanol, and the 3-methyl derivatives of the hopenes and tetrahymanol. The production of tetrahymanol and 3-methyltetrahymanol has not been previously observed in a methanotroph. (B) LC-MS combined extracted ion chromatogram (m/z 714, 728, 772, and 786) demonstrating the production of aminohopanoids and their 3-methyl derivatives. (C) Mass spectra of the tetrahymanol peaks from A with mass spectra of R. palustris tetrahymanol for comparison.

Fig. S2.

Fig. S2.

Open in a new tab

Hopanoids, tetrahymanol, and sterol structures observed in M. alcaliphilum 20Z.

Identification of a Tetrahymanol Synthase.

To identify putative bacterial tetrahymanol biosynthesis proteins, we used comparative genomics to search for protein-encoding genes present in M. alcaliphilum, R. palustris, and B. japonicum but absent in bacteria that we have experimentally verified to produce hopanoids but not tetrahymanol (Materials and Methods). The resultant 31 M. alcaliphilum genes have no homologs (maximum e-value 1e-5) in tetrahymanol producing ciliates and other eukaryotes. However, one gene, encoding a hypothetical protein with no identifiable motifs (locus tag: MEALZ_1626), occurs in all Methylomicrobium, Bradyrhizobium, and Rhodopseudomonas genomes and exclusively in bacterial genomes also containing squalene-hopene cyclase (maximum e-value 1e-50). Although the genomic context of this protein does not demonstrate a link to lipid biosynthesis, its distribution pattern in bacterial genomes led us to hypothesize that MEALZ_1626 may play a role in tetrahymanol production. Deletion of this locus in M. alcaliphilum resulted in a loss of tetrahymanol but not hopanoids (Fig. 1C). Further, placing the MEALZ_1626 gene in a permissible site on the chromosome of the deletion strain restored production of tetrahymanol (Fig. S3A), indicating that this gene, renamed ths for tetrahymanol synthase, encodes a protein that is specifically required to produce tetrahymanol.

Fig. S3.

Fig. S3.

Open in a new tab

Complementation of ∆ths strains. (A) Complementation of M. alcaliphilum ∆ths. GC-MS extracted ion (m/z 191) chromatograms of M. alcaliphilum ths mutants with an IPTG-inducible expression cassettes recombined onto the chromosome at another location: control cassette (MEALZ_2523::PlacUV5) or with the M. alcaliphilum ths gene (MEALZ_2523::PlacUV5-MEALZ_1626). As a control, the wild-type strain with the control cassette was grown under the same conditions (NMS-MOPS with 100 μM IPTG induction). (B) Complementation of R. palustris ∆ths. GC-MS extracted ion (m/z 191) chromatograms of R. palustris ths mutants containing an empty vector (pSRKGm) or the vector plus the R. palustris ths gene (Rpal_0860) under an IPTG inducible promoter (pAB239). As a control, the empty vector was introduced into the wild-type strain and grown under the same conditions (YPS-MOPS plus 400 μg/mL gentamicin with 100 μM IPTG induction).

Homologs of M. alcaliphilum Ths are present in 104 bacterial genomes in three different phyla (Table S1), including several α-Proteobacteria (Rhodopseudomonas, Bradyrhizobium, Nitrobacter, Afipia, Agromonas, and Rhodovulum species), aerobic methanotrophic γ-Proteobacteria (Methylomonas and Methylomicrobium species), and sulfate-reducing δ-Proteobacteria (Desulfovibrio species). The occurrence of ths in the sulfate-reducing Desulfovibrio was surprising; several strains of these anaerobic bacteria synthesize hopanoids, but there are no reports of tetrahymanol production (35). However, lipid analysis verified that Desulfovibrio inopinatus is capable of producing trace amounts of tetrahymanol (Fig. S4).

Table S1.

Genomes that contain Ths homologs

Genome Locus tag Isolation/environment
α-Proteobacteria
 Afipia sp. P52-10 X566_10940 Pteropus vampyrus (flying fox)
 Agromonas oligotrophica S58 Ga0040870_00508 Soil
 Bradyrhizobium daqingense CGMCC 1.10947 IQ17DRAFT_06411 Soybean nodules
 Bradyrhizobium elkanii USDA 3254 A3AMDRAFT_08310 Plant root nodule
 Bradyrhizobium elkanii USDA 3259 YUGDRAFT_07985 Plant root nodule
 Bradyrhizobium elkanii USDA 76 BraelDRAFT_1824 Plant root nodule
 Bradyrhizobium elkanii USDA 94 A3AKDRAFT_07700 Plant root nodule
 Bradyrhizobium elkanii WSM1741 YUODRAFT_03582 Plant root nodule
 Bradyrhizobium elkanii WSM2783 YY7DRAFT_01093 Plant root nodule
 Bradyrhizobium geno sp. SA-4 CB756 BrageDRAFT_7438 Plant root nodule
 Bradyrhizobium huanghuaihaiense CGMCC 1.10948 IQ16DRAFT_03532 Soybean nodules
 Bradyrhizobium japonicum 22 K410DRAFT_0048 Soil
 Bradyrhizobium japonicum SEMIA 5079 BJS_05503 Plant root nodule
 Bradyrhizobium japonicum SEMIA 5080 BJA5080_084046 Plant root nodule
 Bradyrhizobium japonicum USDA 110 blr0371 Soybean nodules
 Bradyrhizobium japonicum USDA 122 YUEDRAFT_07452 Soybean nodules
 Bradyrhizobium japonicum USDA 123 K287DRAFT_03345 Soybean nodules
 Bradyrhizobium japonicum USDA 124 B370DRAFT_07213 Soybean nodules
 Bradyrhizobium japonicum USDA 135 YUQDRAFT_05604 Soybean nodules
 Bradyrhizobium japonicum USDA 38 A3AODRAFT_08781 Soybean nodules
 Bradyrhizobium japonicum USDA 4 A3AQDRAFT_07038 Soybean nodules
 Bradyrhizobium japonicum USDA 6 BJ6T_03280 Plant root nodule
 Bradyrhizobium japonicum in8p8 K408DRAFT_06793 Soil
 Bradyrhizobium japonicum is5 K409DRAFT_06714 Soil
 Bradyrhizobium sp. ARR65 BraARR65DRAFT_00062690 Plant root nodule
 Bradyrhizobium sp. Ai1a-2 K288DRAFT_04581 Plant root nodule
 Bradyrhizobium sp. BTAi1 BBta_0546 Plant root nodule
 Bradyrhizobium sp. CCGE-LA001 BCCGELA001_38077 Plant root nodule
 Bradyrhizobium sp. Cp5.3 K289DRAFT_06548 Plant root nodule
 Bradyrhizobium sp. DOA9 BDOA9DRAFT_00928 Plant root nodule
 Bradyrhizobium sp. EC3.3 YUUDRAFT_07418 Plant root nodule
 Bradyrhizobium sp. OHSU_III BOHSU_00122 Human blood
 Bradyrhizobium sp. ORS 375 Soil
 Bradyrhizobium sp. ORS278 BRADO6983 Plant root nodule
 Bradyrhizobium sp. ORS285 BRAO285_2000064 Plant root nodule
 Bradyrhizobium sp. S23321 S23_04650 Soil
 Bradyrhizobium sp. STM 3809 BRAS3809_3320004 Plant root nodule
 Bradyrhizobium sp. STM 3843 Ga0040047_03975 Unknown
 Bradyrhizobium sp. TV2a.2 A3AIDRAFT_01685 Plant root nodule
 Bradyrhizobium sp. Th.b2 K359DRAFT_08377 Plant root nodule
 Bradyrhizobium sp. URHA0002 H981DRAFT_05818 Soil
 Bradyrhizobium sp. URHA0013 N551DRAFT_06790 Soil
 Bradyrhizobium sp. URHD0069 N554DRAFT_02734 Soil
 Bradyrhizobium sp. USDA 3384 A3CKDRAFT_07339 Plant root nodule
 Bradyrhizobium sp. WSM1253 Bra1253DRAFT_05268 Plant root nodule
 Bradyrhizobium sp. WSM1417 Bra1417DRAFT_1210 Plant root nodule
 Bradyrhizobium sp. WSM1743 YU9DRAFT_03378 Plant root nodule
 Bradyrhizobium sp. WSM2254 A3M7DRAFT_06549 Plant root nodule
 Bradyrhizobium sp. WSM2793 A3ASDRAFT_07576 Plant root nodule
 Bradyrhizobium sp. WSM3983 YUADRAFT_05669 Plant root nodule
 Bradyrhizobium sp. WSM4349 B041DRAFT_06240 Plant root nodule
 Bradyrhizobium sp. WSM471 Bra471DRAFT_00486 Plant root nodule
 Bradyrhizobium sp. YR681 PMI42_04321 Plant root nodule
 Bradyrhizobium yuanmingense CGMCC 1.3531 IQ15DRAFT_04103 Plant root nodule
 Methylobacterium nodulans ORS 2060 Mnod_2759 Plant root nodule
 Nitrobacter hamburgensis X14 Nham_3607 Soil
 Nitrobacter sp. Nb-311A NB311A_10388 Marine coastal surface water
 Nitrobacter winogradskyi Nb-255 Nwi_3035 Soil
 Rhodopseudomonas palustris 0001L RP0001L_03284 Woods Hole
 Rhodopseudomonas palustris 1a1 RP1a1_00796 Bonn, Germany
 Rhodopseudomonas palustris 420L RP420L_03909 Florence, Italy
 Rhodopseudomonas palustris 7850, DSM 127 RPDSM127_02726 Rock pond
 Rhodopseudomonas palustris AP1 RPAP1_01619 Appelbergen, Netherlands
 Rhodopseudomonas palustris ATH 2.1.37, ATCC 17007 RPATCC17007_01238 Surface water or mud
 Rhodopseudomonas palustris ATH 2.1.6, ATCC 17001 RPATCC17001_01427 Surface water or mud
 Rhodopseudomonas palustris ATH 2.1.6, NCIB 8288 RPNCIB8288_01128 Surface water or mud
 Rhodopseudomonas palustris BIS3 RPBIS3_05218 Freshwater sediment
 Rhodopseudomonas palustris BisA53 RPE_0899 Freshwater sediment
 Rhodopseudomonas palustris BisB18 RPC_4687 Freshwater sediment
 Rhodopseudomonas palustris BisB5 RPD_0783 Freshwater sediment
 Rhodopseudomonas palustris CEA001 RPCEA001_01377 Woods Hole
 Rhodopseudomonas palustris CGA009 RPA0792 Freshwater sediment
 Rhodopseudomonas palustris DCP3 RPDCP3_02772 Biesbosch, Netherlands
 Rhodopseudomonas palustris DX-1 Rpdx1_0952 Unknown
 Rhodopseudomonas palustris HaA2 RPB_4627 Freshwater sediment
 Rhodopseudomonas palustris JA1, ATCC BAA-37 RPATCCBAA37_04980 Wastewater
 Rhodopseudomonas palustris JSC-3b V510DRAFT_02489 China
 Rhodopseudomonas palustris KD1 RPKD1_02480 Freshwater sediment
 Rhodopseudomonas palustris No7 RPNo7_02187 Chiba, Japan
 Rhodopseudomonas palustris O.U.11, DSM 7375 RPDSM7375_02781 Wastewater
 Rhodopseudomonas palustris P4 RPP4_02450 Wastewater
 Rhodopseudomonas palustris Pfennig 1850, DSM 126 RPDSM126_01434 Polluted pond
 Rhodopseudomonas palustris R1, DSM 8283 RPDSM8283_02051 Soil
 Rhodopseudomonas palustris RCH350 RPRCH350_03900 Woods Hole
 Rhodopseudomonas palustris RCH500 RPRCH500_01987 Woods Hole
 Rhodopseudomonas palustris RSP24 RPRSP24_01120 Woods Hole
 Rhodopseudomonas palustris S-1, DSM 131 RPDSM131_03185 Garden pond
 Rhodopseudomonas palustris S55 RPS55_05054 Kyoto, Japan
 Rhodopseudomonas palustris TIE-1 Rpal_0860 Freshwater wetlands (Woods Hole)
 Rhodopseudomonas palustris WS17 RPWS17_03557 Freshwater sediment
 Rhodopseudomonas sp. B29 I5MDRAFT_05036 Wild rice plant
 Rhodovulum sp. PH10 A33M_0328 Soil
δ-Proteobacteria
 Desulfovibrio africanus DSM 2603 H585DRAFT_04008 Well water
 Desulfovibrio africanus PCS PCS_01904 Freshwater sediment
 Desulfovibrio africanus Walvis Bay DesafDRAFT_3256 Marine mud after eruption of submarine hydrogen sulfide
 Desulfovibrio bastinii DSM 16055 G496DRAFT_01177 Freshwater sample collected in an oil pipeline
 Desulfovibrio ferrireducens DSM 16995 Ga0056056_1632 Freshwater Arctic fjord sediment
 Desulfovibrio frigidus DSM 17176 BR06DRAFT_00713 Freshwater Arctic fjord sediment
 Desulfovibrio hydrothermalis DSM 14728 H588DRAFT_00092 Marine deep-sea hydrothermal chimney wall
 Desulfovibrio inopinatus DSM 10711 G451DRAFT_00423 Marine sediment
 Desulfovibrio salexigens DSM 2638 Desal_2967 Mud in British Guyana
 Desulfovibrio zosterae DSM 11974 H589DRAFT_2637 Rhizosphere of eel grass
γ-Proteobacteria
 Methylomicrobium agile ATCC 35068 CC94DRAFT_2329 Freshwater wetlands
 Methylomicrobium album BG8 MetalDRAFT_0956 Freshwater
 Methylomicrobium alcaliphilum 20Z MEALZ_1626 Surface sediment of the highly alkaline soda lake Shara-Nur
 Methylomicrobium kenyense AMO1 IQ34DRAFT_2618 Surface sediment of a Kenyan soda lake
 Methylomonas denitrificans FJG1 JT25_04955 Unknown
Bacteriodetes
 Bacteroidales bacterium PSC KfJoeBact2-2 K513DRAFT_10007 Termite gut endosymbiont
Open in a new tab

Fig. S4.

Fig. S4.

Open in a new tab

GC-MS analysis of Desulfovibrio inopinatus lipid extracts. (A) Extracted ion chromatogram (m/z 191) showing the production of hopenes and tetrahymanol. (B) Mass spectra of the tetrahymanol peak.

An unrooted maximum likelihood tree of Ths amino acid sequences from cultured organisms (Fig. 2A and Figs. S5A and S6) indicates that there are two divergent lineages of Ths: one comprises the α-Proteobacteria, and a second comprises the γ-Proteobacterial methanotrophs and δ-Proteobacterial sulfate-reducing bacteria. To verify that Ths homologs in the α-Proteobacteria are truly involved in tetrahymanol synthesis, we deleted the R. palustris TIE-1 ths homolog (locus tag: Rpal_0860, 28% identity and 43% similarity to M. alcaliphilum Ths). Tetrahymanol production was lost in the R. palustris Δths strain (Fig. 2B). Expression of ths from a plasmid restored tetrahymanol biosynthesis in the mutant, verifying that this protein is a bona fide tetrahymanol synthase in the α-Proteobacteria phyla as well (Fig. S3B).

Fig. 2.

Fig. 2.

Open in a new tab

The MEALZ_1626 homolog from α-Proteobacteria is a bona fide tetrahymanol synthase. (A) Unrooted maximum likelihood phylogenetic tree of putative tetrahymanol synthase protein sequences demonstrating two potentially divergent lineages. The numbers following each phylum name indicate the number of sequences in each phylum. The full phylogenetic tree and the sequence alignment are provided in Supporting Information. (B) GC-MS extracted ion chromatograms (m/z 191) demonstrating loss of tetrahymanol (IV) and 2-methyltetrahymanol (III) after deletion of locus Rpal_0860 in R. palustris. Other lipids identified: I, 2-methyldiplopterol, and II, diplopterol.

Fig. S5.

Fig. S5.

Fig. S5.

Open in a new tab

(A) Unrooted PhyML tree of tetrahymanol synthase protein homologs from bacterial genomes. This expanded tree was modified with the iTOL online tools to create Fig. 2A. Colored fonts represent the following phyla: blue, α-Proteobacteria; black, δ-Proteobacteria; and red, γ-Proteobacteria. Genomic context and sequence homology of various hopanoid genes as well as rRNA genes indicate that the Bacteroidales strain may belong to the α-Protebacteria rather than the Bacteriodetes phylum as listed in the JGI IMG database. (B) Unrooted PhyML tree of tetrahymanol synthase protein sequences from bacterial genomes and metagenomes. Redundancy in the alignment used to generate the tree in A was reduced to groups with ≥75% similarity using Decrease Redundancy (web.expasy.org/decrease_redundancy/). Metagenomic sequences were aligned with genomic sequences via MAFFT. Blue fonts represent metagenome sequences. Clades that contained only soil metagenomic sequences were collapsed to allow the tree to be displayed on one page. Numbers in parentheses represent the number of Ths metagenome sequences in that collapsed clade.

Fig. S6.

Fig. S6.

Fig. S6.

Open in a new tab

Amino acid sequence alignment of Ths homologs. Sequence similarities from MUSCLE-aligned sequences were rendered using ESPript 3.0 (57). Red shading indicates 100% conserved residues, red letters indicate residues that are similar within a group, and residues framed in blue are similar across groups. Consensus sequence >70% similarity is indicated below aligned sequences with 100% conserved residues capitalized and conservative substitutions indicated by #, $, !, and %. Redundancy in the full dataset (104 sequences) was reduced to groups with ≥75% similarity using Decrease Redundancy (web.expasy.org/decrease_redundancy/), and a representative of each group is displayed: Methylobacterium_nodulans ORS 2060 (M.nodulans), Rhodovulum sp. PH10 (R._sp_PH10), Rhodopseudomonas palustris BisB18 (R.pal_BisB18), Rhodopseudomonas palustris JSC-3b (R.pal_JSC-3b), Rhodopseudomonas palustris TIE-1 (R.pal_TIE-1), Afipia sp. P52-10 (A._sp._P52-10), Nitrobacter winogradskyi Nb-255 (N.winogradsky), Bradyrhizobium sp. ARR65 (B._sp._ARR65), Bradyrhizobium japonicum USDA 122 (B.japonicum), Bradyrhizobium elkanii USDA 76 (B.elkanii), Desulfovibrio inopinatus DSM 10711 (D.inopinatus), Desulfovibrio africanus Walvis Bay (D.africanus), Desulfovibrio bastinii DSM 16055 (D.bastinii), Desulfovibrio hydrothermalis DSM 14728 (D.hydrothermalis), Methylomicrobium alcaliphilum 20Z (M.alcaliphilum), Methylomicrobium kenyense AMO1 (M.kenyense), Methylomicrobium agile ATCC 35068 (M.agile), and Methylomonas sp. FJG1 (M._sp_FJG1).

To better understand the types of ecosystems tetrahymanol-producing bacteria might inhabit, we searched for homologs of Ths in environmental metagenomes (2,606 total JGI environmental metagenomes; e-value cutoff: 1e-05). We identified 472 potential Ths homologs in 35 different metagenomes (Fig. 3 and Table S2) including 25 soil, 8 freshwater, and 2 marine metagenomes. An unrooted maximum likelihood tree constructed with a subset of Ths metagenome and genome sequences (Fig. S5B) demonstrates that the majority of soil metagenome Ths homologs clustered within the α-Proteobacterial clade. This clustering suggests that these bacteria are a potential source of tetrahymanol in terrestrial environments. A few freshwater lake sequences also clustered within the α-Proteobacteria, but those associated with methanotrophy (e.g., Lake Washington samples) were more closely related to the γ-Proteobacterial methanotrophs (Fig. S5B). Overall, the distribution of Ths in metagenomes seems to reflect the environmental distribution of the Ths-containing cultured bacteria as shown in Table S1.

Fig. 3.

Fig. 3.

Open in a new tab

Tetrahymanol synthase homologs found in metagenomes are restricted to freshwater, soil, and marine environments. All Joint Genome Institute (JGI) environmental metagenome databases were queried for homologs to the M. alcaliphilum Ths (e-value cutoff: 1e-05). A total of 472 Ths sequences were identified in 35 different metagenomes. Each bar represents the number of metagenomes with Ths sequences in the indicated ecosystem category.

Table S2.

Metagenomes and metatranscriptomes that contain Ths homologs

IMG genome name IMG genome IDs Ecosystem category Ecosystem subtype Ecosystem type No. of hits
Metagenomes
 Bog forest soil microbial communities from Calvert Island, British Columbia, Canada 3300003368; 3300003351 Aquatic Wetlands Freshwater 3
 Freshwater and sediment microbial communities from a dead zone in Lake Erie, USA 3300002184 Aquatic Lentic Freshwater 2
 Freshwater lake sediment microbial communities from the University of Notre Dame, USA, of lakes that contribute to methane emissions 3300003859; 3300003861 Aquatic Lentic Freshwater 8
 Freshwater sediment methanotrophic microbial communities from Lake Washington under simulated oxygen tension 3300004184; 3300004180; 3300004175; 3300004178; 3300004177; 3300004173; 3300004204; 3300004182; 3300004206; 3300004207; 3300004198; 3300004197; 3300004183; 3300004199; 3300004179; 3300004556 Aquatic Sediment Freshwater 70
 Freshwater sediment microbial communities from Lake Washington, Seattle, USA, for methane and nitrogen cycles 2046860007; 2046860006; 2088090013; 2088090009; Aquatic Lentic Freshwater 9
 Sediment microbial communities from Loktak lake India 3300003152 Aquatic Lentic Freshwater 1
 Lentic microbial communities from Lake Waban, Wellesley MA, that are anoxygenic and photosynthetic 3300000497 Aquatic Lentic Freshwater 6
 Freshwater sediment microbial communities from Lake Washington, Seattle, USA, for methane and nitrogen cycles (replicates) 2088090005; 2088090006 Aquatic Lentic Freshwater 10
 Wetland microbial communities from Twitchell Island in the Sacramento Delta 3300000313; 3300000090 Aquatic Wetlands Marine 6
 Deep oceanic, basalt-hosted subsurface ecosystem from Juan de Fuca Ridge flank, Pacific Ocean 3300004069 Aquatic Hydrothermal Vents Marine 1
 Arabidopsis rhizosphere microbial communities from the University of North Carolina 3300000044 Terrestrial Loam Soil 1
 Arctic peat soil microbial communities from the Barrow Environmental Observatory site, Barrow, Alaska, USA 3300002162; 3300003369; 3300001870; 3300002549; 3300002565; 3300001394; 3300001407; 3300001412; 3300001414; 3300001396; 3300001385; 3300001416; 3300001383; 3300001397; 3300001402; 3300001399; 3300001417; 3300001413; 3300001405; 3300001418; 3300001401; 3300001384; 3300001408; 3300001452; 3300001403; Terrestrial Unclassified Soil 63
 Forest soil microbial communities from Douglas fir zone in British Columbia and Gulf Coastal Plain in Texas, USA (Jackpine, Algoma, Ontario, Canada) 3300001545; 3300001546; 3300001369; 3300001160; 3300001081; 3300001471 Terrestrial Loam Soil 41
 Forest soil microbial communities from Amazon Forest, Brazil 3300000793; 3300000893; 3300000837 Terrestrial Unclassified Soil 3
 Forest soil microbial communities from Douglas fir zone in British Columbia and Gulf Coastal Plain in Texas, USA (Davy Crockett National Forest, TX, USA) 3300001157; 3300001204 Terrestrial Loam Soil 2
 Forest soil microbial communities from Douglas fir zone in British Columbia and Gulf Coastal Plain in Texas, USA (El Dorado National Forest, CA, USA) 3300000907; 3300001455; 3300001283; 3300001085; 3300000897; 3300001147; 3300000712; 3300001164; 3300000732; 3300001120; 3300000908; 3300000912 Terrestrial Loam Soil 34
 Forest soil microbial communities from Harvard Forest Long Term Ecological Research (LTER) site in Petersham, MA, for long-term soil warming studies 3300001622; 3300001613; 3300002954 Terrestrial Loam Soil 3
 Forest soil microbial communities from Douglas fir zone in British Columbia and Gulf Coastal Plain in Texas, USA (Black Spruce, Ontario, Canada) 3300001181; 3300001100; 3300001137 Terrestrial Loam Soil 4
 Soil microbial communities from 10 grassland sites in CA, CO, KS, KY, MN, MO, NM, SC, TX, that have been nitrogen fertilized (Willamette National Forest) 3300001074 Terrestrial Loam Soil 2
 Soil microbial communities from Mediterranean grasslands, California (Hopland Soil) 3300001686; 3300001305 Terrestrial Loam Soil 43
 Grasslands soil microbial communities from the Angelo Coastal Reserve, California, USA 3300002557; 3300002908; 3300002915; 3300002558; 3300002916 Terrestrial Unclassified Soil 7
 Peatlands soil microbial communities from Germany and Austria, that are sulfate reducing 3300000567; 3300001356 Terrestrial Unclassified Soil 6
 Soil microbial communities from permafrost in Bonanza Creek, Alaska 2088090008; 2124908041; 2124908043; 2124908029; 2140918007; 2140918025; 2140918008; 2124908032; 2140918006 Terrestrial Unclassified Soil 20
 Soil and rhizosphere microbial communities from Centre INRS-Institut Armand-Frappier, Laval, Canada 3300005158; 3300005146; 3300005163; 3300005169; 3300005164; 3300005148; 3300005147; 3300005161; 3300005159; 3300005168 Terrestrial Unclassified Soil 60
 Soil microbial communities from four geographically distinct crusts in the Colorado Plateau and Sonoran desert (Green Butte sample) 3300000095 Terrestrial Sand Soil 2
 Soil microbial communities from Great Prairies (Iowa) 2088090015; 3300000033; 2228664021 Terrestrial Unclassified Soil 11
 Soil microbial communities from permafrost in Bonanza Creek, Alaska 2124908044 Terrestrial Unclassified Soil 2
 Soil microbial communities from Rifle, Colorado, USA 3300002122; 3300002407; 3300002120; 3300002503; 3300002243 Terrestrial Loam Soil 7
 Soil microbial communities from FACE and OTC sites in USA (Maryland Estuary) 2032320004; 2035918006 Terrestrial Unclassified Soil 8
 Soil microbial communities from FACE and OTC sites in USA (North Carolina) 2035918004; 2040502001 Terrestrial Unclassified Soil 6
 Soil microbial communities from FACE and OTC sites in USA (Oak Ridge) 2032320005; 2032320006 Terrestrial Unclassified Soil 2
 Soil microbial communities from FACE and OTC sites in USA (Wisconsin Rhinelander) 2124908009; 2124908007; 2124908006 Terrestrial Unclassified Soil 16
 Soil microbial communities from FACE and OTC sites in USA (Nevada Test Site) 2119805009; 2119805012; 2081372006; 2119805011 Terrestrial Unclassified Soil 4
 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA 3300002128 Terrestrial Unclassified Soil 2
 Tropical forest soil microbial communities from Luquillo Experimental Forest, Puerto Rico 3300000734 Terrestrial Loam Soil 1
Metatranscriptomes
 Wetland microbial communities from Twitchell Island in the Sacramento Delta 3300003938 Aquatic Wetlands Marine 1
 Tropical rainforest soil microbial communities from the Amazon Forest, Brazil, for analyzing deforestation at different spatial scales 3300004629 Terrestrial Unclassified Soil 5
Open in a new tab

Tetrahymanol Synthase Mechanism.

Our genetic analyses indicate that ths is required for tetrahymanol biosynthesis in bacteria. As mentioned above, the squalene-hopene cyclase is also required, but it is unclear if any additional characteristics of Shc or the cellular environment in tetrahymanol-producing bacteria are necessary. To test this, we expressed M. alcaliphilum ths in two hopanoid-producing strains that typically do not synthesize tetrahymanol, the γ-Proteobacterium Methylococcus capsulatus Bath (36) and the β-Proteobacterium Burkholderia phytofirmans PsJN (37, 38). Both ths+ strains produced tetrahymanol (Fig. 4), demonstrating that ths is sufficient to induce tetrahymanol biosynthesis in hopanoid-producing bacteria and that the occurrence of both ths and shc in a genome is a strong indicator of tetrahymanol production.

Fig. 4.

Fig. 4.

Open in a new tab

Heterologous expression of M. alcaliphilum tetrahymanol synthase (ths) induces tetrahymanol production in Methylococcus capsulatus and Burkholderia phytofirmans. GC-MS combined extracted ion chromatograms (m/z 191, 456, and 442) of lipids extracted from (A) M. capsulatus or (B) B. phytofirmans cells expressing tetrahymanol synthase (ths) from a plasmid (pSRK-ths) compared with the empty vector control (pSRKGm). Lipids identified: I, 4-methylsterol (m/z 442); II, 4-dimethylsterol (m/z 456); III, hopenes (m/z 191); and IV, tetrahymanol (m/z 191).

However, it still remained unclear how Shc and Ths together catalyzed the conversion of squalene to tetrahymanol. A mechanism in which Ths demethylates squalene at the C-23 position to generate C(23)-norsqualene before cyclization by Shc (Fig. 5A) is plausible based on in vitro studies (39). However, this mechanism would require addition of the C-23 methyl group after cyclization to form tetrahymanol. A more straightforward scenario would require Shc to first cyclize squalene to a hopene, such as diploptene (27, 28), and then Ths would convert this hopene to tetrahymanol via a ring expansion (Fig. 5A). To test these two possibilities, we first engineered Escherichia coli to produce high levels of squalene by introducing a plasmid that expresses the M. alcaliphilum squalene synthase (sqs) gene as well as a second plasmid that increases overall isoprenoid synthesis (40, 41). This strain, also expressing M. alcaliphilum ths from a third plasmid, did not demethylate or otherwise modify squalene, nor did it produce tetrahymanol, indicating that Ths was not directly using squalene as a substrate (Fig. 5B and Fig. S7). We next modified this E. coli strain to produce hopenes by introducing a plasmid that expresses both M. alcaliphilum sqs and shc and found that expression of M. alcaliphilum ths in this system resulted in tetrahymanol production (Fig. 5B). Taken together, these data strongly suggest that Ths is converting a hopene to tetrahymanol rather than modifying squalene before cyclization.

Fig. 5.

Fig. 5.

Open in a new tab

Tetrahymanol synthase functions on hopenes rather than squalene. (A) Two potential bacterial tetrahymanol biosynthetic pathways. In gray, Ths first demethylates squalene to form C-(23)-norsqualene, which is then converted to a demethyl derivative of tetrahymanol by Shc. This pathway would require the addition of a methyl group at C-23 to form tetrahymanol. In red, Shc cyclizes squalene to diploptene, and Ths then expands the E ring to form tetrahymanol. Conversion of isoprenoids to squalene is catalyzed by Sqs, and conversion of squalene to tetrahymanol in eukaryotes is catalyzed by Stc (black arrows). Solid arrows indicate reactions that have been demonstrated in vitro (24, 30, 39, 40), and dashed arrows are proposed steps. (B) GC-MS combined extracted ion chromatograms (m/z 69, 191, and 215) of E. coli strains engineered to produce squalene or hopenes with and without coexpression of M. alcaliphilum ths. Production of tetrahymanol (V) is observed when ths is expressed in the strain synthesizing hopenes (red). Sqs, squalene synthase; Shc, squalene-hopene cyclase; Ths, tetrahymanol synthase; and Stc, squalene-tetrahymanol cyclase. Lipids identified: I, squalene (m/z 69); II, hop-17 (21)-ene (m/z 191); III, cholestanol standard (m/z 215); IV, hopenes (m/z 191); and V, tetrahymanol (m/z 191). Full total ion chromatograms are shown in Supporting Information.

Fig. S7.

Fig. S7.

Open in a new tab

GC-MS lipid analysis demonstrating production of squalene, hopenes, and tetrahymanol by engineered E. coli cells. (A) Total ion chromatograms used to generate Fig. 5B. Hopene peak encompasses both hop-22(29)-ene and hop-21-ene. Hop-17(21)-ene is an isomer of the hopenes usually generated during the lipid extraction and/or acetylation procedure (52). See Fig. S2 for structures. (B) Mass spectra of selected peaks. ths, tetrahymanol synthase; sqs, squalene synthase; and shc, squalene-hopene cyclase. Cholestanol standard indicated by an asterisk.

Discussion

The discovery of tetrahymanol synthase demonstrates the effectiveness of combining comparative genomics and classical genetics with organic geochemistry to link gene identity to novel protein functions. There is a critical need for these types of studies given the rapid rate at which acquisition of genomic data are currently outpacing the assignment of hypothetical protein function. The tetrahymanol synthase case is particularly compelling because this protein has no known motifs or characterized homologs, nor does the genomic context provide any clues to its involvement in lipid synthesis. Thus, without the framework provided by lipid analysis and comparative genomics it would have been difficult to link the ths open reading frame with tetrahymanol biosynthesis.

Our findings also indicate that tetrahymanol biosynthesis has experienced convergent evolution with eukaryotes and bacteria developing distinct mechanisms for producing the same molecule. Studies of the biochemical mechanism involved in catalyzing the conversion of squalene to tetrahymanol by Ths and Shc will prove useful in better constraining the evolutionary history of cyclic triterpenoid biosynthesis. Our data suggest that Ths is functioning by expanding the E ring of a hopene after cyclization of squalene by Shc. Although we cannot yet distinguish which hopene is converted to tetrahymanol, a ring expansion of diploptene through the protonation of the C-22 double bond to propagate a carbocation seems most likely as this mechanism is similar to what occurs in the formation of the C ring during cyclization of squalene to hopene by Shc (25). However, because Ths has no identifiable motifs that could be responsible for protonation of the diploptene double bond, further studies of the structure and function of Ths may reveal novel protein folds or biochemical mechanisms.

Our analysis of Ths distribution in genomes and metagenomes demonstrates that the potential for tetrahymanol production is more widespread in the bacterial domain than previously thought. We find that Ths homologs are present in a variety of α-Proteobacteria typically found in soil environments associated with plants. Further, the majority of metagenomic Ths homologs we identify in this study tend to cluster within the α-Proteobacteria clades. Thus, tetrahymanol-producing α-Proteobacteria are potentially a significant source of tetrahymanol in terrestrial systems. The low abundance of Ths homologs in marine metagenomes, despite the presence of ths in a few marine bacterial isolates (Table S1), suggests that bacterial tetrahymanol production may not be common in modern marine ecosystems. However, this restricted distribution may be a result of biases in the available genomic and metagenomic databases rather than a true accounting of tetrahymanol-producing bacteria in these ecosystems. As more metagenomes become publicly available, we may see an increase in environmental Ths sequences. Nonetheless, the genomic and metagenomic data we have now suggest that marine ciliates may be the predominant depositional source of tetrahymanol in marine environments (42), whereas bacterial sources may be significant in terrestrial or lacustrine ecosystems.

The production of tetrahymanol in aerobic methanotrophs and sulfate-reducing bacteria is also notable. First, not all aerobic methanotroph or sulfate-reducing bacterial genomes have a Ths homolog, indicating that only a subset of these taxa have the potential to produce tetrahymanol. Physiological studies aimed at understanding why only certain methanotroph or sulfate-reducing bacterial species produce tetrahymanol may demonstrate a correlation between this lipid and specific environmental niches or physiological conditions. Second, recent studies have documented the occurrence of aerobic methanotrophs in the suboxic zone of stratified marine and freshwater water bodies, whereas sulfate-reducing bacteria are often found in the anoxic sediments of these systems (43–48). Thus, tetrahymanol synthesis in bacteria may be functionally linked to these types of stratified environments. This is significant because the gammacerane index is used primarily as an indicator of stratified conditions in ancient ecosystems (17, 18). The identification of Ths enables physiological studies to directly test a potential link between environmental conditions and tetrahymanol in bacteria. We can now characterize levels of ths expression as well as phenotypes of ths gene deletion mutants in cultured strains under environmental conditions relevant to water stratification (e.g., high salinity, suboxic, or sulfidic). In addition, ths can be used as a genetic marker to probe for the capability of bacterial tetrahymanol biosynthesis in stratified environments and also for environmental transcriptomic studies to assess how changes in these ecosystems affect ths expression. If a functional link can be established in bacteria between tetrahymanol and a response to specific environmental parameters relevant to water stratification, then gammacerane would continue to function as a robust indicator of water stratification conditions regardless of whether the depositional source was bacterial or eukaryotic.

Materials and Methods

Bacterial Strains, Media, and Growth Conditions.

Strains used in this study are listed in Table S3. Escherichia coli was cultured in lysogeny broth (LB) or terrific broth (TB) at 37 °C. Methylococcus capsulatus Bath was cultured in nitrate mineral salts (NMS) medium (49) supplemented with 5 μM CuSO4 and 100 μM ferric citrate at 37 °C. Methylomicrobium alcaliphilum 20Z was cultured at 30 °C in modified high salt NMS medium (HS-NMS, 1.5% NaCl, pH 9) as detailed in ref. 50. Rhodopseudomonas palustris TIE-1 was cultured in YPS-MOPS pH 7 at 30 °C (28). Burkholderia phytofirmans PsJN was cultured in 0.2X tryptic soy broth (TSB) at 30 °C. Methanotroph cultures were sealed in serum vials without removing the ambient air and provided ultrapure methane at 60 kPa over ambient pressure. All liquid cultures were incubated at the appropriate temperature with shaking at 225 RPM. For growth on solid medium, LB, NMS, HS-NMS, YPS-MOPS, or TSB was solidified with 1.5% agar. Media was supplemented, if necessary, with gentamicin (10 μg/mL for E. coli, B. phytofirmans, and methanotrophs; 800 μg/mL on plates and 400 μg/mL in liquid for R. palustris), carbenicillan (100 µg/mL), chloramphenicol (20 µg/mL), 600 μM diaminopimelic acid (DAP), or sucrose (5% for M. alcaliphilum; 10% for R. palustris). For conjugal transfer of plasmids, HS-NMS plates were supplemented with Difco nutrient broth and modified to reduce the salt to 0.2% and the pH to 8 (50). Methanotroph plates were incubated in Vacu-Quik Jars (Almore International, Inc.) filled with ultrapure methane at 20 kPa over ambient pressure. Two 40-mL cultures of Desulfovibrio inopinatus grown in DSMZ 196-13781 medium plus 14 mM lactate were generously supplied by the Bosak Laboratory (MIT).

Table S3.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer Genotype, description, or sequence Sources and notes
Strain
 Escherichia coli DH10B Strain used for constructing plasmids F− endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC)λ− D. Newman (Caltech)
 Escherichia coli BW29427 DAP auxotroph used as donor strain for conjugation thrB1004 pro thi rpsL hsdS lacZΔM15 RP4-1360 Δ(araBAD)567 ΔdapA1341::[erm pir (wt)]; D. Newman (Caltech)
 Methylomicrobium alcaliphilum 20Z Wild type (DSM19304) DSMZ
 Methylococcus capsulatus Bath Wild type M. Klotz (UNC Charlotte)
 Rhodopseudomonas palustris TIE-1 Wild type D. Newman (Caltech)
 Desulfovibrio inopinatus Wild type T. Bosak (MIT)
 Burkholderia phytofirmans PsJN Wild type (DSM 17436) DSMZ
 M. alcaliphilum Δths Locus MEALZ_1626 deleted This study
 M. alcaliphilum 20Z, PlacUV5 control MEALZ_2523::PlacUV5, pABB348 recombined into chromosome at locus Mealz_2523, complementation control strain This study
 M. alcaliphilum Δths, PlacUV5 control ΔMEALZ_1626, MEALZ_2523::PlacUV5, pABB348 recombined into chromosome at locus Mealz_2523, complementation control strain This study
 M. alcaliphilum Δths PlacUV5-ths+ ΔMEALZ_1626, MEALZ_2523::PlacUV5-mealz_1626, pABB349 recombined into chromosome at locus Mealz_2523, ths complementation strain This study
 R. palustris Δths Locus Rpal_0860 deleted This study
Plasmid
 pJQ200SK Mobilizable suicide vector; sacB Gmr (62)
 pSRKGm Broad host range self-replicating plasmid; pBBR1 ori, lac promoter, lacZα Gmr (63)
 pTrc99a Self-replicating plasmid; pBR322 ori, lacUV5 promoter Ampr (64)
 pCM184 Mobilizable suicide vector with kanr cassette flanked by loxP sites (65)
 pBbA5c-MevT(CO)-MBIS(CO, ispA) (pJBEI2997) (Addgene #35151, J. Keasling and T. S. Lee); p15A ori, Cmr (41)
 pJW002 MEALZ_1626 deletion construct This study
MEALZ_1626 upstream region (956bp) was PCR amplified with primers MAH1626 US For and Rev and cloned into pJQ200SK at XhoI/PstI to generate pJQ200SK + MEALZ_1626 US.
MEALZ_1626 downstream region (999bp) was PCR amplified with primers MAH1626 DS For and Rev and cloned into pJQ200SK + MEALZ_1626 US at PstI/NotI.
 pPVW135 Rpal_0860 deletion construct This study
Rpal_0860 upstream region (1100bp) was PCR amplified with primers RPT1 and RPT2. Rpal_0860 downstream region (1100bp) was PCR amplified with primers RPT3 and RPT4.
Both fragments were cloned into BamHI cut pJQ200SK at one time via SLIC.
 pSRKGm-ths (pABB238) MEALZ_1626 expression plasmid (IPTG-inducible) This study
MEALZ_1626 was amplified by CR with primers AB149 and AB150 and cloned into the NdeI site of pSRK-Gm via SLIC.
 pSRKGm-Rpal_0860 (pABB239) Rpal_0860 expression plasmid (IPTG-inducible) This study
Rpal_0860 was amplified by PCR with primers AB151 and AB152 and cloned into the NdeI site of pSRK-Gm via SLIC.
 pSRK-lacUV5-Gm (pABB251) Broad host range self-replicating plasmid; pBBR ori, lacUV5 promoter, lacZα Gmr This study
Lac promoter of pSRK-Gm was modified to stronger lacUV5 promoter by site-directed mutagenesis using oligonucleotide AB165
 pSRK-lacUV5-Gm-ths (pABB261) MEALZ_1626 expression plasmid (IPTG-inducible, lacUV5 promoter) This study
Lac promoter of pABB238 was modified to stronger lacUV5 promoter by site-directed mutagenesis using oligonucleotide AB165
 pTrc-sqs (pABB303) MEALZ_3096 expression plasmid This study
MEALZ_3096 was amplified by PCR with primers AB206 and AB207 and cloned into the NcoI site of pTrc99a via SLIC.
 pTrc-sqs-shc (pABB305) MEALZ_3096-3097 expression plasmid This study
The MEALZ_3096-3097 operon was amplified by PCR with primers AB206 and AB209 and cloned into the NcoI site of pTrc99a via SLIC.
 pJQ200SK-MEALZ_2523US- PlacUV5-ths-kanr-MEALZ_2523DS (pABB348) Mobilizable suicide vector for insertion of PlacUV5 control expression cassette onto chromosome. Insert MEALZ_2523-US (amplified with AB235 and AB198), lacI-lacUV5 expression cassette from pABB251 (amplified with AB201 and AB202), kanr cassette (amplified with AB084 and AB085 from pCM184) and MEALZ_2523-DS (amplified with AB199 and AB236) into ApaI and NheI sites of pJQ200SK using SLIC This study
 pJQ200SK-MEALZ2523US-PlacUV5-ths-kanr-MEALZ2523DS (pABB349) Mobilizable suicide vector for insertion of PlacUV5-ths expression cassette onto chromosome. Insert MEALZ_2523-US (amplified with AB235 and AB198), lacI-lacUV5 expression cassette from pABB261 (amplified with AB201 and AB202), kanr cassette (amplified with AB084 and AB085 from pCM184) and MEALZ_2523-DS (amplified with AB199 and AB236) into ApaI and NheI sites of pJQ200SK using SLIC This study
Primer
 MAH1626 US For GGCGCGCCCTCGAGTGATGCACAAACAAGGCACA AscI/XhoI
 MAH1626 US Rev GAATTCCTGCAGGTGCTTGGGGATTCGGTTTT EcoRI/PstI
 MAH1626 DS For GAATTCCTGCAGCATGCGCCTTTCCTGAATCA EcoRI/PstI
 MAH1626 DS Rev GGCGCGCCGCGGCCGCTGCATCTCGGTAGCGGTAAT AscI/NotI
 MAH1626 US Seq For TTATTGGCGCACTTGGATCG Sequence verification of MEALZ_1626 upstream region in pJW002
 MAH1626 US Seq Rev CATCGCTGTTGTTTGATCGC Sequence verification of MEALZ_1626 upstream region in pJW002
 MAH1626 DS Seq For TCGGCCGATAATTGACCGTA Sequence verification of MEALZ_1626 downstream region in pJW002
 MAH1626 DS Seq Rev TGCATAGCGGTTTGATCGAG Sequence verification of MEALZ_1626 downstream region in pJW002
 MAH1626 internal For ACGAGCGACTTATCCCGATT Screen for MEALZ_1626 deletion
 MAH1626 internal Rev GTCGCCGGTTGATGAGAATC Screen for MEALZ_1626 deletion
 MAH1626 US of US3 CCTCTTCGAGTTTGATGCCG Verify MEALZ_1626 deletion
 MAH1626 DS of DS3 CGTTTAAGCCGGCAGTACC Verify MEALZ_1626 deletion
 RPT1 Rpal0860 del US For CGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGATAGGGATTACGGCGCGAG Used to construct pPVW135 (SLIC)
 RPT2 Rpal0860 del US Rev CAGCGCCAGCCCCAGCAGCACGAAAGCCGAGGTCACTTCCGATCGCACAGGTCATACAGC Used to construct pPVW135 (SLIC)
 RPT3 Rpal0860 del DS For CGCCCGGAAACAAGCGCCGACGCTGTATGACCTGTGCGATCGGAAGTGACCTCGGCTTTC Used to construct pPVW135 (SLIC)
 RPT4 Rpal0860 del DS Rev CTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGTAATGGGTCCAGAACAGCGG Used to construct pPVW135 (SLIC)
 RPT9 Rpal0860 US Seq GCGGGTCTTTTGCGTATGAA Sequence verification of Rpal_0860 upstream region in pPVW135
 RPT10 Rpal0860 DS Seq CCTTCTCCTCGGCCTCATAG Sequence verification of Rpal_0860 downstream region in pPVW135
 RPT7 Rpal0860 Int For CTACAAGAACTCGACGCTGC Screen for Rpal_0860 deletion
 RPT8 Rpal0860 Int Rev TCGATCCAGGTGACGATTCC Screen for Rpal_0860 deletion
 RPT5 Rpal0860 US of US GTTGTAAAACGACGGCCAGT Verify Rpal_0860 deletion
 RPT6 Rpal0860 DS of DS GTAGCTGAACAGGAGGGACA Verify Rpal_0860 deletion
 AB084 GGTACCTTAAGGACCTAGGCATATGGCGGCCGCAT Cloning of pABB348 and pABB349
 AB085 TAGGGCCCGCGGTATCGATAAGCTGGATCC Cloning of pABB348 and pABB349
 AB149 TAACAATTTCACACAGGAAACAGCAATGACAAAAAACGCAAACCTCTATGACAT Clone MEALZ_1626 into pSRK NdeI F
 AB150 TTGCGCGCTTGGCGTAATCATGGTCATATTACTACGATGGGTATGATTCAGGAAAGG Clone MEALZ_1626 into pSRK NdeI R
 AB151 TAACAATTTCACACAGGAAACAGCAATGGATGTGCTGAAGATGGCCGGC Clone Rpal_860 into pSRK NdeI F
 AB152 GCTTGGCGTAATCATGGTCATATTATCAGGCTTGCTGCACAGGCTG Clone Rpal_860 into pSRK NdeI F
 AB165 TCCGGCTCGTATAATGTGTGGAATTGTG lac to lacUV5 QC primer
 AB198 CCATTCGATGGTGTCAATCAGAATTCTGACTTCCCTTTAGTATTAGCGGT Cloning of pABB348 and pABB349
 AB199 CAGCTTATCGATACCGCGGGCCCTAAGTTGCGTAGGTCGGGTTAGC Cloning of pABB348 and pABB349
 AB201 AATTCTGATTGACACCATCGAATGG Cloning of pABB348 and pABB349
 AB202 CATATGCCTAGGTCCTTAAGGTACCGGATCCACTAGTTCTAGAGCGG Cloning of pABB348 and pABB349
 AB206 ACAATTTCACACAGGAAACAGACATGAGCGCATTACAACCAACACT Clone MEALZ_3096 into pTrc99 NcoI F
 AB207 CGGGTACCGAGCTCGAATTCTTATTATAGTGCTGACTTAGCTTTCAGGGATTGT Clone MEALZ_3096 into pTrc99 NcoI R
 AB209 CGGGTACCGAGCTCGAATTCTTATCACGAGTTATTGATCGCGTTACGG Clone Mealz_3097 into pTrc99 NcoI R
 AB235 TATAGGGCGAATTGGGTACCGGGCCCCTTCAAGATGAGGTATTATCCGCTCATATTGGT Cloning of pABB348 and pABB349
 AB236 CAACATAGTAAGCCAGTATACACTCCGTGCAAAATCTGCATTCATGCCATCCT Cloning of pABB348 and pABB349
Open in a new tab

Molecular Cloning Techniques.

Plasmids and oligonucleotides used in this study are listed in Table S3. Details of molecular cloning techniques are described in Supporting Information.

Construction of Tetrahymanol Synthase Mutants.

A homologous recombination-based selection/counterselection method previously used in M. capsulatus was used to delete the MEALZ_1626 locus in M. alcaliphilum (51). The deletion plasmid pJW002 was transferred into M. alcaliphilum via conjugation using the donor strain E. coli BW29427, a dap auxotroph, as described in refs. 50 and 51. Merodiploids with pJW002 integrated into the M. alcaliphilum chromosome were selected on HS-NMS plates containing gentamicin. Single gentamicin-resistant colonies were cultured without antibiotic for 3 d to allow excision of pJW002 from the chromosome and then plated on HS-NMS supplemented with 5% (wt/vol) sucrose to select for the loss of the sacB gene. MEALZ_1626 deletion mutants were identified by screening sucrose-resistant colonies by PCR with primers internal to the MEALZ_1626 and flanking the boundaries of the construct (Table S3). The same selection/counterselection method described above was used to delete Rpal_0860 in R. palustris TIE-1 as described in ref. 28 using plasmid pVW135 (Table S3).

Heterologous Expression.

M. capsulatus Bath strains harboring pSRKGm or pSRKGm-ths (pABB238) were cultured in 50 mL NMS supplemented with gentamicin, and expression was induced at midexponential phase with 100 µM IPTG for 16 h. B. phytofirmans PsJN strains harboring pSRK-lacUV5 (pABB251) or pSRK-lacUV5-ths (pABB261) were cultured on 0.2X TSB plates supplemented with gentamicin and 100 µM IPTG for 48 h after which colonies were harvested from two plates for lipid extraction. E. coli DH10B strains harboring three plasmids, pTrc99a, pTrc-sqs (pABB303), or pTrc-sqs-shc (pABB305); pSRK-lacUV5 (pABB251) or pSRK-lacUV5-ths (pABB261); and pJBEI2997 (Addgene plasmid 35151) (41), were cultured in 5 mL TB supplemented with chloramphenicol, carbenicillan, and gentamicin until midexponential phase. Expression was induced with 500 µM IPTG for 69 h.

Lipid Analysis.

Cultures were harvested by centrifugation at 4,500 × g at 4 °C for 10 min (50 mL of methanotrophs, 20 mL of R. palustris, 40 mL of D. inopinatus, or 5 mL of E. coli), and cell pellets were stored at −20 °C before lipid extraction. Cells were resuspended in 2 mL of deionized water and transferred to a solvent washed Teflon centrifuge tube. Five milliliters of methanol and 2.5 mL of dichloromethane were added, and the cell mixture was sonicated for 1 h. Ten milliliters of deionized water and 10 mL of dichloromethane were added to samples after sonication, mixed, and incubated at −20 °C overnight. Samples were centrifuged for 10 min at 2,800 × g, and the organic layer was transferred to a 40-mL baked glass vial. The total lipid extract was evaporated under N2 and derivatized to acetate esters by incubating in 100 μL of 1:1 acetic anhydride:pyridine for 1 h at 70 °C. Samples were dried under N2 after derivatization and resuspended in 100–200 μL of dichloromethane before analysis.

C-30 hopanoids, methylsterols, and tetrahymanol were analyzed via high-temperature gas chromatography-mass spectrometry (GC-MS) (52). Tetrahymanol was quantified by comparison with a cholestanol standard added to samples before derivatization and was normalized to the largest hopene peak detected in the sample. Lipid extracts were separated on an Agilent 7890B Series GC with helium as the carrier gas at a constant flow of 1.2 mL/min and programmed as follows: 100 °C for 2 min, ramp 15 °C/min to 320 °C, and hold 28 min. The first analysis of M. alcaliphilum extracts was done on a DB5-HT column (30 m × 0.25 mm i.d. × 0.1 μm film thickness) (Fig. S1). All subsequent analyses of M. alcaliphilum and other bacterial extracts were done on a DB17-HT column (30 m × 0.25 mm i.d. × 0.125 μm film thickness) to allow for better separation of the desmethyl and 2-methylhopanoids in R. palustris extracts. Two microliters of the sample were injected into a Gerstel-programmable temperature vaporization (PTV) injector, operated in splitless mode at 320 °C. The GC was coupled to a 5977A Series MSD with the source at 230 °C and operated at 70 eV in EI mode scanning from 50 to 850 Da in 0.5 s. Aminohopanoids were detected via liquid chromatography-mass spectrometry at the Vincent Coates Foundation Mass Spectrometry Laboratory, Stanford University (mass-spec.stanford.edu). All lipids were identified based on their retention time and comparison with previously published spectra (33, 52, 53).

Bioinformatics Analysis.

The JGI Integrated Microbial Genomes (IMG) phylogenetic profiler (img.jgi.doe.gov) was used to identify M. alcaliphilum 20Z proteins with homologs found in the genomes of R. palustris TIE-1 and B. japonicum USDA110 but not found in M. capsulatus Bath, Gluconacetobacter diazotrophicus Pal5, Methylosarcina lacus, Methylomonas methanica, or Burkholderia phytofirmans PsJN. Tetrahymanol synthase homologs were detected in the IMG genomic and metagenomics databases by BLASTP (54). Geneious (Biomatters Limited) was used to align protein sequences from genomes via MUSCLE (55). Metagenomic Ths protein sequences were aligned to genomic Ths sequences via MAFFT (www.ebi.ac.uk/Tools/msa/mafft/) (56), and redundancy in the alignments was reduced through the Decrease Redundancy Program (web.expasy.org/decrease_redundancy/). Sequence similarities from MUSCLE-aligned sequences were rendered using ESPript 3.0 (espript.ibcp.fr/ESPript/ESPript/) (57). Large gaps from metagenomics sequence alignments were removed via GBLOCKS (molevol.cmima.csic.es/castresana/Gblocks_server.html) (58). Maximum likelihood trees were constructed by PhyML (59) using the LG+gamma model, four gamma rate categories, 10 random starting trees, NNI branch swapping, and substitution parameters estimated from the data. Ths trees were generated and edited by importing the resulting PhyML trees into iTOL (itol.embl.de/) (60).

General Molecular Biology Techniques

All plasmids and oligonucleotides used in this study are described in Table S3. Oligonucleotides were purchased from Integrated DNA Technologies. Genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen). PCR was performed according to the manufacturer’s protocol using Taq DNA polymerase, Phusion high-fidelity DNA Polymerase [New England Biolabs (NEB)] or KOD DNA polymerase (EMD Millipore). The GeneJET Plasmid Miniprep Kit (Thermo Scientific) was used for isolation of plasmid DNA from E. coli. The GeneJET gel extraction and PCR purification kits were used for purification of DNA fragments during cloning procedures. DNA sequences were confirmed by sequencing at ELIM Biopharm (Hayward, CA).

Plasmid Cloning and Mutagenesis

Plasmids were constructed by digestion of PCR products and vectors with restriction enzymes (NEB) followed by purification and ligation with T4 DNA ligase (NEB) or by sequence and ligation-independent cloning (SLIC), adapted from ref. 61. Briefly, complementary overhangs were created on gel-purified PCR product inserts and a restriction enzyme-linearized vector by incubation with T4 DNA polymerase (EMD Millipore) in the absence of nucleotides followed by annealing and transformation without ligation. Site-directed mutagenesis of plasmids was performed by DNA synthesis with 2.5 U PfuUltra II Fusion HS DNA Polymerase (Stratagene), one oligonucleotide (0.2 μM) encoding the desired change, 0.2 mM dNTPs, and 50 ng plasmid DNA in a 25-μL reaction with a 1 min/kb extension time at 68 °C, followed by DpnI digestion and transformation by electroporation.

Construction of Strains Harboring Plasmids

E. coli strains were transformed by electroporation using a MicroPulser Electroporator (BioRad) as recommended by the supplier. Plasmids were transferred into M. capsulatus Bath, B. phytofirmans PsJN, and R. palustris TIE-1 via conjugation using the DAP auxotroph BW29427 (51).

Complementation

R. palustris TIE-1 Δths strains harboring pSRK-Gm or pSRK-Gm-Rpal_0860 (pABB239) were cultured in 20 mL of YPS-MOPS supplemented with gentamicin until midexponential phase. Cells were induced with 100 μM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 12 h before lipid extraction. A M. alcaliphilum 20Z Δths strain expressing ths (MEALZ_1626) under the control of PlacUV5 from a chromosomal location adjacent to MEALZ_2523 and both a M. alcaliphilum 20Z Δths strain and a M. alcaliphilum 20Z WT with a negative control expression cassette adjacent to MEALZ_2523 were cultured in 50 mL of NMS until midexponential phase. Cells were induced with 100 μM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 24 h before lipid extraction.

Growth Curves

Thirty-milliliter starter cultures of M. alcaliphilum were grown for 2 d at 30 °C in HS-NMS and used to inoculate 50 mL of HS-NMS in a 250-mL serum bottle (2% inoculum, in quadruplicate). Growth at 30 °C for 5 d was monitored by measuring the absorbance at 600 nm of a 200-μL aliquot in a Synergy 2 Microplate Reader (BioTek).

Acknowledgments

We thank Prof. T. Bosak and Dr. S. Zaarur for kindly providing us with cultures of Desulfovibrio inopinatus for lipid analysis and Profs. W. Metcalf, W. van der Donk, and C. D. Poulter for helpful discussions regarding isoprenoid biochemistry. We also thank Prof. A. Sessions, members of the P.V.W. Laboratory, and two anonymous reviewers for constructive comments on the manuscript and Dr. P. B. Welander for assistance with figure design. This work was supported by a grant from the National Science Foundation (EAR -1418831 to P.V.W.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1511482112/-/DCSupplemental.

References

  • 1.Castoreno AB, et al. Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Proc Natl Acad Sci USA. 2005;102(37):13129–13134. doi: 10.1073/pnas.0506716102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nes WD, Janssen GG, Crumley FG, Kalinowska M, Akihisa T. The structural requirements of sterols for membrane function in Saccharomyces cerevisiae. Arch Biochem Biophys. 1993;300(2):724–733. doi: 10.1006/abbi.1993.1100. [DOI] [PubMed] [Google Scholar]
  • 3.Parks LW, Casey WM. Physiological implications of sterol biosynthesis in yeast. Annu Rev Microbiol. 1995;49:95–116. doi: 10.1146/annurev.mi.49.100195.000523. [DOI] [PubMed] [Google Scholar]
  • 4.Hieb WF, Rothstein M. Sterol requirement for reproduction of a free-living nematode. Science. 1968;160(3829):778–780. doi: 10.1126/science.160.3829.778. [DOI] [PubMed] [Google Scholar]
  • 5.Tomazic ML, Poklepovich TJ, Nudel CB, Nusblat AD. Incomplete sterols and hopanoids pathways in ciliates: Gene loss and acquisition during evolution as a source of biosynthetic genes. Mol Phylogenet Evol. 2014;74:122–134. doi: 10.1016/j.ympev.2014.01.026. [DOI] [PubMed] [Google Scholar]
  • 6.Conner RL, Landrey JR, Burns CH, Mallory FB. Cholesterol inhibition of pentacyclic triterpenoid biosynthesis in Tetrahymena pyriformis. J Protozool. 1968;15(3):600–605. doi: 10.1111/j.1550-7408.1968.tb02178.x. [DOI] [PubMed] [Google Scholar]
  • 7.Raederstorff D, Rohmer M. Polyterpenoids as cholesterol and tetrahymanol surrogates in the ciliate Tetrahymena pyriformis. Biochim Biophys Acta. 1988;960(2):190–199. doi: 10.1016/0005-2760(88)90064-1. [DOI] [PubMed] [Google Scholar]
  • 8.Mallory FB, Conner RL, Gordon JT. Isolation of a pentacyclic triterpenoid alcohol from a protozoan. J Am Chem Soc. 1963;85(9):1362–1363. [Google Scholar]
  • 9.Kemp P, Lander DJ, Orpin CG. The lipids of the rumen fungus Piromonas communis. J Gen Microbiol. 1984;130(1):27–37. doi: 10.1099/00221287-130-1-27. [DOI] [PubMed] [Google Scholar]
  • 10.Takishita K, et al. Lateral transfer of tetrahymanol-synthesizing genes has allowed multiple diverse eukaryote lineages to independently adapt to environments without oxygen. Biol Direct. 2012;7:5. doi: 10.1186/1745-6150-7-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zander JM, Caspi E, Pandey GN, Mitra CR. Presence of tetrahymanol in Oleandra wallichii. Phytochemistry. 1969;8(11):2265–2267. [Google Scholar]
  • 12.Ten Haven HL, Rohmer M, Rullkotter J, Bisseret P. Tetrahymanol, the most likely precursor of gammacerane, occurs ubiquitously in marine sediments. Geochim Cosmochim Acta. 1989;53(11):3073–3079. [Google Scholar]
  • 13.Venkatesan MI. Tetrahymanol—Its widespread occurrence and geochemical significance. Geochim Cosmochim Acta. 1989;53(11):3095–3101. [Google Scholar]
  • 14.Cao CQ, et al. Biogeochemical evidence for euxinic oceans and ecological disturbance presaging the end-Permian mass extinction event. Earth Planet Sci Lett. 2009;281(3-4):188–201. [Google Scholar]
  • 15.Sepulveda J, et al. Molecular isotopic evidence of environmental and ecological changes across the Cenomanian-Turonian boundary in the Levant Platform of central Jordan. Org Geochem. 2009;40(5):553–568. [Google Scholar]
  • 16.Summons RE, et al. Distinctive hydrocarbon biomarkers from fossiliferous sediment of the Late Proterozoic Walcott Member, Chuar Group, Grand Canyon, Arizona. Geochim Cosmochim Acta. 1988;52(11):2625–2637. [Google Scholar]
  • 17.Sinninghe Damste JS, et al. Evidence for gammacerane as an indicator of water column stratification. Geochim Cosmochim Acta. 1995;59(9):1895–1900. doi: 10.1016/0016-7037(95)00073-9. [DOI] [PubMed] [Google Scholar]
  • 18.Peters KE, Waters CC, Moldowan JM. 2007. Biomarkers and Isotopes in Petroleum Exploration and Earth History, The Biomarker Guide (Cambridge Univ Press, Cambridge, UK), Vol 2.
  • 19.Kannenberg EL, Perzl M, Hartner T. The occurrence of hopanoid lipids in Bradyrhizobium bacteria. FEMS Microbiol Lett. 1995;127(3):255–261. [Google Scholar]
  • 20.Kleemann G, et al. Tetrahymanol from the phototrophic bacterium Rhodopseudomonas palustris: First report of a gammacerane triterpene from a prokaryote. J Gen Microbiol. 1990;136(12):2551–2553. [Google Scholar]
  • 21.Bravo JM, Perzl M, Härtner T, Kannenberg EL, Rohmer M. Novel methylated triterpenoids of the gammacerane series from the nitrogen-fixing bacterium Bradyrhizobium japonicum USDA 110. Eur J Biochem. 2001;268(5):1323–1331. doi: 10.1046/j.1432-1327.2001.01998.x. [DOI] [PubMed] [Google Scholar]
  • 22.Eickhoff M, Birgel D, Talbot HM, Peckmann J, Kappler A. Oxidation of Fe(II) leads to increased C-2 methylation of pentacyclic triterpenoids in the anoxygenic phototrophic bacterium Rhodopseudomonas palustris strain TIE-1. Geobiology. 2013;11(3):268–278. doi: 10.1111/gbi.12033. [DOI] [PubMed] [Google Scholar]
  • 23.Neubauer C, et al. Lipid remodeling in Rhodopseudomonas palustris TIE-1 upon loss of hopanoids and hopanoid methylation. Geobiology. 2015;13(5):443–453. doi: 10.1111/gbi.12143. [DOI] [PubMed] [Google Scholar]
  • 24.Saar J, Kader JC, Poralla K, Ourisson G. Purification and some properties of the squalene-tetrahymanol cyclase from Tetrahymena thermophila. Biochim Biophys Acta. 1991;1075(1):93–101. doi: 10.1016/0304-4165(91)90080-z. [DOI] [PubMed] [Google Scholar]
  • 25.Fischer WW, Pearson A. Hypotheses for the origin and early evolution of triterpenoid cyclases. Geobiology. 2007;5(1):19–34. doi: 10.1111/j.1472-4669.2007.00096.x. [DOI] [PubMed] [Google Scholar]
  • 26.Siedenburg G, Jendrossek D. Squalene-hopene cyclases. Appl Environ Microbiol. 2011;77(12):3905–3915. doi: 10.1128/AEM.00300-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Silipo A, et al. Covalently linked hopanoid-lipid A improves outer-membrane resistance of a Bradyrhizobium symbiont of legumes. Nat Commun. 2014;5:5106. doi: 10.1038/ncomms6106. [DOI] [PubMed] [Google Scholar]
  • 28.Welander PV, et al. Hopanoids play a role in membrane integrity and pH homeostasis in Rhodopseudomonas palustris TIE-1. J Bacteriol. 2009;191(19):6145–6156. doi: 10.1128/JB.00460-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Perzl M, Müller P, Poralla K, Kannenberg EL. Squalene-hopene cyclase from Bradyrhizobium japonicum: Cloning, expression, sequence analysis and comparison to other triterpenoid cyclases. Microbiology. 1997;143(Pt 4):1235–1242. doi: 10.1099/00221287-143-4-1235. [DOI] [PubMed] [Google Scholar]
  • 30.Kleemann G, Kellner R, Poralla K. Purification and properties of the squalene-hopene cyclase from Rhodopseudomonas palustris, a purple non-sulfur bacterium producing hopanoids and tetrahymanol. Biochim Biophys Acta. 1994;1210(3):317–320. doi: 10.1016/0005-2760(94)90235-6. [DOI] [PubMed] [Google Scholar]
  • 31.Khmelenina VN, Kalyuzhnaya MG, Starostina NG, Suzina NE, Trotsenko YA. Isolation and characterization of halotolerant alkaliphilic methanotrophic bacteria from Tuva Soda Lakes. Curr Microbiol. 1997;35(5):257–261. [Google Scholar]
  • 32.Vuilleumier S, et al. Genome sequence of the haloalkaliphilic methanotrophic bacterium Methylomicrobium alcaliphilum 20Z. J Bacteriol. 2012;194(2):551–552. doi: 10.1128/JB.06392-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Talbot HM, Watson DF, Murrell JC, Carter JF, Farrimond P. Analysis of intact bacteriohopanepolyols from methanotrophic bacteria by reversed-phase high-performance liquid chromatography-atmospheric pressure chemical ionisation mass spectrometry. J Chromatogr A. 2001;921(2):175–185. doi: 10.1016/s0021-9673(01)00871-8. [DOI] [PubMed] [Google Scholar]
  • 34.Volkman JK. Sterols in microorganisms. Appl Microbiol Biotechnol. 2003;60(5):495–506. doi: 10.1007/s00253-002-1172-8. [DOI] [PubMed] [Google Scholar]
  • 35.Blumenberg M, et al. Biosynthesis of hopanoids by sulfate-reducing bacteria (genus Desulfovibrio) Environ Microbiol. 2006;8(7):1220–1227. doi: 10.1111/j.1462-2920.2006.01014.x. [DOI] [PubMed] [Google Scholar]
  • 36.Neunlist S, Rohmer M. Novel hopanoids from the methylotrophic bacteria Methylococcus capsulatus and Methylomonas methanica. (22S)-35-aminobacteriohopane-30,31,32,33,34-pentol and (22S)-35-amino-3 beta-methylbacteriohopane-30,31,32,33,34-pentol. Biochem J. 1985;231(3):635–639. doi: 10.1042/bj2310635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Cvejic JH, et al. Bacterial triterpenoids of the hopane series as biomarkers for the chemotaxonomy of Burkholderia, Pseudomonas and Ralstonia spp. FEMS Microbiol Lett. 2000;183(2):295–299. doi: 10.1111/j.1574-6968.2000.tb08974.x. [DOI] [PubMed] [Google Scholar]
  • 38.Schmerk CL, et al. Elucidation of the Burkholderia cenocepacia hopanoid biosynthesis pathway uncovers functions for conserved proteins in hopanoid-producing bacteria. Environ Microbiol. 2015;17(3):735–750. doi: 10.1111/1462-2920.12509. [DOI] [PubMed] [Google Scholar]
  • 39.Hoshino T, Kondo T. The cyclization mechanism of squalene in hopene biosynthesis: The terminal methyl groups are critical to the correct folding of this substrate both for the formation of the five-membered E-ring and for the initiation of the polycyclization reaction. Chem Commun. 1999;8:731–732. [Google Scholar]
  • 40.Katabami A, et al. Production of squalene by squalene synthases and their truncated mutants in Escherichia coli. J Biosci Bioeng. 2015;119(2):165–171. doi: 10.1016/j.jbiosc.2014.07.013. [DOI] [PubMed] [Google Scholar]
  • 41.Peralta-Yahya PP, et al. Identification and microbial production of a terpene-based advanced biofuel. Nat Commun. 2011;2:483. doi: 10.1038/ncomms1494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Harvey HR, Mcmanus GB. Marine ciliates as a widespread source of tetrahymanol and hopan-3-β-ol in sediments. Geochim Cosmochim Acta. 1991;55(11):3387–3390. [Google Scholar]
  • 43.Chistoserdova L. Methylotrophs in natural habitats: Current insights through metagenomics. Appl Microbiol Biotechnol. 2015;99(14):5763–5779. doi: 10.1007/s00253-015-6713-z. [DOI] [PubMed] [Google Scholar]
  • 44.Foti M, et al. Diversity, activity, and abundance of sulfate-reducing bacteria in saline and hypersaline soda lakes. Appl Environ Microbiol. 2007;73(7):2093–2100. doi: 10.1128/AEM.02622-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Karr EA, et al. Diversity and distribution of sulfate-reducing bacteria in permanently frozen Lake Fryxell, McMurdo Dry Valleys, Antarctica. Appl Environ Microbiol. 2005;71(10):6353–6359. doi: 10.1128/AEM.71.10.6353-6359.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Oswald K, et al. Light-dependent aerobic methane oxidation reduces methane emissions from seasonally stratified lakes. PLoS One. 2015;10(7):e0132574. doi: 10.1371/journal.pone.0132574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wakeham SG, et al. Microbial ecology of the stratified water column of the Black Sea as revealed by a comprehensive biomarker study. Org Geochem. 2007;38(12):2070–2097. [Google Scholar]
  • 48.Muyzer G, Stams AJ. The ecology and biotechnology of sulphate-reducing bacteria. Nat Rev Microbiol. 2008;6(6):441–454. doi: 10.1038/nrmicro1892. [DOI] [PubMed] [Google Scholar]
  • 49.Whittenbury R, Phillips KC, Wilkinson JF. Enrichment, isolation and some properties of methane-utilizing bacteria. J Gen Microbiol. 1970;61(2):205–218. doi: 10.1099/00221287-61-2-205. [DOI] [PubMed] [Google Scholar]
  • 50.Ojala DS, Beck DA, Kalyuzhnaya MG. Genetic systems for moderately halo(alkali)philic bacteria of the genus Methylomicrobium. Methods Enzymol. 2011;495:99–118. doi: 10.1016/B978-0-12-386905-0.00007-3. [DOI] [PubMed] [Google Scholar]
  • 51.Welander PV, Summons RE. Discovery, taxonomic distribution, and phenotypic characterization of a gene required for 3-methylhopanoid production. Proc Natl Acad Sci USA. 2012;109(32):12905–12910. doi: 10.1073/pnas.1208255109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sessions AL, et al. Identification and quantification of polyfunctionalized hopanoids by high temperature gas chromatography-mass spectrometry. Org Geochem. 2013;56:120–130. doi: 10.1016/j.orggeochem.2012.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Talbot HM, Squier AH, Keely BJ, Farrimond P. Atmospheric pressure chemical ionisation reversed-phase liquid chromatography/ion trap mass spectrometry of intact bacteriohopanepolyols. Rapid Commun Mass Spectrom. 2003;17(7):728–737. doi: 10.1002/rcm.974. [DOI] [PubMed] [Google Scholar]
  • 54.Altschul SF, et al. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25(17):3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Edgar RC. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol Biol Evol. 2013;30(4):772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Gouet P, Robert X, Courcelle E. ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 2003;31(13):3320–3323. doi: 10.1093/nar/gkg556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000;17(4):540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [DOI] [PubMed] [Google Scholar]
  • 59.Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003;52(5):696–704. doi: 10.1080/10635150390235520. [DOI] [PubMed] [Google Scholar]
  • 60.Letunic I, Bork P. Interactive Tree Of Life (iTOL): An online tool for phylogenetic tree display and annotation. Bioinformatics. 2007;23(1):127–128. doi: 10.1093/bioinformatics/btl529. [DOI] [PubMed] [Google Scholar]
  • 61.Li MZ, Elledge SJ. SLIC: A method for sequence- and ligation-independent cloning. Methods Mol Biol. 2012;852:51–59. doi: 10.1007/978-1-61779-564-0_5. [DOI] [PubMed] [Google Scholar]
  • 62.Quandt J, Hynes MF. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene. 1993;127(1):15–21. doi: 10.1016/0378-1119(93)90611-6. [DOI] [PubMed] [Google Scholar]
  • 63.Khan SR, Gaines J, Roop RM, 2nd, Farrand SK. Broad-host-range expression vectors with tightly regulated promoters and their use to examine the influence of TraR and TraM expression on Ti plasmid quorum sensing. Appl Environ Microbiol. 2008;74(16):5053–5062. doi: 10.1128/AEM.01098-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Amann E, Ochs B, Abel KJ. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene. 1988;69(2):301–315. doi: 10.1016/0378-1119(88)90440-4. [DOI] [PubMed] [Google Scholar]
  • 65.Marx CJ, Lidstrom ME. Broad-host-range cre-lox system for antibiotic marker recycling in gram-negative bacteria. Biotechniques. 2002;33(5):1062–1067. doi: 10.2144/02335rr01. [DOI] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES