Skip to main content
SpringerPlus logoLink to SpringerPlus
. 2015 Nov 10;4:684. doi: 10.1186/s40064-015-1457-x

Development of a multiplex real-time PCR assay for detection of Mycoplasma pneumoniae, Chlamydiapneumoniae and mutations associated with macrolide resistance in Mycoplasma pneumoniae from respiratory clinical specimens

Maaret Nummi 1, Laura Mannonen 1,, Mirja Puolakkainen 1
PMCID: PMC4641141  PMID: 26576327

Abstract

The aim of this study was to improve detection of Mycoplasma pneumoniae and Chlamydia pneumoniae in clinical specimens by developing a multiplex real-time PCR assay that includes identification of macrolide-resistant M. pneumoniae. Novel assays targeting a M. pneumoniae conserved hypothetical protein gene, M. pneumoniae 23S rRNA gene mutations associated with macrolide resistance and human β-globin gene (an endogenous internal control) were designed and combined with a previously published C. pneumoniae PCR targeting ompA gene. The resulting quadraplex PCR was validated with a panel of clinical specimens supplemented with external quality assessment specimens, simulated specimens and various bacterial and viral strains. The obtained results were compared to those obtained by reference PCRs or confirmed by sequencing (typing of macrolide resistance). The novel multiplex PCR assay was in 100 % agreement with reference PCRs. Four M. pneumoniae strains with macrolide resistance-associated mutations were identified among 42 strains, which comprises 9.5 % of the study material. Amplification of an internal control excluded sample-derived inhibition possibly leading to false-negative reporting. In conclusion, we have developed a resources conserving multiplex real-time PCR assay for simultaneous detection of M. pneumoniae, C. pneumoniae and the most common mutations leading to macrolide resistance in M. pneumoniae. The assay is a widely useful tool for detection of these respiratory pathogens and will also shed light on the occurrence of macrolide resistance in M. pneumoniae.

Electronic supplementary material

The online version of this article (doi:10.1186/s40064-015-1457-x) contains supplementary material, which is available to authorized users.

Keywords: Multiplex real-time PCR, Mycoplasma pneumoniae, Macrolide resistance, Chlamydia pneumoniae

Background

Mycoplasma pneumoniae and Chlamydia pneumoniae are common respiratory pathogens causing approximately 10–30 % and 5–10 %, respectively, of community acquired pneumonias (Atkinson et al. 2008; Kuo et al. 1995). M. pneumoniae infections can also present with extrapulmonary symptoms, including mucocutaneous and central nervous system manifestations (Atkinson et al. 2008), and the clinical spectrum of C. pneumoniae infection includes reactive arthritis, worsening of asthma and cardiovascular disease (Orrskog et al. 2013).

Mycoplasma pneumoniae infection can occur in all age groups, but the severity of the disease tends to increase with the age of the patient. For immunocompromised patients, M. pneumoniae infection can lead to a severe pneumonia (Waites and Talkington 2004). C. pneumoniae IgG antibody prevalence bounces between 5 and 15 years of age and then increases steadily suggesting that most primary infections take place in school-age children and repeated infections occur later in life. Antimicrobial therapy is available for M. pneumoniae and C. pneumoniae infection. In case antimicrobial treatment is indicated, specific and rapid laboratory diagnosis is important as the diagnosis cannot be based on clinical symptoms only. M. pneumoniae pneumonias are often treated with macrolides but also tetracyclines and fluoroquinolones are effective (Waites and Talkington 2004). Macrolides are often used for treatment due to their safety especially for children and pregnant women. However, in the last few years macrolide-resistant M. pneumoniae strains have emerged, with high rates in China and Japan, and lower rates in Europe and Canada (Principi and Esposito 2013). Resistance to macrolides is caused by point mutations in the bacterial 23S rRNA gene which reduces the affinity of the antibiotic for the ribosomes (Wolff et al. 2008). The most common point mutations leading to the resistance are located in the 23S rRNA gene at positions 2063 and 2064, and include transition A to G or C (Waites and Talkington 2004; Lucier et al. 1995).

In recent years, nucleic acid-based assays targeting M. pneumoniae and C. pneumoniae have been developed (Dumke and Jacobs 2009, 2014; Winchell et al. 2008). PCR-based methods have high sensitivity, short turnaround time and the testing can be completed in a single working day. Moreover, simultaneous amplification of more than one target in the same reaction (multiplex PCR) is becoming a rapid, economical and convenient means in a diagnostic laboratory to detect multiple pathogens causing similar symptoms and their genetic properties at the same. A variety of multiplex PCRs have been developed for detection of M. pneumoniae and C. pneumoniae (Thurman et al. 2011; Welti et al. 2003; Gullsby et al. 2008; Miyashita et al. 2004; McDonough et al. 2005). However, also molecular diagnosis has limitations since the mere presence of nucleic acid can denote either acute infection, persistence of nucleic acid after infection or asymptomatic carriage.

The aim of this study was to improve detection of M. pneumoniae and C. pneumoniae in clinical specimens by developing a time-saving and inexpensive multiplex real-time PCR assay for detection of C. pneumoniae, M. pneumoniae and the most common mutations in the M. pneumoniae 23S rRNA gene leading to resistance for macrolide antibiotics. To our knowledge, this is the first report of a multiplex real-time PCR assay that in addition to the detection of M. pneumoniae, C. pneumoniae and internal control includes detection of macrolide resistance-associated mutations in M. pneumoniae.

Results

Sensitivity of co-amplification

To assess the sensitivity of co-amplification of C. pneumoniae, M. pneumoniae and human beta-globin by multiplex real-time PCR, a range of concentrations of M. pneumoniae M129 and C. pneumoniae K-6 DNA were co-amplified. In addition, low concentrations of M. pneumoniae and C. pneumoniae were amplified in presence of high concentration of human DNA. Crossing threshold (Ct) values remained unchanged for the DNA that was in a lower concentration even when a high concentration of DNA from another organism was co-amplified (data not shown).

Internal control (IC) human beta-globin

The human β-globin was co-amplified in the multiplex reaction as IC. Neither sample matrix-derived inhibition in the PCR reaction, nor specimen processing errors potentially leading to false negative reporting were observed in this study. The Ct values in nose and/or throat swabs (n = 72) varied between 18.9 and 28.1 (mean 23.2, median 23) and for BALs (n = 13) the Ct range was 21.6–29.6 (mean 25.3, median 26).

Analytical sensitivity

The analytical sensitivity, the limit of detection (LOD) with 95 % probability, was determined for M. pneumoniae and C. pneumoniae components of the multiplex real-time PCR using Probit analysis of the Validation Manager software (Finbiosoft, Espoo, Finland). The analytical sensitivity for M. pneumoniae was 2.9 copies/PCR-reaction and for C. pneumoniae (K-6) the LOD was 0.13 IFU/PCR reaction. To confirm that the C. pneumoniae primers and probe are able to detect different strains, DNA from nine available C. pneumoniae isolates were tested: The strains isolated in Finland K6, K8, K66, FIL, HELS-12, MS and Parola, CV6 from Germany (a kind gift from Prof. M Maass), and TW-183 (ATCC VR-2282) and CWL-029 (ATCC VR-1310). The multiplex PCR detected these strains.

Analytical specificity

The specificity of the primers and probes was evaluated using BLAST analysis, and analyzing nucleic acid from various bacterial and viral strains in the multiplex real-time PCR (Additional file 1, Table S1). In silico and in vitro analyses revealed that the M. pneumoniae primers and probe designed for detection of the most common resistance-associated mutations could also amplify DNA from Mycoplasma genitalium.

Diagnostic performance of the multiplex PCR

To evaluate the reliability of the developed real-time multiplex PCR for clinical testing the performance of the assay was compared to those of the reference PCR assays. A total of 42 M. pneumoniae positive specimens and 24 M. pneumoniae simulated BALs were studied with the multiplex assay. The multiplex real-time PCR detected all simulated BALs correctly and the assay was in 100 % agreement with the reference PCRs (Table 1).

Table 1.

Comparison of the results from multiplex real-time PCR and reference PCRs for detection of (a) M. pneumoniae (MP) and (b) C. pneumoniae (CP) in clinical respiratory specimens

M. pneumoniae (MP) Reference PCRs Total
MP pos MP neg
Multiplex PCR  MP pos 42 0 42
 MP neg 0 43 43
 Total 42 43 85
C. pneumoniae (CP) CP pos CP neg Total
Multiplex PCR  CP pos 28 0 28
 CP neg 0 43 43
 Total 28 43 71

The macrolide resistance-associated mutations in M. pneumoniae strains were identified by dissociation curve analysis of the amplicon. The analysis distinguishes mutations in 23S rRNA sequence at positions 2063G/C or 2064G/C. The melting temperature of the wild type is 64–65 °C, for the mutation C 60–61 °C and for the mutation G 57.5–58.5 °C (Fig. 1). The dissociation curve analysis does not differentiate whether the mutation is in the base 2063 or 2064. In our study material, 9.5 % (4/42) of the M. pneumoniae positive specimens contained a M. pneumoniae strain with macrolide resistance-associated mutation. The PCR results were confirmed by sequence analysis. Two BALs and two sputum specimens contained M. pneumoniae with a mutation associated with macrolide resistance. Three M. pneumoniae strains had a point mutation at 2063 A->G and one sputum specimen contained both wild type DNA and DNA with a point mutation at 2064 A->G.

Fig. 1.

Fig. 1

Melting curve displaying a patient sample containing DNA from M. pneumoniae with macrolide resistance-associated mutation (MR–MP). The melting profile of a patient sample was compared to the melting profiles of 3 controls: (1) Plasmid control 2063C which contains M. pneumoniae 23S rRNA PCR target sequence with base C at the position 2063 (DNA amplicon with base C at the position 2064 displays similar melting profile, data not shown). (2) Plasmid control 2063G which contains M. pneumoniae 23S rRNA target sequence with base G at the position 2063 (DNA amplicon with base G at position the 2064 displays similar melting profile, data not shown). (3) Wt (wild type) M. pneumoniae DNA

The C. pneumoniae component in the multiplex PCR uses same oligonucleotides as the previously validated reference PCR and hence the performance of the C. pneumoniae component was verified with a smaller amount of specimens. The clinical sensitivity was verified by testing 28 C. pneumoniae positive or simulated positive upper and lower respiratory tract specimens. In addition, a total of 43 C. pneumoniae negative respiratory tract specimens were assessed. The multiplex PCR assay was in 100 % agreement with the reference method (Table 1).

External quality assessment panel

EQA panel C. pneumoniae and M. pneumoniae 2014 (QCMD, Glasgow, Scotland, UK) was analyzed with the multiplex real-time PCR assay. The multiplex PCR identified all core proficiency samples correctly. Only two educational, infrequently detected M.pneumoniae positive specimens were not detected by the multiplex PCR (CP.MP14-03 and CP.MP14-12) and one educational infrequently detected C. pneumoniae positive specimen CP.MP14-06 gave a negative result (Table 2).

Table 2.

The results of QCMD 2014 proficiency panel for C. pneumoniae and M. pneumoniae using the developed multiplex PCR method

Sample Matrix Sample content Result with the multiplex-PCR Sample status/percentage of laboratories that reported positive result for the pathogen in question Sample type
CP.MP14-01 BAL C. pneumoniae C. pneumoniae Frequently detected/96.2 % Core
CP.MP14-02 TM M. pneumoniae M. pneumoniae Detected/73.9 % Educational
CP.MP14-03 TM M. pneumoniae Negative Infrequently detected/20.6 % Educational
CP.MP14-04 TM Negative Negative Negative Core
CP.MP14-05 TM C. pneumoniae C. pneumoniae Frequently detected/98.4 % Core
CP.MP14-06 TM C. pneumoniae Negative Infrequently detected/58 % Educational
CP.MP14-07 BAL Negative Negative Negative Core
CP.MP14-08 BAL M. pneumoniae M. pneumoniae Detected/78.4 % Educational
CP.MP14-09 TM C. pneumoniae C. pneumoniae Detected/82.5 % Educational
CP.MP14-10 BAL C. pneumoniae C. pneumoniae Frequently detected/98.4 % Core
CP.MP14-11 TM M. pneumoniae M. pneumoniae Detected/94.5 % Core
CP.MP14-12 BAL M. pneumoniae Negative Infrequently detected/43.7 % Educational

BAL Bronchoalveolar lavage, TM transport medium, Core sample type that all participants are expected to detect correctly, Educational sample type that is designed to provide educational information to participants

Discussion

Mycoplasma pneumoniae and C. pneumoniae cause atypical pneumonia and have clinically similar respiratory manifestations. Hence it is logical to detect them simultaneously. To improve laboratory diagnosis and to reduce the cost and time for detecting M. pneumoniae and C. pneumoniae, we designed and validated a multiplex real-time PCR that can also detect the most common mutations in the 23S rRNA gene of M. pneumoniae leading to macrolide resistance in a single reaction. Human beta-globin gene was included as an internal control to allow assessment of the specimen quality and the nucleic acid extraction as well as the amplification processes. No inhibition or specimen processing errors were identified in this study. The variation of the detected IC Ct values for swab specimens and BAL specimens follows normal distribution (mean and median are almost identical) and is therefore more likely to reflect variation in the sampling procedure.

All specimens were analysed both in singleplex and in multiplex reactions. Multiplex PCR may lack sensitivity when compared to singleplex PCR (Mannonen et al. 2012), but here the carefully optimized multiplex PCR had identical sensitivity in comparison to the singleplex PCR (data not shown). The obtained LOD 2.9 cp/reaction for M. pneumoniae can be considered functional and is comparable to those reported by others (Dumke and Jacobs 2009, 2014; Welti et al. 2003; Schmitt et al. 2013). For the C. pneumoniae component of the multiplex PCR, the LOD of 0.13 IFU/PCR reaction was obtained. The sensitivities of previously published PCR assays are challenging to compare since no standard preparations for measuring analytical sensitivity are available (Dowell et al. 2001). Until international molecular standards become available, molecular EQA panels may be the best way to estimate sensitivity of a molecular test. Here we analysed a QCMD 2014 proficiency panel for C. pneumoniae and M. pneumoniae with the developed multiplex PCR method. The multiplex PCR method identified all core samples correctly indicating acceptable level of proficiency. In addition, 3/6 educational samples were identified correctly. The remaining three educational samples which tested negative by the multiplex PCR and the reference methods, were infrequently detected by the proficiency panel participants, and only 20.6 and 43.7 % of the laboratories reported positive M. pneumoniae results and 58 % positive C. pneumoniae result for these samples indicating very low level of bacteria in these samples. Overall, the developed multiplex real-time PCR showed good specificity and sensitivity for detecting M. pneumoniae and C. pneumoniae in clinical and simulated specimens. The performance of the multiplex PCR assay was comparable to that of the reference PCRs.

Macrolides are considered the treatment of choice for M. pneumoniae infections. Since 2000, M. pneumoniae strains resistant to macrolides have emerged (Bébéar et al. 2011; Principi and Esposito 2013). Mutations in the 23S rRNA gene can confer resistance to macrolides and the most commonly occurring mutations are A2063G and A2064G. In our study, 9.5 % of M. pneumoniae strains were shown to have either of these mutations. The observed rate is similar to those reported in other European countries and USA (0–26 %), whereas in Japan and China, the occurrence of macrolide resistance is much higher (>90 %) (Bébéar et al. 2011; Principi and Esposito 2013). A2063G is the most commonly detected mutation worldwide (>90 % of all reported point mutations), and this was also the case in our study (three out of four cases had A2063G mutation). In silico and in vitro studies revealed that the primers and the probe for macrolide resistance mutations also detected M. genitalium. The 23S rRNA genes of M. pneumoniae and M. genitalium are closely related (96.7 % identity) and therefore the observed cross-reactivity is not surprising (Dumke et al. 2010). M. genitalium, however, is not frequently detected in respiratory specimens. Moreover, the presence of M. pneumoniae is first identified by specific oligonucleotides and the presence of mutation is evaluated only in M. pneumoniae positive specimens, so the risk of incorrect identification was considered minimal.

As antimicrobial therapy effective against M. pneumoniae and C. pneumoniae infections is available and recommended in lower respiratory tract infections, molecular testing can aid in patient management by providing a microbiological diagnosis and guiding antibiotic selection. Sensitive nucleic acid based detection techniques also contribute to a better understanding of the epidemiology and manifestations of these infections.

Conclusions

We have developed a resources conserving multiplex real-time PCR assay which has been successfully implemented in a clinical diagnostic laboratory for simultaneous detection of M. pneumoniae, C. pneumoniae and the most common mutations leading to macrolide resistance in M. pneumoniae. The assay is a widely useful tool for detection of these respiratory pathogens and will also shed light on the occurrence of macrolide resistance in M. pneumoniae.

Methods

Design of primers and probes

Primer Express software v 3.0 (Applied Biosystems, Foster City, CA) was used to design primers and probes targeting a conserved hypothetical protein C985_0367 of M. pneumoniae (MP) (MP M129-B7) and human β-globin (BG) gene. The C. pneumoniae (CP) primers and probe have previously been described by Mannonen et al. 2004. The primers and probe for detection of macrolide resistance-associated mutations in M. pneumoniae (MR–MP) were designed by TIB MOLBIOL (Berlin, Germany). All primers and probes were tested for specificity by basic local alignment search tool (BLAST). The primer and probe sequences are listed in Table 3.

Table 3.

Primer and probe sequences for amplification of C. pneumoniae, M. pneumoniae, macrolide resistance associated mutations in M. pneumoniae and human beta-globin DNA, as well as the primer sequences used for sequencing of M. pneumoniae 23S rRNA

Primer/probe Sequence 5′->3′ Gene target (reference)
MP Fw ATGTACTATCAGCAAAAGCTCAGTATGG M. pneumoniae Hyppthetical protein C985_0367
(GeneBank accesion no: AGC04275.1)
(this publication)
MP Rev CCACATACCGCTTTAAGTTAGCAA
MP probea Cy5-CTAACCAAAACAGCCCTTCAACGGCA-Iowa black RQ-Sp
CP Fw AAGGGCTATAAAGGCGTTGCT C. pneumoniae ompA
(Mannonen et al. 2004)
CP Rev TGGTCGCAGACTTTGTTCCA
CP probea Tx Red-TCCCCTTGCCAACAGACGCTGG-Iowa black RQ-Sp
BG Fw GGTTGGGATAAGGCTGGATTATT Homo sapiens beta-globin chain
(GeneBank accesion no: AY260740.1)
(this publication)
BG Rev CAGGAGCTGTGGGAGGAAGA
BG probea JOE/ZEN-CAAGCTAGGCCCTTTTGCTAATCATGTTCA-Iowa black FQ
MR–MP Fw GCTATAGACTCGGTGAAATCCAGG M. pneumoniae gene for 23S rRNA (GeneBank accesion no: gi|288509|emb|X68422.1|)
(this publication)
MR–MP Rev GCTACAGTAAAGCTTCACTGGGTC
MR–MP SimpleProbe® GCGCA XI ACGGGACGGAAAGAC
CARDS TX Fw TTTGGTAGCTGGTTACGGGAAT CARDS toxin gene
(Winchell et al. 2008)
CARDS TX Rev GGTCGGCACGAATTTCATATAAG
CARDS TX probea TGTACCAGAGCACCCCAGAAGGGCT
M. pneumoniae Fw diagnostic PCR AAGGACCTGCAAGGGTTCGT 16SrRNA
(van Kuppeveld et al. 1992)
M. pneumoniae Rev diagnostic PCR Biotin-CTCTAGCCATTACCTGCTAA
M. pneumoniae probe diagnostic PCR ACTCCTACGGGAGGCAGCAGTA-digoxigenin
MR Seq Fwb AACTATAACGGTCCTAAGGTAGCG 23srRNA
(Wolff et al. 2008)
MR Seq Revb GCTCCTACCTATTCTCTACATGAT

aDually labelled hydrolysis probe

bSequencing primer

Multiplex real-time PCR design

Endogenous IC human β-globin PCR assay was optimized as a primer limited reaction to avoid competition between other amplifications. The multiplex PCR reaction consisted of 5 µl of extracted DNA, 1 × Maxima Probe qPCR Master Mix (Thermo Scientific) 0.05 µM CP-Fw, 0.2 µM CP-Rev, 0.175 µM CP-probe, 0.250 µM MP-Fw and MP-Rev primers, 0.150 µ MP-probe, 0.05 µM MR-MP-Fw, 0.400 µM MR-Mp-Rev, 0.150 MR-MP-probe, 0.05 µM BG-Fw, 0.1 µM BG-Rev, 0.05 µM BG-probe and nuclease-free water in a total reaction volume of 25 μl.

Multiplex PCRs were performed using Stratagene Mx3005p instrument (Agilent Technologies Inc, Santa Clara, CA, United States). Positive and negative controls as well as a no template control (NTC) were included in each run. Cycling conditions were 1 cycle 95 °C for 10 min followed by 45 cycles of 95 °C for 15 s and 60 °C for 60 s. After amplification a dissociation curve analysis was performed with a thermal profile: 95 °C for 60 s, 55 °C for 30 s followed by a slow rise in the temperature (0.2 °C/s) to 95 °C with continuous acquisition of fluorescence signal.

Reference PCRs

The M. pneumoniae results by the new multiplex PCR were compared to those obtained by the diagnostic M. pneumoniae PCR test in use at the time of the study at HUSLAB (adapted from van Kuppeveld et al. 1992) or to M. pneumoniae PCR targeting CARDS toxin (CARDStx) gene adapted from Winchell et al. 2008. For the diagnostic PCR, 5 µl of nucleic acid extract was amplified in a 50 µl reaction volume with 0.5 µM of primers (Table 3). Amplified products were detected by microplate hybridization (Vesanen et al. 1996). PCR products were detected with digoxigenin labelled probe (Table 3), anti-digoxigenin antibody conjugated with alkaline phosphatase and LumiPhos Plus substrate (Lumigen, Souhfield, MI, USA). For the CARDStx PCR 5 µl of nucleic acid extract was amplified in 25 µl PCR reaction with 0.25 µM of primers and 0.125 µM probe (Table 3). The real-time PCR reaction was carried out in Stratagene Mx3005p instrument.

The C. pneumoniae results obtained by the new multiplex PCR were compared to those of the diagnostic C. pneumoniae PCR test in use at the time of the study at HUSLAB (Mannonen et al. 2004) (with minor modifications). The primers and probe were the same as in the new multiplex test. Five µl of nucleic acid extract was amplified in 50 µl reaction mixture with 0.3 µM forward and reverse primer and 0.225 µM probe (Table 3).

Specimens

Respiratory tract specimens referred to HUSLAB, Department of Virology and Immunology for testing of M. pneumoniae, C. pneumoniae and/or respiratory viruses between years 1999–2014, were analyzed in this study. The specimens included 42 M. pneumoniae positive specimens assessed by diagnostic PCR of that time (29) (van Kuppeveld et al. 1992) or by CARDS Tx PCR (13) (Winchell et al. 2008). The specimens were nasopharyngeal swabs (24), nasopharyngeal aspirates (5), sputum samples (6), tracheal aspirates (5) and bronchoalveolar lavages (BAL; 2). Due to the limited amount of M. pneumoniae positive BAL specimens, 24 negative BALs were spiked with M. pneumoniae positive respiratory specimens in dilutions 1:10–1:1000.

The C. pneumoniae positive specimens included two sputum samples and three nose and/or throat swabs, 12 simulated BALs and 11 simulated respiratory tract specimens. The simulated specimens were prepared by spiking negative BALs and respiratory tract specimens with C.pneumoniae strain K6 yielding 1.25 inclusion forming unit (IFU)/PCR reaction or 250 IFU/PCR reaction. Altogether 43 M. pneumoniae and C. pneumoniae negative upper and lower respiratory tract specimens were assessed in this study. In addition, the QCMDs External Quality assurance panel 2014 Chlamydophila pneumoniae and Mycoplasma pneumoniae was used to evaluate the performance of the developed multiplex real-time PCR.

DNA extraction

DNA was extracted from respiratory specimens using MagNA Pure LC Total Nucleic Acid Isolation Kit or MagNA Pure DNA/Viral NA SV 2.0 Kit (Roche Diagnostics GmbH, Mannheim, Germany). In detail, 300 µl of specimen was lysed with 300 µl of MagNA Pure Lysis/Binding Buffer (Roche Diagnostics GmbH, Mannheim, Germany). Five hundred µl (MagNA Pure LC) or 450 µl (MagNA Pure 96) of specimen lysate was extracted with the MagNA Pure LC or the MagNA Pure 96-instrument and eluted in 50 µl of the elution buffer.

Specimens tested by the reference M. pneumoniae and C. pneumoniae PCRs had been extracted by either using MagNA Pure LC, EasyMAG instrument (bioMerieux, Marcy l’Etoile, France) or phenol–chloroform extraction. Starting volumes were 1800 µl for BALs, 200 µl for nasopharyngeal aspirates and sputum specimens, and 100 µl for nasopharyngeal swabs. Nucleic acids extracted by EasyMAG were eluted in 25 µl and those extracted by phenol–chloroform protocol were eluted either in 50 µl (nasopharyngeal swabs) or 20 µl (other specimens).

Sequencing analysis of PCR products

Nucleotide sequence analysis of M. pneumoniae 23S rRNA gene (GeneBank. X68422) was performed to all specimens containing mutations associated with macrolide resistance in M. pneumoniae according to the developed multiplex real-time PCR. The primer sequences have been previously described (Table 3). The PCR products were sequenced in the Institute of Biotechnology at the University of Helsinki.

Analytical sensitivity

The analytical sensitivity of the multiplex real-time PCR assay was assessed by amplifying serial dilutions of M. pneumoniae M129 DNA control (ZeptoMetrix Corporation, Franklin, MA) and DNA from C. pneumoniae K-6 (quantitated at Mirja Puolakkainen’s research laboratory). Four dilutions with ten replicates of each were amplified with the multiplex real-time PCR carried out in Mx3005p instrument. The tested M. pneumoniae M 129 DNA dilutions were 6.210, 3.105, 1.552 and 0.776 genome copies (cp)/PCR reaction, and C. pneumoniae K-6 DNA dilutions were 0.250, 0.125, 0.063 and 0.032 IFU/PCR reaction.

Analytical specificity

To assess the analytical specificity of the multiplex PCR assay various bacterial and viral samples were studied (Additional file 1, Table S1).

Authors’ contributions

MN carried out all the laboratory experiments and drafted the manuscript. LM and MP finalized the manuscript. All authors designed the study, participated in the data analysis and reviewed as well as approved the final manuscript. All the authors read and approved the final manuscript.

Acknowledgements

We are grateful to Dr. Dario Papi, TIBMOL, Berlin, Germany for excellent primer and probe design of the MR–MP component of the mxPCR. We thank Akseli Virtanen and Tommi Hirvonen for helping with the data analysis with Validation Manager software. We thank QCMD Glasgow UK, for their kind permission to refer to the results from their external quality assessment programme.

Funding

This study was supported by an R&D grant from Helsinki University Central Hospital (HUSLAB).

Competing interest

The authors declare that they have no Competing interest.

Additional file

40064_2015_1457_MOESM1_ESM.xlsx (11.8KB, xlsx)

10.1186/s40064-015-1457-x Viral and bacterial samples used to evaluate the analytical specificity of the multiplex real-time PCR. An excel table containing information on the material used to assess the analytical specificity of the multiplex PCR.

Contributor Information

Maaret Nummi, Email: maaret.nummi@hus.fi.

Laura Mannonen, Phone: +358-40-8384009, Email: laura.mannonen@hus.fi.

Mirja Puolakkainen, Email: mirja.puolakkainen@helsinki.fi.

References

  1. Atkinson TP, Balish MF, Waites KB. Epidemiology, clinical manifestations, pathogenesis and laboratory detection of Mycoplasma pneumoniae infections. FEMS Microbiol Rev. 2008;32:956–973. doi: 10.1111/j.1574-6976.2008.00129.x. [DOI] [PubMed] [Google Scholar]
  2. Bébéar C, Pereyre S, Peuchant O. Mycoplasma pneumoniae: susceptibility and resistance to antibiotics. Future Microbiol. 2011;6:423–431. doi: 10.2217/fmb.11.18. [DOI] [PubMed] [Google Scholar]
  3. Dowell SF, Peeling RW, Boman J, Carlone GM, Fields BS, Guarner J, Hammerschlag MR, Jackson LA, Kuo CC, Maass M, Messmer TO, Talkington DF, Tondella ML, Zaki SR, C. pneumoniae Workshop Participants Standardizing Chlamydia pneumoniae assays: recommendations from the Centers for Disease Control and Prevention (USA) and the Laboratory Centre for Disease Control (Canada) Clin Infect Dis. 2001;33:492–503. doi: 10.1086/322632. [DOI] [PubMed] [Google Scholar]
  4. Dumke R, Jacobs E. Comparison of commercial and In-House real-time PCR assays used for detection of Mycoplasma pneumoniae. J Clin Microbiol. 2009;47:441–444. doi: 10.1128/JCM.01989-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dumke R, Jacobs E. Evaluation of five real-time PCR assays for detection of Mycoplasma pneumoniae. J Clin Microbiol. 2014;52:4078–4081. doi: 10.1128/JCM.02048-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dumke R, von Baum H, Lück PC, Jacobs E. Occurrence of macrolide-resistant Mycoplasma pneumoniae strains in Germany. Clin Microbiol Infect. 2010;16:616–623. doi: 10.1111/j.1469-0691.2009.02968.x. [DOI] [PubMed] [Google Scholar]
  7. Gullsby K, Storm M, Bondeson K. Simultaneous detection of Chlamydophila pneumoniae and Mycoplasma pneumoniae by use of molecular beacons in a duplex real-time PCR. J Clin Microbiol. 2008;46:727–731. doi: 10.1128/JCM.01540-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Kuo CC, Jackson LA, Campbell LA, Grayston JT. Chlamydia pneumoniae (TWAR) Clin Microbiol Rev. 1995;8:451–461. doi: 10.1128/cmr.8.4.451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lucier TS, Heitzman K, Liu SK, Hu PC. Transition mutations in the 23S rRNA of erythromycin-resistan isolates of Mycoplasma pneumoniae. Antimicrob Agents Chemother. 1995;39:2770–2773. doi: 10.1128/AAC.39.12.2770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Mannonen L, Kamping E, Penttilä T, Puolakkainen M. INF-γ induced persistent Chlamydia pneumoniae infection in HL and Mono Mac 6 cells: characterization by real-time quantitative PCR and culture. Microb Pathog. 2004;36:41–50. doi: 10.1016/j.micpath.2003.09.001. [DOI] [PubMed] [Google Scholar]
  11. Mannonen L, Vainionpää R, Kauppinen J, Lienhard R, Tritten ML, Cannon G, Halle WW, Moilanen K, Häkkinen M, Jääskeläineng A, Piiparinen H, Mäki M, Järvinen AK, Lappalainen M. Evaluation of multiplex-PCR and microarray-based assay for rapid herpesvirus diagnostics. Diagn Microbiol Infect Dis. 2012;73:74–79. doi: 10.1016/j.diagmicrobio.2012.02.015. [DOI] [PubMed] [Google Scholar]
  12. McDonough E, Barrozo C, Russell K, Metzg D. A multiplex PCR for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila and Bordetella pertussis in clinical specimens. Mol Cell Probes. 2005;19:314–322. doi: 10.1016/j.mcp.2005.05.002. [DOI] [PubMed] [Google Scholar]
  13. Miyashita N, Saito A, Kohno S, Yamaguchi K, Watabe A, Oda A, Kazuyama Y, Matsusihima T. Multiplex PCR for the simultaneous detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella pneumophila in community acquired pneumonia. Respir Med. 2004;98:542–550. doi: 10.1016/j.rmed.2003.11.012. [DOI] [PubMed] [Google Scholar]
  14. Orrskog S, Medin E, Tsolova S, Semenza JC. Causal inference regarding infectious aetiology of chronic conditions: a systematic review. PLoS One. 2013;8:e68861. doi: 10.1371/journal.pone.0068861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Principi N, Esposito S. Macrolide-resistant Mycoplasma pneumoniae: its role in respiratory infection. J Antimicrob Chemother. 2013;68:506–511. doi: 10.1093/jac/dks457. [DOI] [PubMed] [Google Scholar]
  16. Schmitt B, Sloan L, Patel R. Real-time PCR detection of Mycoplasma pneumoniae in respiratory specimens. Diagn Microbiol Infect Dis. 2013;77:202–205. doi: 10.1016/j.diagmicrobio.2013.07.016. [DOI] [PubMed] [Google Scholar]
  17. Thurman K, Warner A, Cowart K, Benitez A, Winchell J. Detection of Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella spp. in clinical specimens using a single-tube multiplex real-time PCR assay. Diagn Microbiol Infect Dis. 2011;70:1–9. doi: 10.1016/j.diagmicrobio.2010.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. van Kuppeveld FJM, van der Logt JTM, Angulo AF, van Zoest MJ, Qunt WGV, Niesters HGM, Galama JMD, Melchers WJG. Genus- and species-specific identification of mycoplasmas by 16S rRNA amplification. Appl Environ Microbiol. 1992;58:2606–2615. doi: 10.1128/aem.58.8.2606-2615.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Vesanen M, Piiparinen H, Kallio A, Vaheri A. Detection of herpes simplex virus DNA in cerebrospinal fluid samples using the polymerase chain reaction and microplate hybridization. J Virol Methods. 1996;59:1–11. doi: 10.1016/0166-0934(95)01991-X. [DOI] [PubMed] [Google Scholar]
  20. Waites KB, Talkington DF. Mycoplasma pneumonia and its role as a human pathogen. Clin Microbiol Rev. 2004;17:697–728. doi: 10.1128/CMR.17.4.697-728.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Welti M, Jaton K, Altwegg M, Sahli R, Wenger A, Bille J. Development of a multiplex real-time quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumoniae in respiratory tract secretions. Diagn Microbiol Infect Dis. 2003;45:85–95. doi: 10.1016/S0732-8893(02)00484-4. [DOI] [PubMed] [Google Scholar]
  22. Winchell JM, Thurman KA, Mitchell SL, Thacker WL, Fields BS. Evaluation of three real-time PCR assays for the detection of Mycoplasma pneumoniae in an outbreak investigation. J Clin Microbiol. 2008;46:3116–3118. doi: 10.1128/JCM.00440-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wolff B, Thacker L, Schwartz S, Winchell J. Detection of macrolide resistance in Mycoplasma pneumonia by real-time PCR and high-resolution melt analysis. Antimicrob Agents Chemother. 2008;52:3542–3549. doi: 10.1128/AAC.00582-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from SpringerPlus are provided here courtesy of Springer-Verlag

RESOURCES