Skip to main content
DNA and Cell Biology logoLink to DNA and Cell Biology
. 2015 Nov 1;34(11):684–691. doi: 10.1089/dna.2015.2951

Effect of Crocin on Cell Cycle Regulators in N-Nitroso-N-Methylurea-Induced Breast Cancer in Rats

Mahboobeh Ashrafi 1,,2, S Zahra Bathaie 1,, Saeid Abroun 3, Mahshid Azizian 1
PMCID: PMC4642822  PMID: 26394119

Abstract

We previously showed the anticancer effect of crocin, a saffron carotenoid, in both breast and gastric cancers in animal models, but its mechanism of action is not clearly known, yet. In this study, the effect of crocin on cell cycle regulators is investigated. Female Wistar Albino rats were divided into two groups, with or without N-nitroso-N-methylurea (NMU) injection. After tumor formation, each group of rats was divided into two subgroups, receiving crocin or vehicle only. After 5 weeks, the rats were sacrificed and the tumors were retained for pathologic investigation and determination of the parameters. Before crocin treatment, the tumor volumes were 13.27±3.77 and 12.37±1.88, but at the end of the experiment, they were 23.66±8.82 and 11.91±2.27 in the control and crocin-treated groups, respectively. Pathologic investigation indicated the adenocarcinoma induction by NMU. Reverse transcription–polymerase chain reaction and Western blot analysis showed overexpression of cyclin D1 and p21Cip1 in the NMU-induced breast tumors; however, the expression of both of them suppressed by crocin treatment. The previous studies indicated that crocin induces apoptosis in tumor tissue. In this study, we show that it also suppresses tumor growth and induces cell cycle arrest by downregulation of cyclin D1. In addition, crocin suppressed p21Cip1 in a p53-dependent manner.

Introduction

Rat model of mammary carcinoma using N-nitroso-N-methylurea (NMU) injection is a widely used animal model for breast cancer researches. Because of the similarities between these chemically induced mammary carcinomas and human breast cancers, including their histopathology, originating from mammary ductal epithelial cells and depending on ovarian hormones (estrogen and progesterone) for tumor development (Chan et al., 2005, 2007), it is a good model to investigate the new strategies of breast cancer treatment.

Breast cancer is the most common malignancy in women and comprises 21% of all cancers in women in 23 areas (Parkin et al., 1999). According to different epidemiologic studies in Iran, breast cancer is the first or second (after lung cancer) leading cause of death among cancerous women (Sadjadi et al., 2009; Kolahdoozan et al., 2010; Movahedi et al., 2012; Taghavi et al., 2012; Veisy et al., 2015) and the rate of death was increased from 3.933 to 4.92 per 100,000 cases between 2006 and 2010 (Enayatrad et al., 2015). Despite improvements in surgery and the use of adjuvant therapy, it continues to be fatal in many patients around the world. Furthermore, various side effects and chemoresistance are two important problems.

Therefore, there is a growing interest in using naturally occurring compounds in both chemopreventive and chemotherapeutic studies of breast cancer. There are evidences that medicinal herbs have anticancer properties, which are mediated through different mechanisms (Bathaie and Tamanoi, 2014), including alteration in the carcinogen metabolism, induction of DNA repair systems, immune activation, induction of apoptosis, and suppression of cell cycle progression.

Cyclins control the orderly progression of cells through the cell cycle by determining the timing of activation and the substrate specificity of a series of cyclin-dependent kinases (Cdks), which are sequentially activated during specific phases of the cell cycle. Three D-type cyclins (cyclin Dl–3) act at mid-G1 by complexing with either Cdk4 or Cdk6 (Bui et al., 1995; Peters et al., 1995; Sherr, 1995). Among them, cyclin D1 overexpression was observed in many malignancies, including 40–90% of invasive breast cancers (Roy and Thompson, 2006).

The cyclin-dependent kinase inhibitors (CDKIs) identified in mammalian cells are classified into two major categories. The INK4 family includes p16Ink4a, pl5Ink4b, pl8Ink4c, and pl9Ink4d, which mainly inhibit Cdk4 and Cdk6 by binding to the Cdk subunit itself. The Cip/Kip family includes p2lCip1, p27Kipl, and p57Kip2, which inhibit a broader range of Cdks by binding to several cyclin/Cdk complexes. All of these CDKIs cause G1 arrest when overexpressed in transfected cells. Because the CDKIs are potent negative regulators of the cell cycle, it has been suggested that they may also function as tumor suppressor genes (Sgambato et al., 1997; Nakayama and Nakayama, 1998; Roussel, 1999; Denicourt and Dowdy, 2004).

p53 as a tumor suppressor and cell regulator is also essential for preventing inappropriate cell proliferation and maintaining genome integrity that may occur following genotoxic stresses (Vousden and Lu, 2002). It can induce cell cycle arrest in the G1, G2, and S phases of the cell cycle. Thus, p53 provides additional time for the cell to repair genomic damage before entering the critical stages of DNA synthesis and mitosis. p21waf1/Cip1, which is a CDKI, has been known as a downstream target of p53. Following a DNA damage, p21waf1/Cip1 (wild-type p53-activated fragment 1/Cdk-interacting protein 1) is the primary mediator of p53-dependent G1 cell cycle arrest (el-Deiry et al., 1993; Xiong et al., 1993). The expressions of p21waf1/Cip1 and p53 were evaluated in breast cancer patients. p21 was expressed in 49% and p53 in 32% of the patients. Inverse expression of these two proteins was seen in 73% cases. The percentage of Waf1-positive and p53-negative patients was more than Waf1-negative and p53-positive patients (Wakasugi et al., 1997). However, overexpression of both p53 and p21 was reported in both NMU-induced (Ashrafi et al., 2012) and 7,12-dimethylbenz[a]anthracene (DMBA)-induced (Crist et al., 1996) breast cancer in rats.

Crocin as a water soluble carotenoid obtained from saffron showed various medicinal properties, including antioxidant (Papandreou et al., 2006; Bathaie et al., 2011), anti-inflammatory (Nam et al., 2010), hypoglycemic, and antilipidemic activities (Shirali et al., 2013), in addition to its anticancer effect (Escribano et al., 1996; Hoshyar et al., 2013). The biological properties of saffron and its components were recently reviewed by us (Bathaie and Mousavi, 2010; Bolhassani et al., 2014; Bathaie et al., 2014b). Previous studies have shown that crocin is safe and no toxic effect has been reported for its therapeutic usage (Bathaie and Mousavi, 2010). In addition, our recent study indicates its nontoxic effect, even in humans (Mousavi et al., 2015).

Although the exact mechanism of action of saffron components is still not known, different studies indicated varieties in the molecular mechanism of the anticancer effect of saffron carotenoids. For example, induction of apoptosis in cancer cells (Hoshyar et al., 2013; Bathaie et al., 2013, 2014a; He et al., 2014), telomerase inhibition (Noureini and Wink, 2012), interaction with DNA sequences and induction of conformational changes (Bathaie et al., 2007; Hoshyar et al., 2012), and decrease of histone-DNA complex formation (Ashrafi et al., 2005) have been reported. Because of the importance of the cell cycle regulators in breast cancer and the observed effect of NMU on both p53 and p21, in the present study, the effect of crocin on cell cycle regulators such as cyclin D1, p53, p21Cip1, and p27Kip1 was investigated.

Materials and Methods

Crocin separation and purification

Crocin was extracted and purified from the dried stigmas of Crocus sativus L. using the method previously described by us (Bolhasani et al., 2005).

Animals and treatment

Forty 35-day-old female Wistar Albino rats were purchased from Pastor Institute, Tehran, Iran. All rats were housed under a controlled environment with a 12-h-light/12-h-dark cycle and temperature of 23°C±2°C, given a commercial diet with tap water ad libitum, and weighed weekly. The experimental protocol was approved by the Animal Ethics Committee in accordance with the Guidelines for the Care and Use of Laboratory Animals prepared by the Tarbiat Modares University. After a 2-week acclimatization period, rats were divided into two groups: A group of rats (#26) received three intraperitoneal injections of NMU (Sigma), dissolved freshly in 0.9% NaCl adjusted to pH 4.0 with acetic acid, at a dose of 50 mg/kg body weight, and at 50, 65, and 80 days of age (Ashrafi et al., 2012). The remaining rats, representing the control groups, received the vehicle only.

Tumor number, size, and volume were determined weekly by palpation, after 4 weeks of NMU administration up to the end of the experiment. Tumor volume was calculated according to the V=(4/3)πR12R2 (radius R1<R2) formula (Fendl and Zimniski, 1992). When tumor size reached between 10 and 15 mm in the largest dimension, each of the NMU-treated group and control group of rats were divided into two groups; one group received crocin and the other received the vehicle only. The groups were named as follows: NMU-treated control group (T1, n=7), NMU-treated group receiving crocin (T2, n=7), control group with no treatment (C1, n=7), and a control group receiving crocin (C2, n=7). The rats without tumors were excluded from the study. The crocin-treated groups (T2 and C2) received four doses of 200 mg/kg body weight of crocin, dissolved in the serum physiologic, by intraperitoneal injection at 7-day intervals. Groups T1 and C1 were intraperitoneally injected with the serum physiologic.

Tissue sample preparation

The rats were sacrificed under anesthesia 7 days after the last injection of crocin. All mammary tumors and normal mammary glands of all the groups were dissected and fixed as follows: half of the tumors were fixed in 10% formalin, embedded in paraffin wax, and then stained with hematoxylin and eosin (H&E) for histological study, and the other half of the tumors were immediately frozen in liquid nitrogen and stored at −70°C for reverse transcription–polymerase chain reaction (RT-PCR) and Western blot analysis.

Reverse transcription–polymerase chain reaction

Total RNA from excised rat mammary glands and tumors was isolated using the TRIZOL extraction reagent (Invitrogen) according to the manufacturer's recommendations. The integrity of mRNA was confirmed by electrophoresis in a 1% agarose gel and Thermo Scientific Nanodrop 2000C spectrophotometer. The cDNA was synthesized by using a Revert Aid™ H Minus first strand cDNA synthesis kit (Fermentas, Inc.) as described in the manufacturer's instructions. Polymerase chain reaction (PCR) was carried out by amplification of genes together with the reference gene (GADPH) using an equivalent cDNA template, PCR master mix (Fermentas, Inc.), and specific primers, in a MJ Mini™ Personal Thermal Cycler (Bio-Rad). PCR conditions for cyclin D1 amplification were as follows: 30 cycles of 95°C for 30 s, 56°C annealing for 45 s, and 72°C extension for 45 s; for p21, the conditions were as follows: 30 cycles of 95°C for 30 s, 58°C annealing for 45 s, and 72°C extension for 45 s; for p53 and p27, the conditions were as follows: 30 cycles of 95°C for 30 s, 60°C annealing for 45 s, and 72°C extension for 45 s. The primer sequences, product sizes, and annealing temperatures are given in Table 1. The primer sequences of p53, p27, and GADPH were taken from the literature and the cDNA synthesis kit (Kohen et al., 2003; Takamura et al., 2003; Hsu et al., 2006). Cyclin D1 and p21 primers were designed using Oligo 6, Generunner, and AlleleID 07 software. Then, reaction products were separated on 2% agarose gel and visualized by ethidium bromide staining. The bands were quantified by densitometric analysis through image capturing system software. The relative target mRNA expression level was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same sample.

Table 1.

Experimental Conditions for Polymerase Chain Reaction

Gene Primer sequence Product size Annealing temperature (°C)
Cyclin D1 F: 5′-CAGACCAGCCTAACAGATTTC-3′ 208 56
  R: 5′-TGACCCACAGCAGAAGAAG-3′    
p21 F: 5′-CTGGATGCTAGAGGTCTGC-3′ 105 58
  R: 5′-AGAGTTGTCAGTGTAGATGC-3′    
GAPDH F: 5′-CAAGGTCATCCATGACAACTTTG-3′ 500, 190, 160 58, 60
  R: 5′-GTCCACCACCCTGTTGCTGTAG-3′    
  F: 5′-AACGACCCCTTCATTGAC-3′    
  R: 5′-TCCACGACATACTCAGCAC-3′    
  F: 5′-AACGACCCCTTCATTGAC-3′    
  R: 5′-TCCACGACATACTCAGCAC-3′    
P53 F: 5′-GTGGCCTCTGTCATCTTCCG-3′ 290 60
  R: 5′-CCGTCACCATCAGAGCAACG-3′    
P27 F: GAGGGCAGATACGAGTGGCAG 238 60
  R: CTGGACACTGCTCCGCTAACC    

The primer sequence, annealing temperature, and expected size of PCR products.

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction.

Western blot analysis

For Western blotting, frozen tumor and normal mammary gland tissues (about 100 mg) were homogenized in a lysis buffer (containing 150 mM NaCl, 50 mM EDTA, 1 mM NaF, 10 mM Na4P2O7, 0.1% sodium dodecyl sulfate [SDS], 100 mM Tris-HCl, 1% glycerol, and 1% Triton X-100), containing a cocktail of protease and phophatase inhibitors (Sigma). Equivalent amounts of protein were applied to 12% SDS–polyacrylamide gels, separated by electrophoresis, and electrotransferred to 0.45-μm-pore-size polyvinylidene difluoride membranes (Roche). Membranes were immersed in a blocking solution (5% nonfat dry milk, 0.05% Tween 20 in phosphate-buffered saline [PBS]) and were incubated overnight at 4°C. Primary incubation of the membranes was carried out, respectively, by using 1:100 and 1:200 dilution of mouse monoclonal anti-p21 and anticyclin D1 antibodies (#450 and #271610; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature in 3% nonfat dry milk. After washing with PBS-0.05% Tween 20, filters were incubated for 1 h at room temperature with the horseradish peroxidase-conjugated secondary antibody (1:7000 dilution, goat anti-mouse, #2005; Santa Cruz Biotechnology, Inc.). Protein bands were visualized using an ECL advance Western blotting detection kit (Amersham; GE Healthcare) after washing. An equal loading of proteins was assessed with a mouse monoclonal anti-β-actin antibody (#81178; Santa Cruz Biotechnology, Inc.).

Statistical analysis

Data are shown as mean±standard deviation. For gene expression, differences between the data obtained in all groups, and tumor volume analysis, one-way ANOVA were used. All comparisons with p-values below 0.05 were considered significant.

Results

Treatment response and pathology of mammary tumors

Breast tumors were observed only in the NMU-treated rats (T1 and T2). Before crocin treatment, the mean volumes of tumors were about 13.27±3.77 and 12.37±1.88 in the T1 and T2 groups, respectively. At the end of the experiment, they were 23.66±8.82 and 11.91±2.27 in these groups (T1 and T2, respectively). As demonstrated in Figure 1, administration of crocin significantly suppressed tumor growth in the NMU-treated rats.

FIG. 1.

FIG. 1.

Tumor volume in T1 and T2 groups before and after treatment. Analysis was performed by one-way ANOVA analysis. Values are presented as mean±SD, and the same letters indicate the significance of the data that compares with another.

The H&E stained sections of the samples were analyzed by a specialist in the field of histopathology. As shown in Figure 2, the majority (about 91.9%) of tumors from the NMU-treated groups were malignant adenocarcinoma of different types, such as papillary and comedo carcinoma. About 8.1% were benign epithelial neoplasms such as lactating adenoma (adenomas with milk-like substance in the lumen) and papillary adenoma.

FIG. 2.

FIG. 2.

Histopathology images of tumors. (A) Comedo-type tumor in T1 group with areas of necrosis (shown by the arrow); this area is indicating the presence of debris from dead (necrotic) cancer cells. (B) Papillary-type tumor in T2 group, without necrotic area. H&E staining of mammary tumors shows invasive intraductal carcinoma in NMU-induced tumors. H&E, hematoxylin and eosin; NMU, N-nitroso-N-methylurea.

Expression of cyclin D1, p21Cip1, p27Kip1, and p53

The expression of cyclin D1, p21Cip1, p27Kip1, and p53 was examined in mammary tissues (normal and tumors) of all rats in both mRNA and protein levels. There was no alteration in the expression of these genes in the normal mammary glands, groups C1 and C2. (The Western blot data are not shown.) As shown in Figure 3A–C, a significant decrease in the mRNA and protein levels of cyclin D1 was observed in the tumors of group T2 in comparison with T1. A marked decrease in the mRNA and protein level of p21Cip1 and a nonsignificant decrease in the mRNA levels of p27Kip1 and p53 were observed in the tumors of group T2 in comparison with T1 (Figs. 4A–C, 5A, B, and 6A, B).

FIG. 3.

FIG. 3.

The results of cyclin D1 expression. (A) RT-PCR and (B) Western blot results of rat tumors with or without treatment by crocin in comparison with the normal mammary tissue. (C) Densitometric analysis of cyclin D1 expression. Values are presented as mean±SD, and the same letters indicate the significance of the data that compares with another. M, DNA marker; C1 and C2, control groups with or without crocin treatment, respectively; T1 and T2, NMU-injected groups with or without crocin treatment, respectively; RT-PCR, reverse transcription–polymerase chain reaction; SD, standard deviation.

FIG. 4.

FIG. 4.

The results of p21Cip1 expression. (A) RT-PCR and (B) Western blot results of the rat tumors with or without crocin treatment in comparison with the normal mammary gland. (C) Densitometric analysis of p21Cip1 expression. Values are expressed as mean±SD, and the same letters indicate the significance of the data that compares with another.

FIG. 5.

FIG. 5.

The results of p27 expression. (A) RT-PCR and (B) densitometric analysis of P27 expression. Values are expressed as mean±SD.

FIG. 6.

FIG. 6.

The results of p53 expression. (A) RT-PCR and (B) densitometric analysis of P53 expression. Values are expressed as mean±SD.

Discussion

The results of the present study indicate the anticancer effect of crocin in NMU-induced breast cancer in female rat. Before and after crocin treatment, the volumes of tumors were determined in the T1 and T2 groups. The results showed that the rate of tumor growth was twice greater in the NMU-injected group with no other treatment than the similar group receiving crocin; it means that crocin significantly suppressed the growth of tumors. Similar results were reported by us in our previous study (Chitsazan et al., 2006). In addition, pathologic analysis showed both comedo and papillary types of adenocarcinoma with areas of necrosis in NMU-induced breast tumors (T1), however in the crocin-treated group only papillary-type tumors have been observed. Since the growth of comedo-type tumor is faster than the papillary type, this result is completely consistent with the observed changes in the tumor volume. These results are in accordance with the reported data on the therapeutic effect of crocin on colon adenocarcinoma in rats (Garcia-Olmo et al., 1999), bladder cancer in mice (Zhao et al., 2008), in leukemia HL-60 cells both in vitro and xenografted in mice (Sun et al., 2013), and in both rat model of gastric cancer and human AGS cells (Hoshyar et al., 2013).

We also showed that crocin induced apoptosis in AGS cells and MNNG-induced gastric cancer in rats. Crocin increased the Bax/Bcl-2 ratio and the activity of caspases in AGS cells, in addition to the increased sub-G1 population of cells (Hoshyar et al., 2013). In addition, the induction of apoptosis and activation of caspases have been reported in MCF-7 cells after treatment of cells with saffron extract (Mousavi et al., 2009). The present study was also investigating the effect of crocin on cell cycle regulators in NMU-induced breast cancer.

As shown in Figure 3, the results of both RT-PCR and Western blot analysis indicate that cyclin D1 expression was increased in the NMU-treated group. The cyclin D family comprises key proteins involved in facilitating the entry of cells into the cell cycle and progression through S phase. The overexpression of cyclin D1 and activation of Cdks in G1 phase may be the key factors for shortening the G1 phase, increasing the cell proliferation rate and oncogenesis (Hinz et al., 1999). An immunohistochemical study in 64 breast cancer patients demonstrated that, the cyclin D1 gene is amplified in ∼24% of mammary carcinomas and its protein is overexpressed in more than 50% of cases (Barbareschi et al., 1997).

As indicated in the results, crocin treatment significantly suppressed cyclin D1 overexpression in both mRNA and protein levels. Thus, in addition to the induction of apoptosis and activation of caspases that were shown in previous studies, it is the third mechanism of crocin anticancer effect. These results are in accordance with the reported data on the effect of crocin on downregulation of cyclin D1 expression in bladder cancer (TCCB) T24 cell line and in vivo, in BALB/c xenograft tumor (Zhao et al., 2008).

Based on the RT-PCR and Western blot results presented here, crocin significantly suppressed the p21Cip1 overexpression due to the NMU injection and cancer induction in breast tissue. As mentioned above, p21 regulates several cell cycle proteins, including cyclin D1, inhibits Cdks, and induces cell cycle arrest (Xiong et al., 1993; Archer et al., 1995; Wakasugi et al., 1997). Although p21 has been known as the inhibitor of CDKs, the coexpression of cyclin D1 and p21 protein is required for the initial steps of tumor development. The overexpression of cyclin D1 and p21 are often reported in human cancers and is correlated with a high tumor grade and poor prognosis (Dai et al., 2013).

p53 as a tumor suppressor is known to play a key role in practically all types of human cancers, especially breast cancer (Oren and Rotter, 1999). Our results also indicated its overexpression in NMU-induced breast cancer in Wistar Albino rat that is similar to that reported in Sprague Dawley rat (Crist et al., 1996). It has also shown that in this type of cancer induction, there is no mutation in the p53 gene (Kito et al., 1996). On the other hand, p21 has been known as a critical downstream mediator of wild-type p53 (Dotto, 2000); thus, overexpression of p21Cip1 after NMU administration and its downregulation due to crocin treatment may occur through the pathways dependent on p53.

The anticancer effect of crocin on three human colorectal cancer cells (HCT-116, SW-480, and HT-29) has been reported. The represented data indicated a significantly higher sensitivity of HCT-116 to crocin than the other two cell lines. HCT-116 cells contain wild-type p53, while the p53 tumor suppressor gene is mutated in SW-480 and HT-29 cells. Therefore, it was concluded that the stronger anticancer activity of crocin on HCT-116 cells is related to the wild-type p53 (Aung et al., 2007). These results are affirmative reasons for the above-mentioned explanation of the relation between wild-type p53 and p21 and the effect of crocin.

Increased expression of cyclin D1 and p21Cip1 in association with decreased expression of p27Kip1 has been reported in DMBA-induced mammary tumors in rats (Jang et al., 2000). p27kip1 has been known as another cell cycle regulator that inhibits G1 progression through Cdk2 inhibition. In most cancers, mitogen stimulates the elimination of p27Kip1 by decreased translation and increased ubiquitin-directed degradation (Alessandrini et al., 1997; Vlach et al., 1997), a cause for lower concentration of this cell cycle inhibitor in tumor tissues. Our results also indicated a significant decrease in p27 mRNA expression in some tumors; however, there were no changes in some others. Thus, the average mRNA expression of p27 in T1 was not significant in comparison with the average in C1. In addition, a nonsignificant reduction in p27 mRNA expression in T2, in comparison with T1, was also observed (Fig. 5). These nonsignificant changes are possible due to the limitations in our experiment that we could not investigate by Western blot. As mentioned above, the expression of p27Kip1 is mainly controlled by the rate of translation and degradation rather than by changes in the transcriptional activities (Slingerland and Pagano, 2000). The subject should be investigated in the future.

In conclusion, crocin, a carotenoid and a main metabolite of saffron, induces growth inhibition (decreased TV) in the NMU-induced breast cancer in rats through at least two different mechanisms; not only by inducing apoptosis but also by inhibiting cell cycle progression through downregulation of cyclin D1 and p21Cip1 expression in a p53-dependent manner.

Acknowledgments

The authors are thankful to the Research Council of Tarbiat Modares University for supporting this project. We especially thank the Avicenna Research Institute for their assistance to do some experiments.

Disclosure Statement

No competing financial interests exist.

References

  1. Alessandrini A., Chiaur D.S., and Pagano M. (1997). Regulation of the cyclin-dependent kinase inhibitor p27 by degradation and phosphorylation. Leukemia 11, 342–345 [DOI] [PubMed] [Google Scholar]
  2. Archer S.G., Eliopoulos A., Spandidos D., Barnes D., Ellis I.O., Blamey R.W., Nicholson R.I., and Robertson J.F. (1995). Expression of ras p21, p53 and c-erbB-2 in advanced breast cancer and response to first line hormonal therapy. Br J Cancer 72, 1259–1266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ashrafi M., Bathaie S.Z., and Abroun S. (2012). High expression of cyclin D1 and p21 in N-nitroso-N-methylurea-induced breast cancer in Wistar Albino female rats. Cell J 14, 193–202 [PMC free article] [PubMed] [Google Scholar]
  4. Ashrafi M., Bathaie S.Z., Taghikhani M., and Moosavi-Movahedi A.A. (2005). The effect of carotenoids obtained from saffron on histone H1 structure and H1-DNA interaction. Int J Biol Macromol 36, 246–252 [DOI] [PubMed] [Google Scholar]
  5. Aung H.H., Wang C.Z., Ni M., Fishbein A., Mehendale S.R., Xie J.T., Shoyama C.Y., and Yuan C.S. (2007). Crocin from Crocus sativus possesses significant anti-proliferation effects on human colorectal cancer cells. Exp Oncol 29, 175–180 [PMC free article] [PubMed] [Google Scholar]
  6. Barbareschi M., Pelosio P., Caffo O., Buttitta F., Pellegrini S., Barbazza R., Dalla Palma P., Bevilacqua G., and Marchetti A. (1997). Cyclin-D1-gene amplification and expression in breast carcinoma: relation with clinicopathologic characteristics and with retinoblastoma gene product, p53 and p21WAF1 immunohistochemical expression. Int J Cancer 74, 171–174 [DOI] [PubMed] [Google Scholar]
  7. Bathaie S.Z., Bolhasani A., Hoshyar R., Ranjbar B., Sabouni F., and Moosavi-Movahedi A.A. (2007). Interaction of saffron carotenoids as anticancer compounds with ctDNA, Oligo (dG.dC)15, and Oligo (dA.dT)15. DNA Cell Biol 26, 533–540 [DOI] [PubMed] [Google Scholar]
  8. Bathaie S.Z., Bolhassan A., and Tamanoi F. (2014a). Anticancer effect and molecular targets of saffron carotenoids. In Natural Products and Cancer Signaling: Isoprenoids, Polyphenols and Flavonoids. Bathaie S.Z., and Tamanoi F., eds. (Academic Press/Elsevier, San Diego, CA: ), pp. 57–86 [DOI] [PubMed] [Google Scholar]
  9. Bathaie S.Z., Farajzade A., and Hoshyar R. (2014b). A review of the chemistry and uses of crocins and crocetin, the carotenoid natural dyes in saffron, with particular emphasis on applications as colorants including their use as biological stains. Biotech Histochem 89, 401–411 [DOI] [PubMed] [Google Scholar]
  10. Bathaie S.Z., Hoshyar R., Miri H., and Sadeghizadeh M. (2013). Anticancer effects of crocetin in both human adenocarcinoma gastric cancer cells and rat model of gastric cancer. Biochem Cell Biol 91, 397–403 [DOI] [PubMed] [Google Scholar]
  11. Bathaie S.Z., and Mousavi S.Z. (2010). New applications and mechanisms of action of saffron and its important ingredients. Crit Rev Food Sci Nutr 50, 761–786 [DOI] [PubMed] [Google Scholar]
  12. Bathaie S.Z., Shams A., and Moghadas Zadeh Kermani F. (2011). Crocin bleaching assay using purified di-gentiobiosyl crocin (-crocin) from Iranian saffron. Iran J Basic Med Sci 14, 399–406 [PMC free article] [PubMed] [Google Scholar]
  13. Bathaie S.Z., and Tamanoi F. (2014). Natural products and cancer signaling: isoprenoids, polyphenols and flavonoids. In The Enzymes. Tamanoi F., ed. (Academic Press/Elsevier, San Diego, CA: ), p. 258 [Google Scholar]
  14. Bolhasani A., Bathaie S.Z., Yavari I., Moosavi-Movahedi A.A., Ghaffari M. (2005). Separation and purification of some components of Iranian saffron. Asian J Chem 17, 727–729 [Google Scholar]
  15. Bolhassani A., Khavari A., and Bathaie S.Z. (2014). Saffron and natural carotenoids: biochemical activities and anti-tumor effects. Biochim Biophys Acta 1845, 20–30 [DOI] [PubMed] [Google Scholar]
  16. Bui K.C., Buckley S., Wu F., Uhal B., Joshi I., Liu J., Hussain M., Makhoul I., and Warburton D. (1995). Induction of A- and D-type cyclins and cdc2 kinase activity during recovery from short-term hyperoxic lung injury. Am J Physiol 268, L625–L635 [DOI] [PubMed] [Google Scholar]
  17. Chan M.M., Lu X., Merchant F.M., Iglehart J.D., Miron P.L. (2005). Profiling of NMU-induced rat mammary tumors: Cross species comparison with human breast cancer. Carcinogenesis 26, 1343–1353 [DOI] [PubMed] [Google Scholar]
  18. Chan M.M., Lu X., Merchant F.M., Iglehart J.D., Miron P.L. (2007). Serial transplantation of NMU-induced rat mammary tumors: A model of human breast cancer progression. Int J Cancer 121, 474–485 [DOI] [PubMed] [Google Scholar]
  19. Chitsazan A., Bathaie S.Z., Mohagheghi M.A., and Banasadegh S. (2006). Rat mammary tumor induced by NMU and the effect of natural carotenoids. In XXX1st Symposium on Hormones and Regulation: Cancer Cell Signalling. Marais R., ed. (Hostellerie du Mont Sainte Odile, Ottrott, France, p. 45) [Google Scholar]
  20. Crist K.A., Fuller R.D., Chaudhuri B., Chaudhuri P. and You M. (1996). Brief communication, P53 accumulation in N-methyl-N-nitrosourea-induced rat mammary tumors. Toxicol Pathol 24, 370–375 [DOI] [PubMed] [Google Scholar]
  21. Dai M., Al-Odaini A.A., Fils-Aime N., Villatoro M.A., Guo J., Arakelian A., Rabbani S.A., Ali S., and Lebrun J. (2013). Cyclin D1 cooperates with p21 to regulate TGFbeta-mediated breast cancer cell migration and tumor local invasion. Breast Cancer Res 15, R49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Denicourt C., and Dowdy S.F. (2004). Cip/Kip proteins: more than just CDKs inhibitors. Genes Dev 18, 851–855 [DOI] [PubMed] [Google Scholar]
  23. Dotto G.P. (2000). p21(WAF1/Cip1): more than a break to the cell cycle? Biochim Biophys Acta 1471, M43–M56 [DOI] [PubMed] [Google Scholar]
  24. el-Deiry W.S., Tokino T., Velculescu V.E., Levy D.B., Parsons R., Trent J.M., Lin D., Mercer W.E., Kinzler K.W., and Vogelstein B. (1993). WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817–825 [DOI] [PubMed] [Google Scholar]
  25. Enayatrad M., Amoori N., and Salehiniya H. (2015) Epidemiology and trends in breast cancer mortality in Iran. Iran J Public Health 44, 430–431 [PMC free article] [PubMed] [Google Scholar]
  26. Escribano J., Alonso G.L., Coca-Prados M., and Fernandez J.A. (1996). Crocin, safranal and picrocrocin from saffron (Crocus sativus L.) inhibit the growth of human cancer cells in vitro. Cancer Lett 100, 23–30 [DOI] [PubMed] [Google Scholar]
  27. Fendl K.C., and Zimniski S.J. (1992). Role of tamoxifen in the induction of hormone-independent rat mammary tumors. Cancer Res 52, 235–237 [PubMed] [Google Scholar]
  28. Garcia-Olmo D.C., Riese H.H., Escribano J., Ontanon J., Fernandez J.A., Atienzar M., and Garcia-Olmo D. (1999). Effects of long-term treatment of colon adenocarcinoma with crocin, a carotenoid from saffron (Crocus sativus L.): an experimental study in the rat. Nutr Cancer 35, 120–126 [DOI] [PubMed] [Google Scholar]
  29. He K., Si P., Wang H., Tahir U., Chen K., Xiao J., Duan X., Huang R., and Xiang G. (2014). Crocetin induces apoptosis of BGC-823 human gastric cancer cells. Mole Med Rep 9, 521–526 [DOI] [PubMed] [Google Scholar]
  30. Hinz M., Krappmann D., Eichten A., Heder A., Scheidereit C., and Strauss M. (1999). NF-kappaB function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol Cell Biol 19, 2690–2698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Hoshyar R., Bathaie S.Z., Kyani A., and Mousavi M.F. (2012). Is there any interaction between telomeric DNA structures, G-quadruplex and I-motif, with saffron active metabolites? Nucleosides, Nucleotides Nucleic Acids 31, 801–812 [DOI] [PubMed] [Google Scholar]
  32. Hoshyar R., Bathaie S.Z., and Sadeghizadeh M. (2013). Crocin triggers the apoptosis through increasing the Bax/Bcl-2 ratio and caspase activation in human gastric adenocarcinoma, AGS, cells. DNA Cell Biol 32, 50–57 [DOI] [PubMed] [Google Scholar]
  33. Hsu M.K.H., Qiao L., Ho V., Zhang B.H., Zhang H., Teoh N., Dent A., Farrell G.C. (2006). Ethanol reduces p38 kinase activation and cyclin D1 protein expression after partial hepatectomy in rats. J Hepato l44, 375–382 [DOI] [PubMed] [Google Scholar]
  34. Jang T.J., Kang M.S., Kim H., Kim D.H., Lee J.I., and Kim J.R. (2000). Increased expression of cyclin D1, cyclin E and p21(Cip1) associated with decreased expression of p27(Kip1) in chemically induced rat mammary carcinogenesis. Jpn J Cancer Res 91, 1222–1232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kito K., Kihana T., Sugita A., Murao S., Akehi S., Sato M., Tachibana M., Kimura S., and Ueda N. (1996). Incidence of p53 and Ha-ras gene mutations in chemically induced rat mammary carcinomas. Mol Carcinog 17, 78–83 [DOI] [PubMed] [Google Scholar]
  36. Kohen R., Neumaier J.F., Hamblin M.W., Edwards E. (2003). Congenitally learned helpless rats show abnormalities in intracellular signaling. Biol Psychiatry 53, 520–529 [DOI] [PubMed] [Google Scholar]
  37. Kolahdoozan S., Sadjadi A., Radmard A.R., and Khademi H. (2010). Five common cancers in Iran. Arch Iran Med 13, 143–146 [PubMed] [Google Scholar]
  38. Mousavi B., Bathaie S.Z., Fadai F., Ashtari Z., Ali Beigi N., Farhang S., Hashempour S., Shahhamzei N., and Heidarzadeh H. (2015). Safety evaluation of saffron (Crocus sativus L.) aqueous extract and crocin in patients with schizophrenia. Avicenna J Phytomed. Available at: http://ajp.mums.ac.ir/pdf_3879_5bd632d76a4e0b74df6349757d5d2245.html (accessed January26, 2015). [PMC free article] [PubMed]
  39. Mousavi S.H., Tavakkol-Afshari J., Brook A., and Jafari-Anarkooli I. (2009). Role of caspases and Bax protein in saffron-induced apoptosis in MCF-7 cells. Food Chem Toxicol 47, 1909–1913 [DOI] [PubMed] [Google Scholar]
  40. Movahedi M., Haghighat S., Khayamzadeh M., Moradi A., Ghanbari-Motlagh A., Mirzaei H., and Esmail-Akbari M. (2012). Survival rate of breast cancer based on geographical variation in Iran, a national study. Iran Red Crescent Med J 14, 798–804 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Nakayama K., and Nakayama K. (1998). Cip/Kip cyclin-dependent kinase inhibitors: brakes of the cell cycle engine during development. Bioessays 20, 1020–1029 [DOI] [PubMed] [Google Scholar]
  42. Nam K.N., Park Y.M., Jung H.J., Lee J.Y., Min B.D., Park S.U., Jung W.S., Cho K.H., Park J.H., Kang I., Hong J.W., and Lee E.H. (2010). Anti-inflammatory effects of crocin and crocetin in rat brain microglial cells. Eur J Pharmacol 648, 110–116 [DOI] [PubMed] [Google Scholar]
  43. Noureini S.K., and Wink M. (2012). Antiproliferative effects of crocin in HepG2 cells by telomerase inhibition and hTERT down-regulation. Asian Pac J Cancer Prev 13, 2305–2309 [DOI] [PubMed] [Google Scholar]
  44. Oren M., and Rotter V. (1999). Introduction: p53—the first twenty years. Cell Mol Life Sci 55, 9–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Papandreou M.A., Kanakis C.D., Polissiou M.G., Efthimiopoulos S., Cordopatis P., Margarity M., and Lamari F.N. (2006). Inhibitory activity on amyloid-beta aggregation and antioxidant properties of Crocus sativus stigmas extract and its crocin constituents. J Agric Food Chem 54, 8762–8768 [DOI] [PubMed] [Google Scholar]
  46. Parkin D.M., Pisani P., and Ferlay J. (1999). Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer 80, 827–841 [DOI] [PubMed] [Google Scholar]
  47. Peters G., Fantl V., Smith R., Brookes S., and Dickson C. (1995). Chromosome 11q13 markers and D-type cyclins in breast cancer. Breast Cancer Res Treat 33, 125–135 [DOI] [PubMed] [Google Scholar]
  48. Roussel M.F. (1999). The INK4 family of cell cycle inhibitors in cancer. Oncogene 18, 5311–5317 [DOI] [PubMed] [Google Scholar]
  49. Roy P.G., and Thompson A.M. (2006). Cyclin D1 and breast cancer. Breast 15, 718–727 [DOI] [PubMed] [Google Scholar]
  50. Sadjadi A., Nouraie M., Ghorbani A., Alimohammadian M., and Malekzadeh R. (2009). Epidemiology of breast cancer in the Islamic Republic of Iran: first results from a population-based cancer registry. East Mediterr Health J 15, 1426–1431 [PubMed] [Google Scholar]
  51. Sgambato A., Zhang Y.J., Arber N., Hibshoosh H., Doki Y., Ciaparrone M., Santella R.M., Cittadini A., and Weinstein I.B. (1997). Deregulated expression of p27(Kip1) in human breast cancers. Clin Cancer Res 3, 1879–1887 [PubMed] [Google Scholar]
  52. Sherr C.J. (1995). D-type cyclins. Trends Biochem Sci 20, 187–190 [DOI] [PubMed] [Google Scholar]
  53. Shirali S., Zahra Bathaie S., and Nakhjavani M. (2013). Effect of crocin on the insulin resistance and lipid profile of streptozotocin-induced diabetic rats. Phytother Res 27, 1042–1047 [DOI] [PubMed] [Google Scholar]
  54. Slingerland J., and Pagano M. (2000). Regulation of the cdk inhibitor p27 and its deregulation in cancer. J Cell Physiol 183, 10–17 [DOI] [PubMed] [Google Scholar]
  55. Sun Y., Xu H.J., Zhao Y.X., Wang L.Z., Sun L.R., Wang Z., and Sun X.F. (2013). Crocin exhibits antitumor effects on human leukemia HL-60 cells in vitro and in vivo. Evid Based Complement Alternat Med 2013, 690164.. DOI: 10.1155/2013/690164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Taghavi A., Fazeli Z., Vahedi M., Baghestani A.R., Pourhoseingholi A., Barzegar F., and Pourhoseingholi M.A. (2012). Increased trend of breast cancer mortality in Iran. Asian Pac J Cancer Prev 13, 367–370 [DOI] [PubMed] [Google Scholar]
  57. Takamura Y., Kubo E., Tsuzuki S., Akagi Y. (2003). Apoptotic cell death in the lens epithelium of rat sugar cataract. Exp Eye Res 77, 51–57 [DOI] [PubMed] [Google Scholar]
  58. Veisy A., Lotfinejad S., Salehi K., and Zhian F. (2015). Risk of breast cancer in relation to reproductive factors in North-West of Iran, 2013–2014. Asian Pac J Cancer Prev 16, 451–455 [DOI] [PubMed] [Google Scholar]
  59. Vlach J., Hennecke S., and Amati B. (1997). Phosphorylation-dependent degradation of the cyclin-dependent kinase inhibitor p27. EMBO J 16, 5334–5344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Vousden K.H., and Lu X. (2002). Live or let die: the cell's response to p53. Nat Rev Cancer 2, 594–604 [DOI] [PubMed] [Google Scholar]
  61. Wakasugi E., Kobayashi T., Tamaki Y., Ito Y., Miyashiro I., Komoike Y., Takeda T., Shin E., Takatsuka Y., Kikkawa N., Monden T., and Monden M. (1997). p21(Waf1/Cip1) and p53 protein expression in breast cancer. Am J Clin Pathol 107, 684–691 [DOI] [PubMed] [Google Scholar]
  62. Xiong Y., Hannon G.J., Zhang H., Casso D., Kobayashi R., and Beach D. (1993). p21 is a universal inhibitor of cyclin kinases. Nature 366, 701–704 [DOI] [PubMed] [Google Scholar]
  63. Zhao P., Luo C.L., Wu X.H., Hu H.B., Lv C.F., and Ji H.Y. (2008). Proliferation apoptotic influence of crocin on human bladder cancer T24 cell line. Zhongguo Zhong Yao Za Zhi 33, 1869–1873 [PubMed] [Google Scholar]

Articles from DNA and Cell Biology are provided here courtesy of SAGE Publications

RESOURCES