Identification of 99 novel mutations in a worldwide cohort of 1,056 patients with a nephronophthisis-related ciliopathy

Abstract

Nephronophthisis-related ciliopathies (NPHP-RC) are autosomal-recessive cystic kidney diseases. More than 13 genes are implicated in its pathogenesis to date, accounting for only 40 % of all cases. High-throughput mutation screenings of large patient cohorts represent a powerful tool for diagnostics and identification of novel NPHP genes. We here performed a new high-throughput mutation analysis method to study 13 established NPHP genes (NPHP1–NPHP13) in a worldwide cohort of 1,056 patients diagnosed with NPHP-RC. We first applied multiplexed PCR-based amplification using Fluidigm Access-Array™ technology followed by barcoding and next-generation resequencing on an Illumina platform. As a result, we established the molecular diagnosis in 127/1,056 independent individuals (12.0 %) and identified a single heterozygous truncating mutation in an additional 31 individuals (2.9 %). Altogether, we detected 159 different mutations in 11 out of 13 different NPHP genes, 99 of which were novel. Phenotypically most remarkable were two patients with truncating mutations in INVS/NPHP2 who did not present as infants and did not exhibit extrarenal manifestations. In addition, we present the first case of Caroli disease due to mutations in WDR19/NPHP13 and the second case ever with a recessive mutation in GLIS2/NPHP7. This study represents the most comprehensive mutation analysis in NPHP-RC patients, identifying the largest number of novel mutations in a single study worldwide.

Introduction

The term nephronophthisis-related ciliopathies (NPHP-RC) describes a group of rare autosomal-recessive cystic kidney diseases, characterized by a broad genetic and clinical heterogeneity and accounting for the majority of genetic causes of end-stage renal disease (ESRD) during childhood (Hildebrandt et al. 2009; Hildebrandt and Otto 2005; Wolf and Hildebrandt 2011). NPHP-RC includes isolated nephronophthisis (NPHP), Senior-Loken syndrome (SLS), Joubert syndrome (JBTS), and Meckel Gruber syndrome (MKS). In renal histology, the most prominent features of NPHP are tubular atrophy, basement membrane disintegration, interstitial fibrosis, and cyst formation. The most common extrarenal manifestation observed in NPHP is progressive retinal dystrophy defined as SLS. The hallmark of JBTS is mid-hindbrain malformation and cerebellar vermis hypoplasia or aplasia, descriptively designated as “molar tooth sign” on a cranial MRI. This results in various neurological features including developmental delay, intellectual disability, muscle hypotonia, ataxia, oculomotor apraxia, nystagmus, and respiratory distress (Parisi 2009). MKS, a perinatally lethal ciliopathy, represents the most severe manifestation of the NPHP-RC clinical spectrum. It is characterized by central nervous system malformations, bilateral postaxial hexadactyly, hepatobiliary ductal plate malformation, and multicystic dysplastic kidneys (Johnson et al. 2003). As the phenotype of NPHP-RC shows a vast and partially overlapping spectrum, the genotype is also broadly heterogeneous, with more than 13 NPHP genes implicated to date (Table 1), accounting for only about 40 % of all cases: NPHP1, INVS/NPHP2, NPHP3, NPHP4, IQCB1/NPHP5, CEP290/NPHP6, GLIS2/NPHP7, RPGRIP1L/NPHP8, NEK8/NPHP9, SDCCAG8/NPHP10, TMEM67/NPHP11, TTC21B/NPHP12 and WDR19/NPHP13 (Hildebrandt et al. 1997; Olbrich et al. 2003; Otto et al. 2002, 2003, 2005, 2008b, 2009b, 2010; Mollet et al. 2002; Sayer et al. 2006; Attanasio et al. 2007; Delous et al. 2007; Davis et al. 2011; Bredrup et al. 2011). In addition, JBTS or MKS results from mutations in a subset of these genes or from any of at least 20 additional disease genes (MKS1, B9D1, B9D2, AHI1, INPP5E, ARL13B, TMEM216, CC2D2A, KIF7, TCTN1, TCTN2, TCTN3, ATXN10, CEP41, OFD1, TMEM138, C5ORF42, ZNF423, TMEM231 and TMEM237), most of which have been identified only recently (Kyttälä et al. 2006; Hopp et al. 2011; Dowdle et al. 2011; Ferland et al. 2004; Bielas et al. 2009; Cantagrel et al. 2008; Valente et al. 2010; Gorden et al. 2008; Dafinger et al. 2011; Garcia-Gonzalo et al. 2011; Sang et al. 2011; Huang et al. 2011; Lee et al. 2012a, b; Coene et al. 2009; Srour et al. 2012a, b; Chaki et al. 2012; Thomas et al. 2012).

Table 1.

13 NPHP genes investigated using Fluidigm 48.48 Access Array™ amplification and consecutive next-generation resequencing (NGS)

Gene	Locus/protein	Chromosome	Accession #	Exon count	Coding exon count	Open reading frame size (bp)
NPHP1	NPHP1/nephrocystin 1	2	NM_000272.2	20	20	2,202
INVS	NPHP2/inversin	9	NM_014425.2	17	16	3,198
NPHP3	NPHP3/nephrocystin 3	3	NM_153240.3	27	27	3,993
NPHP4	NPHP4/nephroretinin	1	NM_015102.2	30	29	4,281
IQCB1	NPHP5/IQ motif containing B1	3	NM_001023570.1	15	13	1,797
CEP290	NPHP6/centrosomal protein 290 kDa	12	NM_025114.3	54	53	7,440
GLIS2	NPHP7/GLIS family zinc finger 2	16	NM_032575.2	6	6	1,575
RPGRIP1L	NPHP8/RPGRIP1-like	16	NM_015272.2	27	26	3,948
NEK8	NPHP9/NIMA-related kinase 8	17	NM_178170.2	15	15	2,079
SDCCAG8	NPHP10/serologically defined colon cancer antigen 8	1	NM_006642.3	18	18	2,139
TMEM67	NPHP11/meckelin	8	NM_153704.5	28	28	2,988
TTC21B	NPHP12/tetratricopeptide repeat domain 21B	2	NM_024753.4	29	29	3,951
WDR19	NPHP13/WD repeat domain 19	4	NM_025132.3	37	36	4,029
				323	316	43,620

The common feature of proteins encoded by genes mutated in NPHP-RC is their localization to primary cilia, basal body or centrosomes, which results in defects of the respective cell organelle. The discovery of the crucial role of primary cilia led to the general term “ciliopathy” (Hildebrandt et al. 2011).

Since 60 % of NPHP-RC cases harbor mutations in genes that are yet to be identified, the detection of novel, disease causing NPHP genes remains a major challenge. In order to address this issue, mutation analysis of established genes is a necessity in way of a priori exclusion. Due to an increasing number of NPHP genes, comprehensive mutation analysis by Sanger sequencing becomes more tedious and costly. However, technical advances in next-generation resequencing (NGS) and development of commercially available high-throughput polymerase chain reaction (PCR)-based resequencing platforms facilitate and accelerate mutation analysis. One of those platforms is the 48.48 Access Array™ microfluidic system from Fluidigm (South San Francisco, CA), which enables amplification of 48 DNA samples in combination with each of 48 target-specific primer pairs, resulting in 2,304 individual PCRs in parallel. Applying a tenfold primer pooling strategy, we recently were able to successfully scale up the Fluidigm/NGS approach to about 23,000 parallel PCRs (Halbritter et al. 2012). This pilot project was conducted in 192 patients and showed high efficiency at a low cost with a sensitivity of 90 % and specificity of 87 %. In the present study, we describe a streamlined screening approach using the Fluidigm platform to amplify all coding exons of 13 known NPHP genes by multiplexed-PCR and barcoded consecutive NGS in a comprehensive cohort of 1,056 individuals with NPHP-RC. The most frequent mutation in patients with NPHP-RC, a homozygous NPHP1 deletion, has been excluded in all affected individuals prior to inclusion in the present study.

Materials and methods

Human subjects

We obtained blood samples, pedigrees, and clinical information after receiving informed consent (http://www.renalgenes.org). Approval for experiments on humans was obtained from the University of Michigan Institutional Review Board. The diagnosis of NPHP-RC was based on published clinical criteria (Chaki et al. 2011). The total cohort of 1,056 patients with NPHP-RC included 447 patients with isolated NPHP versus 609 patients with additional extrarenal manifestations mainly in patients with Joubert syndrome (109), Senior-Loken syndrome (103), Meckel–Gruber syndrome (9), and Jeune syndrome (5). Frequent extrarenal manifestations seen in our cohort were retinal dystrophy (157), cerebellar vermis hypoplasia (109), liver fibrosis/hepatomegaly (94), early blindness/Leber congenital amaurosis (49), heart anomalies (30), oculomotor apraxia (30), deafness (18), polydactyly (17), microcephaly (15), situs inversus (14), facial dysmorphic features (11), retina coloboma (10), cone-shaped epiphysis (9), hydrocephalus (6), pancreatic cysts (6), and microophthalmia (2). Our total cohort consisted of 159 families with multiple affected cases vs. 897 single affected cases. Consanguinity was known to be present in 190 (18 %) families. As a first diagnostic step, homozygous deletions of NPHP1 were excluded in all patients by applying a multiplex PCR-based deletion analysis described elsewhere (Otto et al. 2008a).

Primer design and evaluation for the Fluidigm Access Array IFC system

We designed 345 target-specific primer pairs to cover all 316 coding exons and intron/exon boundaries of the genes NPHP1–NPHP13 (Suppl. Table 1). The maximum amplicon size was chosen as 300 bp, anticipating subsequent NGS bidirectional sequence reads of 150 bases from each side. Universal primer sequences 5′-ACACTGACGACA TGGTTCTACA-[target-specific forward]-3′ and 5′-TAC GGTAGCAGAGACTTGGTCT-[target-specific reverse]-3′ were added at the 5′ end to all target-specific forward and reverse primers, respectively.

Target DNA enrichment by Fluidigm 48.48 Access Array™ IFC system

Primers were pooled to generate 7-plex NPHP primer pools per PCR with a final concentration of 1 μM per primer. Every sample master mix solution contained 50 ng genomic DNA, 1× FastStart High Fidelity Reaction Buffer with MgCl₂, 5 % DMSO, dNTP (200 μM each), 1× Access Array™ loading reagent, and FastStart High Fidelity Enzyme Blend (Roche, Indianapolis, IN, USA). In one microfluidic 48.48 Access Array™, 48 different DNA samples and 48 different primer pools were applied. Subsequently, thermal cycling on a Fluidigm FC1 Cycler was performed. PCR products were then harvested as 48 separate amplicon pools using the IFC controller AX and transferred to a 96-well plate. In a separate PCR on a standard thermocycler, Illumina sequence-specific adaptors and sample barcodes were attached. Altogether, we processed 22 different Fluidigm 48.48-Access Arrays™ and divided all of the 1,056 patient-derived amplicon pools into batches of 144 unique barcodes/indices. The primer sequences required for bidirectional amplicon tagging (requiring 2 separate PCRs) compatible with Illumina NGS were as follows: PE1-CS1, 5′-AATGATACGGCGACCA CCGAGATCTACACTGACGACATGGTTCTACA-3′ and PE2-BC-CS2, 5′-CAAGCAGAAGACGGCATACGAGA T-[BARCODE]-TACGGTAGCAGAGACTTGGTCT-3′ as well as PE1-CS2, 5′AATGATACGGCGACCACCGA GATCTTACGGTAGCAGAGACTTGGTCT-3′, and PE2-BC-CS1, 5′-CAAGCAGAAGACGGCATACGAGAT-[BARCODE]-ACACTGACGACATGGTTCTACA-3′. Subsequently, 7 × 144 indexed samples and 1 × 48 indexed samples were pooled in order to allocate all 1,056 samples to 8 lanes of an Illumina next-generation sequencing instrument.

Next-generation resequencing on an Illumina GAIIx platform

Pooled and indexed PCR products were sequenced on 8 lanes of an Illumina GAIIx instrument as one 150 base run (v2.5 reagents) following standard Illumina protocols with the following modifications. In order to sequence the Fluidigm specific barcodes, we substituted the Illumina-specific index sequencing primer with a mixture of two custom Fluidigm-specific index primers (CS1rc, 5′-T+GT+AG+AACCATGTCGTCAGTGT-3′ and CS2rc, 5′-A+GAC+CA+AGTCTCTGCTACCGTA-3′). Modified oligos were ordered from Exiqon company (http://www.exiqon.com, Vedbaek, Denmark) with nucleotides preceded by a “+” representing LNA^® nucleotides. To decipher the full Fluidigm barcodes, we extended the index read length to 10 cycles. Finally, for a single 150 base Illumina sequence run, we equally mixed and applied Fluidigm custom primer CS1 (5′-A+CA+CTG+ACGACATGGTTCTACA-3′) and CS2 (5′-T+AC+GGT+AGCAGAGACTTGGTCT-3′).

Bioinformatics pipeline

Sequence reads were separated according to their barcodes using the CASAVA v1.7 demultiplex.dp script (Illumina) resulting in 30–40 million bases per barcode. Sequence reads were aligned for each barcode (patient) using CLC Genomics Workbench™ software (CLC-bio, Aarhus, Denmark) to a single reference sequence containing the concatenated genomic sequences of all 13 NPHP target genes (NPHP1–NPHP13). We annotated all donor and acceptor splice sites of all exons within that reference sequence. Variant calls were obtained using the following filter parameters: minimum central base quality = 20, minimum average quality = 15, variant frequency ≥ 20 %. A minimum variant count of 2 was applied for potential truncating mutations (nonsense, frameshift, and obligatory splice-site mutations). More stringent parameters were applied to non-synonymous missense variants with a minimum count of 10 and a PolyPhen2 score above 0.9. The rationale for choosing the variant frequency and count parameters has been previously described in detail (Halbritter et al. 2012). Synonymous variants and common dbSNP (v135) with a population allele frequency above 1 % were excluded. Variants were ranked by the criteria of whether mutations were likely to truncate the conceptual reading frame (nonsense, frameshift, and obligatory splice mutations). Missense variants were ranked by evolutionary conservation and using web-based programs (PolyPhen2, Mutation Taster, SIFT), predicting the impact on the encoded protein.

Sanger sequencing confirmation and segregation analysis

Variants/mutations detected by NGS and predicted to be detrimental were subsequently confirmed by Sanger sequencing using original DNA samples from the respective patients as PCR template. Whenever parental DNA was available, we performed segregation analysis. Polymerase chain reaction was performed using a touchdown protocol described previously (Otto et al. 2011). Sequencing was performed using BigDye^® Terminator v3.1 Cycle Sequencing Kit on an ABI 3730 XL sequencer (Applied Biosystems). Sequence traces were analyzed using Sequencher (version 4.8) software (Gene Codes Corporation, Ann Arbor, MI, USA).

Next-generation sequencing using the Illumina MiSeq Personal Sequencer

In patients with only a single confirmed heterozygous truncating or obligatory splice-site mutation, a standard PCR-amplification of all coding exons of the respective gene was performed. After barcoding the various patient-derived PCR-products, all samples were pooled and sequenced on an Illumina MiSeq Personal Sequencer instrument in one 2 × 151 bases paired-end run following the standard Illumina protocol with the following modifications. In order to sequence the Fluidigm-specific barcodes, we used the chemically modified CS1rc oligo (5′-T+GT+AG+AACCATGTCGTCAGTGT-3′). To sequence the forward and reverse paired-end reads, we used custom oligo CS1 (A+CA+CTG+ACGACATGGTTCTACA) and CS2 (T+AC+GGT+AGCAGAGACTTGGTCT), respectively. These oligos contain Locked Nucleic Acid^® (LNA^®) oligonucleotides, indicated with a plus sign in front of the modified base, and provide superior hybridization characteristics and enhanced biostability compared to conventional oligos. The LNA^® oligos were purchased from Exiqon (Vedbaek, Denmark).

Results

Illumina NGS and mapping statistics

We performed sequencing on 8 lanes of a GAIIx instrument after targeted amplification of 316 coding exons (345 amplicons) in 1,056 different indexed patients using the Fluidigm platform. The total output (8 lanes) was 204 million reads of 150 bases (25.5 million reads per lane) yielding an average of 193,000 reads per DNA sample. Using CLC Genomics Workbench™ software, we mapped an average of 177,000 (92 %) reads per patient to a human reference. Alignment resulted in mean exon coverage of 185×, with 70 % of the targeted coding regions covered at least fivefold and 66 % being covered tenfold. Insufficient coverage was found in 20 % of targeted exons randomly distributed across all genes investigated (Suppl. Table 1).

Variant filtering, validation, and parameter setting

Variant calling resulted in altogether 52,063 single nucleotide variant calls and 7,181 indels. We found a total of 26,534 known dbSNP135 (exonic and intronic) variants across the dataset derived from all 1,056 patients analyzed. As in our pilot project, we set a threshold of 20 % minimal allele frequency as a filter parameter and considered variants below this threshold as most likely “false positives” (Halbritter et al. 2012). Due to the low coverage, compared to our pilot project, we evaluated all truncating and obligatory splice-site variants with a count of at least 2. In contrast, missense variants were evaluated applying a cutoff parameter of ≥10 counts. Only missense variants with PolyPhen2 scores above 0.9 were further analyzed. In summary, filtering and ranking led to the selection of 315 potentially truncating mutations (including nonsense, frameshift, and obligatory splice-site mutations) and 80 missense variants/mutations for validation by standard Sanger sequencing. We were able to confirm 194 of the truncating mutations and 20 of the selected missense variants. In total, 214 out of 395 variants (specificity: 54 %) have been confirmed by Sanger sequencing.

Mutation detection in positive control samples

In order to calculate the sensitivity, we included 27 DNA samples with 44 known mutations as positive controls. Overall, only 27 out of these 44 mutations have been re-detected in the present study (“mutation” sensitivity 61 %). The low total coverage resulted in the detection of only one heterozygous mutation in some of these patients who knowingly carried a compound heterozygous mutation. When taking these patients into account, we were able to identify 20 out of 27 patients (“patient” sensitivity 74 %). Identified control samples are indicated as underlined in Table 2.

Table 2.

Genotypes and phenotypes of 127 families (142 patients) with mutations in NPHP1, INVS, NPHP3, NPHP4, IQCB1, CEP290, GLIS2, SDCCAG8, TMEM67, TTC21B, and WDR19

Patientc	Kidney ESRD age (years)	Extrarenal manifestations	Origin	Gene	Nucleotide changea (zygosity)	Amino acid change (segregation)	Mutation count/ coverage	PolyPhen2 scoreb	Reference
A867-21	11	OMA	Germany	NPHP1	c.84_87delTTCT (Horn)	p.S29Rfs*4	10/10	NA	Novel
A2527-21/22	19	No	UK	NPHP1	c.112G>T (hem)	p.E38*	7/7	NA	Novel
A2229-25	6	No	Arab	NPHP1	c.143G>A (Horn)	p.R48K (m)	31/31	0.99	Novel
A3244-21	17	No	Turkey	NPHP1	c.400G>T (Horn)	p.E134*	10/10	NA	Novel
A13-21	15	No	USA	NPHP1	c.555dupA (het)	p.P186Tfs*2 (p)	446/1,113d	NA	Caridi et al. (2006)
					c.1438-1G>A (het)	Splice site (m)	15/25	NA	Novel
A1754-21	>10	No	The Netherlands	NPHP1	c.1027G>A (Horn)	p.G343R	805/809	1.0	Caridi et al. (2006)
A2169-21	10	No	USA	NPHP1	c.1027G>A (Horn)	p.G343R	523/528	1.0	Caridi et al. (2006)
A3171-21	12	No	Germany	NPHP1	c.1027G>A (Horn)	p.G343R	575/579	1.0	Caridi et al. (2006)
A4618-21	>13	JBTS, Nystagmus, T1 DM	Germany	NPHP1	c.1027G>A (Horn)	p.G343R	816/820	1.0	Caridi et al. (2006)
A4840-21	12	No	Czech Republic	NPHP1	c.1057C>T (Horn)	p.Q353*	114/114	NA	Novel
A3484-21	9	No	Turkey	NPHP1	c.1252-1G>T (Horn)	Splice site	707/708	NA	Novel
A2369-21	12	No	Philippines	NPHP1	c.1298delA (Horn)	p.K433Sfs*55	998/1,010	NA	Novel
A661-21	17	No	Germany	NPHP1	c.1520+1delG (Horn)	Splice site	28/28	NA	Hildebrandt et al. (1997)
F430-22	25	No	Germany	NPHP1	c.1520+1delG (Horn)	Splice site (p)	25/25	NA	Hildebrandt et al. (1997)
F845-21	8	Ataxia	Germany	NPHP1	c.1520+1delG (Horn)	Splice site (m)	14/14	NA	Hildebrandt et al. (1997)
F1213-21	ND	ND	Germany	NPHP1	c.1520+1delG (Horn)	Splice site	27/27	NA	Hildebrandt et al. (1997)
A157-21	8	OMA	USA	NPHP1	c.1719delT (Horn)	p.I573Mfs*10	292/294	NA	Novel
A749-21	14	No	Turkey	NPHP1	c.1786_1787delGA (hem)	p.D596Qfs*8	265/274	NA	Novel
A232-21	22	OMA	USA	NPHP1	c.1884+1G>T (hem)	Splice site	973/977	NA	Otto et al. (2008a)
A2548-21	6	No	Turkey	NPHP1	c.1884+1G>A (Horn)	Splice site	919/923	NA	Otto et al. (2008a)
A3630-21	7	RD, deafness, CAKUT, microcephaly, JBTS, heart anomalies	India	NPHP1	c.1884+2T>C (Horn)	Splice site	743/749	NA	Novel
F1422-21	10	No	Turkey	NPHP1	c.2006delG (Horn)	p.R669Pfs*60	7/7	NA	Novel
A4432-21/22/23	20/12/16	No	Turkey	NPHP1	c.2153C>A (hem)	p.S718*	10/10	NA	Novel
A3483-21	13	No	Turkey	INVS	c.1417delG (het)	p.A473Qfs*37	321/646d	NA	Novel
					c.3125delA (het)	p.N1042Tfs*64	75/128	NA	Novel
F1433-21	10	No	Germany	INVS	c.2695C>T (het)	p.R899*	1,020/2,502d	NA	Otto et al. (2003)
					c.2782C>T (het)	p.R928*	41/58	NA	Novel
A4301-21	<1	LF	USA	NPHP3	c.406delA (het)	p.T136Rfs*13	819/1,546d	NA	Novel
					c.2570+lG>T (het)	Splice site	47/136	NA	Halbritter et al. (2012)
A3865-21	11	LF	Germany	NPHP3	c.518A>G (het)	p.K173R	658/1,278d	1.0	Novel
					c.2694-2_2694-ldelAG (het)	Splice site	5/14	NA	Bergmann et al. (2008)
A173-21	<1	HF, BDP	USA	NPHP3	c.537_542delAGAAAA (het)	p.K179_E180del (de novo)	3/5	NA	Halbritter et al. (2012)
					c.2570+lG>T (het)	Splice site (m)	154/349	NA	Halbritter et al. (2012)
A4040-22	<1	Cholangitis	Egypt	NPHP3	c.671-3C>G (Horn)	Splice site	51/51	NA	Novel
A1122-21	9	No	Austria	NPHP3	c.682C>T (het)	p.Q228*	71/145	NA	Novel
					c.3329+lG>A (het)	Splice site	29/83	NA	Novel
A633-21/22	<1	PFO	USA	NPHP3	c.1206delA (het)	p.V403Sfs*9 (m)	35/105	NA	Novel
					c.3003delT (het)	p.F1001Lfs*61 (p)	384/540	NA	Novel
F300-21	ND	ND	Germany	NPHP3	c.1304_1306delAAG (het)	p.E435del	276/563d	NA	Novel
					c.2104C>T (het)	p.R702*	587/1,197	NA	Simpson et al. (2009)
A4695-21	<1	Heart anomalies, HSM	USA	NPHP3	c.2369T>C (het)	p.L790P	75/138d	0.99	Novel
					c.2694-2_2694-ldelAG (het)	Splice site	17/28	NA	Bergmann et al. (2008)
A1444-21	<1	LF, heart anomalies	USA	NPHP3	c.2541delG (het)	p.K847Nfs*2	86/189	NA	Novel
					c.2570+lG>T (het)	Splice site	52/97	NA	Halbritter et al. (2012)
A2361-21	3	LF, hydrocephalus, recurrent subdural bleeding	Norway	NPHP3	c.2563C>T (het)	p.Q855* (p)	184/477	NA	Tory et al. (2009)
					c.3812+2dupT (het)	Splice site (m)	47/68	NA	Otto et al. (2008a)
F1215-21	>11	LF	Germany	NPHP3	c.2694-2_2694-ldelAG (het)	Splice site	24/45	NA	Bergmann et al. (2008)
					c.3020T>G (het)	p.L1007R	2,900/5,702d	1.0	Novel
A2425-21/22	<1	MKS	UK	NPHP3	c.2694-2_2694-ldelAG (het)	Splice site	21/45	NA	Bergmann et al. (2008)
					c.3619C>T (het)	p.R1207*	10/10	NA	Novel
A4405-21	16	No	USA	NPHP3	c.3133C>T (Horn)	p.Q1045*	193/194	NA	Novel
A3499-21	5	HSM	Turkey	NPHP3	c.3329+2T>G (Horn)	Splice site	87/87	NA	Novel
A3999-21/22	4/3	LF	USA	NPHP3	c.3466G>T (het)	p.E1156*	56/333	NA	Novel
					c.3570+5G>A (het)	Splice site	89/150	NA	Novel
A2225-21	<1	ID, LF	Turkey	NPHP3	c.3567_3568delAA (Horn)	p.K1189Nfs*5	107/192	NA	Halbritter et al. (2012)
A1451-21	2	No	Egypt	NPHP3	c.3812+lG>C (Horn)	Splice site (p,m)	47/47	NA	Halbritter et al. (2012)
A2393-21	25	RD	Italy	NPHP4	c.175C>T (Horn)	p.R59*	80/81	NA	Otto et al. (2008a)
A1539-21	18	Malformation of thoracic vertebrae	Canada	NPHP4	c.257_258delCG (het)	p.P86Lfs*6	23/57	NA	Novel
					c.3316-lG>C (het)	Splice site	150/277	NA	Novel
F1291-21	7	No	Germany	NPHP4	c.305delA (het)	p.N102Tfs*76	40/80	NA	Otto et al. (2011)
					c.1956-2A>G (het)	Splice site	39/83	NA	Novel
A137-21	9	No	USA	NPHP4	c.641delT (het)	p.I214Nfs*101	73/177	NA	Novel
					c.3920T>C (het)	p.L1307P	867/1,767d	1.0	Novel
A3285-21	8	No	Egypt	NPHP4	c.673G>A (Horn)	p.G225S	124/124	0.95	Novel
A3443-21	11	PD	Turkey	NPHP4	c.685C>T (Horn)	p.R229*	39/39	NA	Novel
A3165-21	15	RD	Germany	NPHP4	c.750dupC (het)	p.S251Lfs*6	92/177	NA	Novel
					c.3703C>G (het)	p.R1235G	946/1,909d	1.0	Novel
A4421-21	ND	No	Czech Republic	NPHP4	c.1082_1083dupAG (het)	p.Y362Sfs*45	485/1,193	NA	Novel
					c.3272delT (het)	p.V1091Gfs*31	1,945/4,662	NA	Mollet et al. (2002)
A4243-21/22	15/14	Dextrocardia	USA	NPHP4	c.1228C>T (het)	p.Q410*	124/319	NA	Novel
					c.3769_3772delACAG (het)	P.T1257*	433/872	NA	Novel
A647-21	17	No	USA	NPHP4	c.1271delA (het)	p.K424Rfs*7	44/69	NA	Novel
					c.3644+lG>T (het)	Splice site	1,137/1,752	NA	Novel
F10-21/22	14/8	No	Germany	NPHP4	c.1956-2A>G (het)	Splice site (p)	158/185	NA	Novel
					c.3773_3776delTGAG (het)	p.V1258Gfs*3 (m)	480/1,058	NA	Novel
A4021-21	12	No	Belgium	NPHP4	c.2001T>A (het)	P.Y667*	26/44	NA	Novel
					c.3196C>T (het)	p.Q1066*	35/78	NA	Novel
A3261-21	11	Gastroschisis	Australia	NPHP4	c.2011C>T (het)	p.Q671*	29/55	NA	Novel
					c.3272delT (het)	p.V1091Gfs*31	1,403/2,583	NA	Mollet et al. (2002)
A3411-35	7	No	Egypt	NPHP4	c.2044C>T (Horn)	p.R682*	85/85	NA	Mollet et al. (2002)
F824-21	16	No	Turkey	NPHP4	c.2145delG (Horn)	p.S716Lfs*6	83/83	NA	Novel
A3863-21	7	No	India	NPHP4	c.2265delC (Horn)	p.S756Pfs*12 (p,m)	272/277	NA	Novel
A3228-34	11	Ataxia	Egypt	NPHP4	c.2356dupG (Horn)	p.V786Gfs*5	21/24	NA	Novel
A2377-21	15	No	Italy	NPHP4	c.2511_2512delAG (het)	p.G838Lfs*2	177/828	NA	Novel
					c.3272delT (het)	p.V1091Gfs*31	1,447/3,746	NA	Mollet et al. (2002)
A1967-26	10	No	Egypt	NPHP4	c.2618dupA (Horn)	p.H873Qfs*14 (m)	194/195	NA	Chaki et al. (2011)
A1195-21	15	No	Sweden	NPHP4	c.3010dupA (het)	p.T1004Nfs*99	47/148	NA	Otto et al. (2008a)
					c.3866T>C (het)	p.L1289P (m)	1,047/2,03ld	1.0	Novel
A2265-21	11	No	Germany	NPHP4	c.3272delT (Horn)	p.V1091Gfs*31 (p,m)	3,047/3,107	NA	Mollet et al. (2002)
A3540-22	12	No	Egypt	NPHP4	c.3557delT (het)	p.V1186Gfs*ll	979/2,302	NA	Novel
					c.3773_3776delTGAG (het)	p.V1258Gfs*3	105/212	NA	Novel
A4031-21	20	RD	Germany	IQCBl	c.273dupT (het)	p.V92Cfs*15	9/18	NA	Novel
					c.1518_1519delCA (het)	p.H506Qfs*13	21/98	NA	Otto et al. (2005)
A3618-21	19	RD	UK	IQCBl	c.424_425delTT (Horn)	p.F142Pfs*5	16/21	NA	Otto et al. (2005)
A1973-22	13	RD	USA	IQCBl	c.424_425delTT (het)	p.F142Pfs*5	NA	NA	Otto et al. (2005)
					c.897_900dupCTTG (het)	p.I301Lfs*42 (m)	2/8	NA	Halbritter et al. (2012)
F62-21/22	>11/7	LCA, ID, LCA	Germany	IQCBl	c.424_425delTT (het)	p.F142Pfs*5 (m)	14/27	NA	Otto et al. (2005)
					c.1518_1519delCA (het)	p.H506Qfs*13 (p)	19/124	NA	Otto et al. (2005)
F849-21	51	RD	France	IQCBl	c.758delG (het)	p.C253Sfs*9	5/8	NA	Halbritter et al. (2012)
					c.1381C>T (het)	p.R461*	2/15	NA	Otto et al. (2005)
A1902-21	43	RD	Austria	IQCBl	c.825_828delACAG (het)	p.R275Sfs*6	NA	NA	Otto et al. (2005)
					c.1518_1519delCA (het)	p.H506Qfs*13	64/249	NA	Otto et al. (2005)
A4253-21	26	RD	Canada	IQCBl	c.897_900dupCTTG (Horn)	p.I301Lfs*42	34/37	NA	Halbritter et al. (2012)
F58-21/24	33/30	RD	The Netherlands	IQCBl	c.897_900dupCTTG (het)	p.I301Lfs*42	11/42	NA	Halbritter et al. (2012)
					c.1333C>T (het)	p.R445*	9/33	NA	Halbritter et al. (2012)
A3125-21	22	LCA, pituitary cysts	Canada	IQCBl	c.897_900dupCTTG (het)	p.I301Lfs*42	53/112	NA	Halbritter et al. (2012)
					c.1465C>T (het)	p.R489*	90/181	NA	Otto et al. (2008a)
A3084-21	13	RD	Germany	IQCBl	c.994C>T (het)	p.R332*	3/4	NA	Otto et al. (2005)
					c.1518_1519delCA (het)	p.H506Qfs*13	30/200	NA	Otto et al. (2005)
A3122-21	17	RD	USA	IQCBl	c.1465C>T (het)	p.R489*	84/113	NA	Otto et al. (2008a)
					c.1518_1519delCA (het)	p.H506Qfs*13	23/137	NA	Otto et al. (2005)
A3333-21	14	RD	Turkey	IQCBl	c.1504C>T (Horn)	p.R502*	72/73	NA	Estrada-Cuzcano et al. (2011)
A2227-21	15	RD, ASD	USA	IQCBl	c.1518_1519delCA (Horn)	p.H506Qfs*13	120/191	NA	Otto et al. (2005)
A4418-21	12	RD	Brazil	IQCBl	c.1518_1519delCA (Horn)	p.H506Qfs*13	32/70	NA	Otto et al. (2005)
A4606-21	>10	LCA	Germany	IQCBl	c.1518_1519delCA (Horn)	p.H506Qfs*13	63/142	NA	Otto et al. (2005)
F1150-21	7	RD	USA	IQCBl	c.1518_1519delCA (Horn)	p.H506Qfs*13	93/179	NA	Otto et al. (2005)
A3535-21	6	OMA, ID	Germany	CEP290	c.57_58delCC (het)	p.R20Sfs*7	NA	NA	Novel
					c.828delA (het)	p.E277Kfs*16	45/92	NA	Novel
A1664-21	13	RD	Canada	CEP290	c.95T>C (het)	p.L32S	12/32	0.617	Halbritter et al. (2012)
					c.5226+5_5226+8delGTAA (het)	Splice site	19/43	NA	Novel
A4638-21	8	RD	USA	CEP290	c.164_167delCTCA (het)	p.T55Sfs*3	36/91	NA	Helou et al. (2007)
					c.6072C>A (het)	P.Y2024*	9/16	NA	Brancati et al. (2007)
F641-21/22	ND<33	JBTS	Greece	CEP290	c.164_167delCTCA (het)	p.T55Sfs*3 (p)	82/217	NA	Helou et al. (2007)
					c.7320_7321delCT (het)	p.L2441Rfs*14 (m)	592/1,167d	NA	Novel
A2-21	6	RD, LCA	Australia	CEP290	c.270_274delAGTAA (het)	p.K90Nfs*6	90/186d	NA	Novel
					c.6277delG (het)	p.V2093Sfs*4 (m)	49/92	NA	Brancati et al. (2007)
A4460-21	9	Dandy-Walker malformation, RD	Egypt	CEP290	c.1606C>T (Horn)	p.Q536*	28/28	NA	Novel
A2818-21	1	LF, ID, nystagmus, strabismus	Canada	CEP290	c.1936C>T (het)	p.Q646*	27/55	NA	Perrault et al. (2007)
					c.4723A>T (het)	P.K1575*	NA	NA	Perrault et al. (2007)
F283-21	17	RD	Germany	CEP290	c.1984C>T het)	p.Q662*	55/163	NA	Baala et al. (2007)
					c.4723A>T (het)	P.K1575*	365/736d	NA	Perrault et al. (2007)
A3100-21	16	ID, RD	Slovenia	CEP290	c.1987A>T (het)	P.K663*	82/179	NA	Halbritter et al. (2012)
					c.4723A>T (het)	P.K1575*	183/336d	NA	Perrault et al. (2007)
A2422-21/22	<1	MKS	Germany/France	CEP290	c.2251C>T (het)	p.R751*	16/53	NA	Tory et al. (2009)
					c.4864_4865delinsT (het)	p.R1622Ffs*9	3/3	NA	Novel
A3493-21	1	ID, CVH	Turkey	CEP290	c.2457_2458delAA (het)	p.S820Ffs*4	46/99d	NA	Novel
					c.5722G>T (het)	P.E1908*	13/21	NA	Brancati et al. (2007)
F335-22	10	RD, LCA	Saudi-Arabia	CEP290	c.2915T>C (Horn)	p.L972P	38/38	1.0	Otto et al. (2011)
F91-21	10	RD, JBTS	Germany	CEP290	c.3175dupA (het)	p.I1059Nfs*ll	19/47	NA	Sayer et al. (2006)
					c.6331C>T (het)	p.Q2111*	10/16	NA	Sayer et al. (2006)
A4663-21	5	RD, ID	Egypt	CEP290	c.3572delA (het)	p.Q1191Rfs*22	26/37	NA	Novel
					c.4792_4795delAAAT (het)	p.K1598Sfs*8	149/288d	NA	Novel
A1210-21	22	RD	Germany	CEP290	c.3802C>T (het)	p.Q1268* (m)	54/106	NA	Halbritter et al. (2012)
					c.4723A>T (het)	P.K1575*	586/l,109d	NA	Perrault et al. (2007)
F891-21	5	Dandy-Walker malformation	Germany	CEP290	c.4144delT (het)	p.Y1382Mfs*37	7/20	NA	Novel
					c.6277delG (het)	p.V2093Sfs*4	40/85	NA	Brancati et al. (2007)
F118-21	>10	RD	Austria	CEP290	c.4452_4455delAGAA (het)	p.K1484Nfs*4	NA	NA	Halbritter et al. (2012)
					c.4723A>T (het)	P.K1575*	422/760d	NA	Perrault et al. (2007)
F351-21	ND	RD	Germany	CEP290	c.5182G>T (het)	P.E1728*	NA	NA	Otto et al. (2011)
					c.6277delG (het)	p.V2093Sfs*4	47/47	NA	Brancati et al. (2007)
A1048-21	ND	ND	Turkey	CEP290	c.5714delC (Horn)	p.A1905Vfs*5	15/15	NA	Novel
A1413-22	>3 mo	ID, JBTS, pituitary cysts,	Germany	CEP290	c.5714delC (Horn)	p.A1905Vfs*5 (p,m)	7/7	NA	Novel
A1924-21	15	No	Turkey	GLIS2	c.523T>C (Horn)	p.C175R	368/368	1.0	Novel
F99-21	17	RD	Germany	SDCCAG8	c.679A>T (het)	P.K227* (p)	38/55	NA	Otto et al. (2010)
					c.784G>T (het)	P.E262* (m)	41/58	NA	Novel
A3945-21	5	No	Turkey	SDCCAG8	c.696T>G (Horn)	P.Y232*	5/5	NA	Otto et al. (2010)
A4665-21	>15	RD, PCO, HM	USA	SDCCAG8	c.1444delA (Horn)	p.T482Lfs*12	16/16	NA	Otto et al. (2010)
A4313-21	6	JBTS	UK	TMEM67	c.407-2A>G (het)	Splice site	17/38	NA	Novel
					c.1918G>A (het)	p.D640N	56/163d	1.0	Novel
A2431-21/22	<1	MKS	UK	TMEM67	c.579_580delAG (het)	p.G195Ifs*13	3/3	NA	Brancati et al. (2009)
					c.622A>T (het)	p.R208*	9/18	NA	Khaddour et al. (2007)
A4485-21	4	JBTS, heart anomalies (VSD), VUR	Poland	TMEM67	c.579_580delAG (het)	p.G195Ifs*13	44/89d	NA	Brancati et al. (2009)
					c.1843T>C (het)	p.C615R	18/34	0.98	Tallila et al. (2009)
F1431-21	<1	JBTS	Germany	TMEM67	c.622A>T (het)	p.R208*	4/8	NA	Khaddour et al. (2007)
					c.1538A>G (het)	p.Y513C	22/42d	1.0	Novel
A382-21	ND	RD	Italy	TMEM67	c.622A>T (het)	p.R208*	4/7	NA	Khaddour et al. (2007)
					c.1289A>G (het)	p.D430G	16/24	0	Halbritter et al. (2012)
F912-21	20	LF, Morning glory papillary	Germany	TMEM67	c.622A>T (het)	p.R208*	2/3	NA	Khaddour et al. (2007)
					c.2498T>C (het)	P.I833T	121/279d	0.97	Brancati et al. (2009)
A4019-21	6	LF	Australia	TMEM67	c.726T>G (het)	P.N242K	1,526/3,016d	1.0	Novel
					c.1843T>C (het)	p.C615R	13/24	0.98	Tallila et al. (2009)
A3473-21	ND	JBTS, LF	UK	TMEM67	c.755T>C (het)	P.M252T (p)	24/65	0.38	Khaddour et al. (2007)
					c.2498T>C (het)	P.I833T (m)	152/285d	0.97	Brancati et al. (2009)
F631-21	<21	JBTS, LF	Germany	TMEM67	c.1046T>C (het)	p.L349S	694/1,265	0.95	Khaddour et al. (2007)
					c.1843T>C (het)	p.C615R (p)	6/14	0.98	Tallila et al. (2009)
A3858-21	>7	LF, Nystagmus	Czech	TMEM67	c.1815_1831del17 (het)	p.Q605Hfs*17 (m)	NA	NA	Novel
			Republic		c.1843T>C (het)	p.C615R (p)	13/13	0.98	Tallila et al. (2009)
A3187-21	10	HSM	USA	TMEM67	c.1843T>C (Horn)	p.C615R	20/20	0.98	Tallila et al. (2009)
A4439-21	14	HSM	Czech Republic	TMEM67	c.1843T>C (Horn)	p.C615R	26/26	0.98	Tallila et al. (2009)
F529-21	<10	No	Germany	TMEM67	c.1843T>C (Horn)	p.C615R	26/26	0.98	Tallila et al. (2009)
A3669-21	9	RD	Poland	TMEM67	c.1843T>C (het)	p.C615R (m)	6/12	0.98	Tallila et al. (2009)
					c.2345A>G (het)	p.H782R (p)	3/5	0.96	Brancati et al. (2009)
A3260-21	3	SI, polysplenia, GIT malformation, PD	USA	TTC21B	c.264_267dupTAGA (Horn)	p.E90*	35/37	NA	Novel
A999-21	2	LF	Germany	TTC21B	c.626C>T (het)	p.P209L	2,898/5,811d	1.0	Davis et al. (2011)
					c.1240G>T (het)	P.E414*	3/3	NA	Novel
A4291-21	3	LF, cone-shaped epiphysis (hands/feet)	USA	TTC21B	c.626C>T (het)	p.P209L	2,608/5,486d	1.0	Davis et al. (2011)
					c.2868+lG>T (het)	Splice site	471/853	NA	Novel
A1065-21	10	SI, Hepatopathy	Germany	TTC21B	c.626C>T (het)	p.P209L	52/113	1.0	Davis et al. (2011)
					c.3923A>G (het)	p.D1308G	36/68	1.0	Novel
A3511-21/22	>8	Chondrodysplasia, Bell’s palsy, hypertension	UK	TTC21B	c.1231C>T (het)	p.R411*	3/3	NA	Davis et al. (2011)
					c.1445dupA (het)	p.T483Dfs*25	30/93	NA	Novel
F1229-21	17	RD	Spain	WDR19	c.641dupT (het)	p.L214Ffs*5	64/200	NA	Novel
					c.1477G>C (het)	p.D493H	183/383d	0.99	Novel
A2556-21/22	5	Caroli disease	Egypt	WDR19	c.682C>T (het)	p.Q228*	71/108	NA	Novel
					c.3703G>A (het)	P.E1235K	1,125/2,262d	1.0	Novel
A4436-22	<1	PD, Caroli disease, RD	Oman	WDR19	c.3533G>A (Horn)	p.R1178Q	294/296	1.0	Novel
A3241-21	<1	Cortical blindness, pancreatic cysts, hepatic cysts	USA	WDR19	c.3533G>A (het)	p.R1178Q	2,701/5,319d	1.0	Novel
					c.3565+lG>A (het)	Splice site	22/48	NA	Novel

Mutation numbering is based on cDNA position according to reference sequences of NPHP1 (NM_000272.3), INVS (NM_014425.2), NPHP3 (NM_153240.4), NPHP4 (NM_015102.3), IQCB1 (NM_001023570.2), CEP290 (NM_025114.3), GLIS2 (NM_032575.2), SDCCAG8 (NM_006642.3), TMEM67 (NM_153704.5), TTC21B (NM_024753.4) and WDR19 (NM_025132.3) with +1 corresponding to the A of the ATG translation initiation codon

ASD atrial septal defect, BDP bilary ductal proliferation, CAKUT congenital anomalies of the kidney and urinary tract, CVH cerebellar vermis hypoplasia, ESRD end-stage renal disease, GIT gastrointestinal tract, (het) heterozygous mutation, (Hom) homozygous mutation, HM hepatomegaly, HSM hepato-splenomegaly, ID intellectual disability, JBTS Joubert syndrome, LCA Leber congenital amaurosis, LF liver fibrosis, (m) maternal heterozygous mutation, MKS Meckel–Gruber syndrome, NA not applicable, ND no data available, OMA ocular motor apraxia, (p) paternal heterozygous mutation, PCO polycystic ovaries, PD polydactyly, PFO patent foramen ovale, RD retinal dystrophy, SI situs inversus, T1 DM type 1 diabetes mellitus, VSD ventricular septal defect, VUR vesicoureteral reflux

^aAll mutations were absent from at least 192 healthy control subjects

^bPolyPhen-2 scores above 0.9 are predicted to be disease causing

^cSamples found in pilot run and included as positive controls are underlined

^dSamples sequenced on Illumina MiSeq Personal Sequencer

Identification of mutations in a cohort of 1,056 individuals

Combination of high-throughput multiplex-PCR and bar-coded subsequent NGS in a worldwide cohort of 1,056 independent patients revealed the molecular diagnosis in 90 patients. Furthermore, one single heterozygous truncating mutation was found in 68 additional patients. In order to screen for a potential second mutated allele, standard amplification of all coding exons of the respective gene and barcoded consecutive NGS on an Illumina MiSeq Personal Sequencer System was conducted. Using this approach, a second mutated allele could be identified in 36 of those 68 patients. Due to low DNA quality, sequencing on the MiSeq failed for seven samples. However, after Sanger sequencing, one additional patient with a second heterozygous mutation was detected.

In summary, high-throughput mutation analysis led to the molecular diagnosis in 127 (90 + 36 + 1) out of 1,056 (12.0 %) independent NPHP-RC patients. Segregation analysis in multiplex families resulted in the identification of causative mutations in an additional 15 affected siblings. A molecular genetic diagnosis has been obtained in 142 patients derived from 127 families who carried mutations on both alleles. Recessive mutations have been identified in the following genes: NPHP1 (26 patients/23 families), INVS/NPHP2 (2 patients/2 families), NPHP3 (20 patients/17 families), NPHP4 (24 patients/22 families), IQCB1/NPHP5 (18 patients/16 families), CEP290/NPHP6 (22 patients/20 families), GLIS2/NPHP7 (1 patient/1 family), SDCCAG8/NPHP10 (3 patients/3 families), TMEM67/NPHP11 (15 patients/14 families), TTC21B/NPHP12 (6 patients/5 families), and WDR19/NPHP13 (5 patients/4 families) (Table 2). No causative mutation was identified in the gene NEK8/NPHP9 for which only four mutations have been reported to date (Otto et al. 2008b; Frank et al. 2013). Overall, we identified 51 independent individuals with homozygous mutations, 4 individuals with hemizygous mutations (all in NPHP1), and 72 individuals with compound heterozygous mutations. In 93 patients, truncating mutations (nonsense, frameshift or obligatory splice-site mutations) were found on both alleles, whereas 18 patients carried one truncating mutation in combination with a non-synonymous missense mutation. The remaining 16 patients exhibited missense mutations only.

After evaluation of all coding regions and intron/exon boundaries in the respective genes, 31 patients remained with only one heterozygous truncating mutation (Table 3).

Table 3.

31 single heterozygous truncating or obligatory splice variants in 31 different patients in NPHP1, INVS, NPHP3, NPHP4, IQCB1, CEP290, RPGRIP1L, SDCCAG8, TMEM67, TTC21B and WDR19

Patientc	Kidney ESRD (yrs)	Extrarenal manifestations	Origin	Gene	Nucleotide changea (zygosity)	Amino acid change (segregation)		Mutation count/coverage	EVS (exome variant server)	Reference
F1369-21#	>16	No	Germany	NPHP1	c.1274dupT (het)	p.R426Qfs*7		573/701	NA	Novel
A903-21	16	Pulmonary stenosis, microcephaly, LF	Turkey	INVS	c.465G>A (het)	p.W155*		93/209	NA	Novel
A1936-22	12	Nystagmus	Candada	INVS	c.1078+1G>A (het)	Splice site		28/44	A= 1 G = 13,005	Novel
F964-21	ND	ND	Germany	INVS	c.2069-1G>T (het)	Splice site		58/84	NA	Novel
A10-21	ND	ND	France	INVS	c.2908delG (het)	p.E970Nfs*2		116/231	NA	Otto et al. (2003)
F1135-21	>14	OMA, JBTS	Germany	NPHP3	c.2104C>T (het)	p.R702*		585/1,230	NA	Simpson et al. (2009)
A918-21	<1	Neonatal hepatitis	Turkey	NPHP3	c.2570+lG>T (het)	Splice site		139/304	NA	Halbritter et al. (2012)
A3865-21	11	LF	Germany	NPHP3	c.2694-2_2694-ldelAG (het)	Splice site		5/14	NA	Bergmann et al. (2008)
A4419-12	2	ID	USA	NPHP3	c.2694-2_2694-ldelAG (het)	Splice site		8/15	NA	Bergmann et al. (2008)
A3843-21	>10	No	USA	NPHP4	c.133C>T (het)	p.Q45*		162/287	T= 1 C = 12,485	Novel
A165-21	11	Developmental delay	Canada	NPHP4	c.517C>T (het)	p.Q173*		669/1,497	NA	Novel
A385-21	ND	RD	Germany	NPHP4	c.1956-2A>G (het)	Splice site		21/48	NA	Novel
F1348-21	12	RD	Germany	NPHP4	c.1956-2A>G (het)	Splice site		90/138	NA	Novel
A821-21	>1	No	Germany	IQCB1	c.1632_1638dupTGTGGCA (het)	p.A547Cfs*31		19/22	NA	Novel
F1051-21	>5	No	Sweden	CEP290	c.1992delT (het)	p.P665Lfs*10		56/107	NA	Perrault et al. (2007)
F1386-23	14	Dental and skeletal malformations	Poland	CEP290	c.1992delT (het)	p.P665Lfs*10		114/190	NA	Perrault et al. (2007)
F122-22	7	JBTS	Germany	CEP290	c.2249T>G (het)	p.L750*		13/18	NA	Den Hollander et al. (2006)
F417-22	25	LF	Germany	CEP290	c.3175dupA (het)	p.I1059Nfs*ll		56/182	NA	Sayer et al. (2006)
A711-21	ND	LCA	Canada	CEP290	c.4966G>T (het)	P.E1656*		285/539	NA	Den Hollander et al. (2006)
A2615-21	>1	JBTS	Germany	CEP290	c.6277delG (het)	p.V2093Sfs*4		29/69	NA	Brancati et al. (2007)
A2156-21	ND	PD, microcephaly, VUR	USA	RPGRIP1L	c.1700-1G>A (het)	Splice site	Sanger		NA	Novel
A963-21	12	RD	Spain	SDCCAG8	c.1420delG (het)	p.E474Sfs*20	18/46		NA	Otto et al. (2010)
A1010-21	>10	HMSN type 1	Germany	TMEM67	c.622A>T (het)	p.R208*	Sanger		T= 1 A = 13,005	Khaddour et al. (2007)
F128-21	ND	JBTS	Germany	TMEM67	c.622A>T (het)	p.R208*	14/22		T= 1 A = 13,005	Khaddour et al. (2007)
F1392-21	>10	No	Germany	TMEM67	c.622A>T (het)	p.R208*	8/12		T= 1 A = 13,005	Khaddour et al. (2007)
F1307-21	>1	ND	Germany	TMEM67	c.1774-1G>A (het)	Splice site	21/54		NA	Novel
F1369-21#	16	No	Germany	TTC21B	c.93delG (het)	p.R32Gfs*17	56/164		NA	Novel
A4609-21	>19	No	Taiwan	TTC21B	c.264_267dupTAGA (het)	p.E90*	12/39		NA	Novel
F889-21	12	RD	Turkey	WDR19	c.407-2A>G (het)	Splice site	125/364		NA	Novel
F754-22	>7	No	USA	WDR19	c.781dupA (het)	p.T261Nfs*13	15/27		NA	Novel
A4395-21/22	5	JATD	USA	WDR19	c.781dupA (het)	p.T261Nfs*13	6/13		NA	Novel

Mutation numbering is based on cDNA position according to reference sequences of NPHP1 (NM_000272.3), INVS (NM_014425.2), NPHP3 (NM_153240.4), NPHP4 (015102.3), IQCB1 (NM_001023570.2), CEP290 (NM_025114.3), GLIS2 (NM_032575.2), RPGRIP1L (NM_015272.2), SDCCAG8 (NM_006642.3), TMEM67 (NM_153704.5), TTC21B (NM_024753.4) and WDR19 (NM_025132.3) with +1 corresponding to the A of the ATG translation initiation codon

ESRD end-stage renal disease, (het) heterozygous mutation, HMSN hereditary motor and sensory neuropathy, ID intellectual disability, JATD Jeune asphyxiating thoracic dystrophy, JBTS Joubert syndrome, LCA Leber congenital amaurosis, LF liver fibrosis, NA not applicable, ND no data available, OMA ocular motor apraxia, PD polydactyly, RD retinal dystrophy, VUR vesicoureteral reflux

^aAll mutations were absent from at least 192 healthy control subjects

^bPolyphen 2 scores >0.9 are predicted to be disease causing

^cSamples found in pilot run and included as positive controls are underlined

^#Note that F1369-21 has one variant in two different genes

In total, we discovered 99 novel pathogenic mutations in the genes NPHP1 (14), INVS/NPHP2 (6), NPHP3 (16), NPHP4 (26), IQCB1/NPHP5 (2), CEP290/NPHP6 (12), GLIS2/NPHP7 (1), RPGRIP1L/NPHP8 (1), SDCCAG8/NPHP10 (1), TMEM67/NPHP11 (6), TTC21B/NPHP12 (6), and WDR19/NPHP13 (8). These mutations add an additional 20 % to the previously reported 492 mutations in the genes NPHP1–NPHP13, according to the HGMD^®-Professional mutation database “Biobase” (September 28th 2012 release) (Table 4).

Table 4.

Novel mutations found in this study compared with previously reported mutations (HGMD^®-Professional “Biobase”) in the genes NPHP1–NPHP13

Gene	Biobase (# mut)	Novel (# mut)	Percent added
NPHP1	27	14	52
INVS/NPHP2	20	6	30
NPHP3	31	16	52
NPHP4	59	26	44
IQCB1/NPHP5	21	2	10
CEP290/NPHP6	146	12	8
GLIS2/NPHP7	1	1	100
RPGRIP1L/NPHP8	31	1	3
NEK8/NPHP9	4	–	–
SDCCAG8/NPHP10	13	1	8
TMEM67/NPHP11	102	6	6
TTC21B/NPHP12	33	6	18
WDR19/NPHP13	5	8	160
Total	493	99	20

Discussion

High-throughput mutation analysis of 13 NPHP genes in a large worldwide cohort of 1,056 patients using the Fluidigm/NGS system led to the identification of the causative mutations in 127 different families with 142 affected individuals with NPHP-RC. In addition, we detected single heterozygous truncating mutations, which do not fully explain the phenotype in a recessive disease in 31 patients. Individuals with mutations in NPHP1 (23), NPHP4 (22), CEP290/NPHP6 (20), NPHP3 (17) and IQCB1/NPHP5 (16) were the most frequent findings. Combined with previous studies and the results of the homozygous NPHP1 deletion analysis, which has been applied to every affected individual in our cohort of 1,540 families, we hereby obtain a representative frequency distribution of genes implicated in NPHP-RC with 63.8 % of cases remaining still unsolved (Fig. 1). By identifying 99 novel mutations, our study generated the largest number of previously unreported mutations in patients with a NPHP-RC phenotype, adding an additional 20 % to publicly available databases.

Fig. 1.

a Distribution of established molecular NPHP-diagnoses for the genes NPHP1–NPHP13 detected previously in our total cohort of 1,540 individuals (in blue) and in the subset of patients identified within the present study (in red). All affected individuals were screened for the presence of a homozygous NPHP1 deletion prior to being entered into the present study. b Percentage of patients with a molecular diagnosis versus patients without a molecular diagnosis in our total cohort of 1,540 NPHP-RC patients (left). Distribution of molecular diagnoses across the genes NPHP1–NPHP13 (right) (color figure online)

In contrast to previously reported phenotypical findings, it is noteworthy that two patients with truncating mutations in INVS/NPHP2 did not present as infants and did not exhibit extrarenal manifestations. Another striking observation is that NPHP3 represents the most common gene implicated in infantile NPHP in this study. Remarkably, two patients with homozygous WDR19 mutations additionally displayed Caroli disease, a rare inherited disorder characterized by dilatation of the intrahepatic bile ducts.

In GLIS2/NPHP7, only one homozygous splice-site mutation (c.755+1G>T) has been published to date (Attanasio et al. 2007). We hereby report the second mutation, an evolutionary highly conserved (Drosophila melanogaster) homozygous missense mutation, located at the first nucleotide of exon 4, potentially affecting the splicing of the respective exon (c.523T>C, p.C175R). Similarly, in WDR19/NPHP13 we added an additional eight mutations to the five currently known (Table 4). Interestingly, in this project we have not found any indication for the presence of oligogenicity in NPHP unlike described earlier (Hoefele et al. 2007). Except for one (F1369, Table 3), none of the patients showed truncating mutations in more than one NPHP gene. Still, we cannot exclude oligogenicity for those patients with only one truncating mutation detected. To address the oligogenicity hypothesis, one might have to analyze even more genes in parallel, take missense alleles into account, and compare with the results derived from an ethnically matched cohort of healthy individuals.

Regarding the 31 patients with only one heterozygous truncating mutation, one has to consider the possibility that some of these truncating mutations, although rare, might have been found by chance in concordance with the frequency seen in the general population. Using the data derived from about 6,500 individuals deposited in the Exome Variant Server database (EVS, http://evs.gs. washington.edu/EVS/), we previously calculated that 10 heterozygous deleterious truncating mutations within an NPHP gene is expected to be present by chance in a cohort of 1,000 individuals (Halbritter et al. 2012). Interestingly, four out of the above mentioned 31 patients indeed do carry rare truncating variants listed in the EVS server.

There are multiple reasons why we did not detect mutations in about 900 patients. First, in comparison with our pilot project, the mutation detection sensitivity was substantially lower (Halbritter et al. 2012). In the current study, NGS was performed on a GAIIx instead of a HiSeq2000, resulting in fewer reads per lane, significantly lower mean exon-coverage, and thus lower sensitivity. We estimate that we therefore might have overlooked about 10 % of patients with exonic mutations. Second, many disease causing mutations are not exonic and therefore not detectable with our exon-resequencing method. Third, some patients in our cohort might have been misdiagnosed with NPHP but suffer from other cystic kidney diseases like autosomal recessive polycystic kidney disease (ARPKD). Fourth, some of the cases might be explained by disease causing mutations implicated in JBTS or MKS that were not part of the present study such as AHI1, ARL13B, CC2D2A, INPP5E, TCTN1-3, MKS1. Nevertheless, the high number of still “unsolved” cases indicates that additional extensive heterogeneity in NPHP-RC is likely.

To improve the method, in subsequent projects we have begun testing bidirectional sequencing of 150 bp reads on a HiSeq2000. As a consequence, we are able to increase the sequence output from 25.5 million reads up to 200–300 million reads per lane.

Identification of the remaining unknown genes in genetically heterogeneous diseases like nephronophthisis and other ciliopathies still represents a major challenge. Discovery of these genes can be achieved by applying high-throughput methods like whole exome/genome sequencing (WES/WGS). The Fluidigm/NGS approach is an affordable method to screen large cohorts for a predefined set of genes and should be considered before applying WES/WGS.

In summary, we successfully introduced the use of a high-throughput mutation analysis in a large NPHP-RC cohort and were able to detect the largest number of novel mutations in a single experiment. Further method optimizations will lead to a higher sensitivity and specificity and will enable rapid screening of large cohorts in an efficient and streamlined way.

Appendix

Contributing members of the GPN study group are listed as follows: F Yalcinkaya (Ankara, Turkey); S Bakkaloglu (Ankara, Turkey); F Ozaltin (Ankara, Turkey); E Comak (Antalya, Turkey); F Krull (Aurich, Germany); Schmitz-Hübner (Bad Oeynhausen, Germany); H Rupprecht (Bayreuth, Germany); D Muller (Berlin, Germany); P Dahlem (Coburg, Germany); B Hoppe (Cologne, Germany); M Wolfe (Cologne, Germany); M Weber (Cologne, Germany); U Vester (Essen, Germany); K Bonzel (Essen, Germany); J Nikolay (Furth, Germany); I Hansmann (Halle, Germany); M Wiefel (Hamburg, Germany); U Orth (Hamburg, Germany); H Pfleiderer (Hamm, Germany); L Pape (Hannover, Germany); Morlot (Hannover, Germany); J Ehrich (Hannover, Germany); B Tonshoff (Heidelberg, Germany); F Schindera (Karlsruhe, Germany); J Hoefele (Martinsried, Germany); M Griebel (Munich, Germany); E Broeking (Münster, Germany); M Konrad (Münster, Germany); M Radke (Potsdam, Germany); M Brandis (Ravensburg, Germany); A Kirchhoff (Wurzburg, Germany); V Feygina (Brooklyn, NY, USA); J Springate (Buffalo, NY, USA); S Ahmadzdeh (Burlington, VT, USA); D Gipson (Chapel Hill, NC, USA); A Becker (Dallas, TX, USA); V Dharnidharka (Gainesville, FL, USA); P Mark (Grand Rapids, MI, USA); P Srivaths (Houston, TX, USA); A Wilson (Indianapolis, IN, USA); E Kamil (Los Angeles, CA, USA); S Why (Milwaukee, WI, USA); C Pan (Milwaukee, WI, USA); C Kashtan (Minneapolis, MN, USA); C D’Alessandri (New Haven, CT, USA); H Trachtman (Ney York city, NY, USA); B Kaplan (Philadelphia, PA, USA); M Joseph (Phoenix, AZ, USA); R Weiss (Valhalla, NY, USA); S Thomas (Ann Arbor, MI, USA); L Newberry (Aurora, CO, USA); M Koyun (Cairo, Egypt); H Fathy (Alexandria, Egypt); A Rybi—Szuminska (Bialystok, Poland); M Szczepanska (Zabrze, Poland); Z Dolezel (Brno, Czech Republic); M Malina (Prague, Czech Republic); T Seeman (Prague, Czech Republic); T Honzik (Prague, Czech Republic); P Ferreira (Calgary, Canada); M Ferguson (Halifax, Canada); E Harvey (Toronto, Canada); K Chong (Toronto, Canada); R Sandford (Cambridge, UK); D Josifova (London, UK); D Bockenhauer (London, UK); J Sayer (Newcastle upon Tyne, UK); C Johnson (Yorkshire, UK); P Senguttuvan (Chennai, India); I Pela (Firenze, Italy); N Knops (Leuven, Belgium); T Levart (Ljubljana, Slovenia); T Neuhaus (Luzern, Switzerland); C Ayuso (Madrid, Spain); A Kindi (Muscat, Sultanate of Oman); N Knoers (Nijmegen, The Netherlands); C Antignac (Paris, France); W Radauer (Salzburg, Austria); C Genzani (Sao Paulo, Brazil); U Berg (Stockhom, Sweden); C Klingenberg (Tromsø, Norway); C Jones (Victoria, Australia); R Savarirayan (Victoria, Australia); J Kausman (Victoria, Australia).