Molybdenum-Containing Nicotine Hydroxylase Genes in a Nicotine Degradation Pathway That Is a Variant of the Pyridine and Pyrrolidine Pathways

Abstract

Ochrobactrum sp. strain SJY1 utilizes nicotine as a sole source of carbon, nitrogen, and energy via a variant of the pyridine and pyrrolidine pathways (the VPP pathway). Several strains and genes involved in the VPP pathway have recently been reported; however, the first catalyzing step for enzymatic turnover of nicotine is still unclear. In this study, a nicotine hydroxylase for the initial hydroxylation step of nicotine degradation was identified and characterized. The nicotine hydroxylase (VppA), which converts nicotine to 6-hydroxynicotine in the strain SJY1, is encoded by two open reading frames (vppA_S and vppA_L [subunits S and L, respectively]). The vppA genes were heterologously expressed in the non-nicotine-degrading strains Escherichia coli DH5α and Pseudomonas putida KT2440; only the Pseudomonas strain acquired the ability to degrade nicotine. The small subunit of VppA contained a [2Fe-2S] cluster-binding domain, and the large subunit of VppA contained a molybdenum cofactor-binding domain; however, an FAD-binding domain was not found in VppA. Resting cells cultivated in a molybdenum-deficient medium had low nicotine transformation activity, and excess molybdenum was detected in the purified VppA by inductively coupled plasma-mass spectrometry analysis. Thus, it is demonstrated that VppA is a two-component molybdenum-containing hydroxylase.

INTRODUCTION

Nicotine is the main toxic compound in tobacco, and it accumulates with tobacco wastes during the processing of tobacco products. Nicotine can easily spread into the environment due to its water solubility and endanger the health of humans and other organisms (1). Microbial biodegradation is one of the best remediation strategies to remove nicotine from the environment (2–4). A number of bacteria and fungi which use nicotine as a sole source of carbon, nitrogen, and energy for their growth have been isolated and identified (3, 4). Three nicotine degradation pathways have been proposed in bacteria based on the identification of intermediates: the pyridine pathway (3), the pyrrolidine pathway (2, 5), and the variant of pyridine and pyrrolidine pathways (the VPP pathway) (Fig. 1) (6–9). The molecular mechanisms of nicotine degradation by the pyridine pathway and the pyrrolidine pathway have been elucidated in detail by the research groups of Brandsch (3) and Xu et al. (2, 10, 11), respectively. However, the genes involved in several catalyzing steps of the VPP pathway are still unknown.

FIG 1.

The pyridine pathway, VPP pathway, and pyrrolidine pathway of nicotine degradation in bacteria. The pyridine pathway is shown in the light green portion at the top, and the enzymes reported in Arthrobacter nicotinovorans are indicated by green text. The VPP pathway is shown in the light pink portion in the middle, and the enzymes reported in Ocrobactrum sp. SJY1 are indicated by red text. The pyrrolidine pathway is shown in the light blue portion at the bottom, and the enzymes reported in Pseudomonas putida S16 are indicated by blue text.

Thus far, several bacteria that are able to degrade nicotine via the VPP pathway have been reported, including Ochrobactrum sp. strain SJY1 (6, 7), Agrobacterium tumefaciens S33 (12), Shinella sp. strain HZN7 (8), and a Pusillimonas strain (13). In the VPP pathway, nicotine degradation is initiated by a hydroxylation reaction to form 6-hydroxynicotine (6HN), which is then converted to 6-hydroxy-N-methylmyosmine (6HMM) and 6-hydroxypseudooxynicotine (6HPON). Subsequently, 6HPON is oxidized to form 6-hydroxy-3-succinoylpyridine (HSP), which is catabolized to fumaric acid through 2,5-dihydroxypyridine (2,5-DHP), N-formylmaleamic acid, maleamic acid, and maleic acid (Fig. 1) (2). In an early study, Ochrobactrum sp. strain SJY1 was isolated, and a 97.6-kb gene cluster (the vpp cluster, GenBank accession number KM065745), which is responsible for nicotine degradation, was characterized (7). Six genes (vppBDEFGH) involved in the VPP pathway were identified in the vpp cluster, and three of them were functionally characterized using in vitro experiments. VppB catalyzes the reaction from 6HN to 6HMM and 6HPON; VppD is responsible for the reaction from HSP to 2,5-DHP; and VppE is a 2,5-DHP dioxygenase (Fig. 1). Additionally, an HSP hydroxylase (GenBank accession number KJ129609) that catalyzes the oxidative decarboxylation of HSP to 2,5-DHP has been identified in Agrobacterium tumefaciens S33 (9). More recently, the function of nctB (GenBank accession number AGS16700), a gene that encodes (S)-6-hydroxynicotine oxidase, in Shinella sp. HZN7, was also investigated (14). However, the gene responsible for nicotine hydroxylation in the VPP pathway is still unknown.

Hydroxylation of the α position of the pyridine ring with the formation of 6HN is the first catalyzing step in the VPP pathway of nicotine degradation (Fig. 1). Pyridine α-position hydroxylation reactions are essential for the degradation of pyridine derivatives (15, 16), and these kinds of reactions are typically catalyzed by a family of bacterial molybdenum-containing hydroxylases with similar subunit structures, using molybdopterin dinucleotide, FAD, and [2Fe-2S] clusters as cofactors (17). Three pyridine α-position hydroxylases have been identified in nicotine degradation: nicotine dehydrogenase (Ndh) (18, 19) and ketone dehydrogenase (Kdh) (19, 20) from the pyridine pathway, and 3-succinoylpyridine dehydrogenase (Spm) (2) from the pyrrolidine pathway (Fig. 1). These enzymes are all composed of three subunits; the small and middle subunits correspond to the [2Fe-2S] cluster and the FAD-binding motif, and the large subunit corresponds to the molybdopterin-binding subunit. Molybdenum-containing enzymes are found in nearly all organisms and represent a large growing class of enzymes that catalyze redox reactions by taking advantage of the versatile redox chemistry of molybdenum. The molybdenum-containing hydroxylases use H₂O instead of O₂ as the electron donor and are usually involved in the metabolism of medicines (17). Molybdenum-containing hydroxylases play important roles in the biodegradation of aromatic N-heterocycles, such as nicotinic acid and nicotine (2, 15).

In the present study, the genes responsible for the first enzymatic catalyzing step of nicotine degradation in Ochrobactrum sp. SJY1 were cloned and characterized. VppA, the nicotine hydroxylase for the hydroxylation of nicotine to 6HN in the VPP pathway, is composed of two subunits, a [2Fe-2S]-binding subunit and a molybdenum cofactor (MoCo)-binding subunit, suggesting that VppA is a two-component molybdenum-containing hydroxylase.

MATERIALS AND METHODS

Chemicals and media.

l-(−)-Nicotine (99% purity) was purchased from Fluka Chemie GmbH (Buchs Corp., Switzerland). 6-Hydroxynicotine was obtained from Roderich Brandsch. NAD(P)H, FAD, 2,6-dichlorophenolindophenol sodium (DCIP), and phenazine ethosulfate (PES) were obtained from Sangon Biotech, Shanghai, China. The 6-hydroxynicotine oxidase was purified according to the method described previously (7). All other reagents and solvents were of analytical or chromatographic grade and were commercially available. Luria-Bertani (LB) medium and minimal salt medium (MSM) were prepared as previously described (21). Molybdenum deficiency minimal salt medium (MoDM) was prepared using double-distilled H₂O (ddH₂O) by removing the molybdenum from MSM.

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were grown in LB medium at 37°C. Ochrobactrum sp. SJY1 and Pseudomonas putida strains were grown at 30°C in LB medium (7) or MSM with different carbon and nitrogen sources (21).

TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer	Description or primer sequencea	Source
Strains
Ochrobactrum sp. SJY1	Nicotine-degrading strain, Gram negative	CCTCC 2014136
Pseudomonas putida
KT2440	Metabolically versatile saprophytic soil bacterium	23
KT6032	KT2440 containing pME6032	This study
KTVppA	KT2440 containing pME6032-vppA	This study
KTVppAplus	KT2440 containing pME6032-vppAplus	This study
KTVppA-His	KT2440 containing pME6032-vppA-His	This study
Escherichia coli
DH5α	F− recA1 endA1 thi-1 hsdR17 supE44 relA1 deoRΔ(lacZYA-argF)U169 ϕ80dlacZΔM15	TransGen, China
DHVppA	DH5α, containing pME6032-vppA	This study
Plasmids
pME6032	Tetr, shuttle vector	22
pME6032-vppA	Tetr, pME6032 containing vppAS and vppAL	This study
pME6032-vppAplus	Tetr, pME6032 containing vppAS, vppAL, and ORF3	This study
pME6032-vppA-His	Tetr, pME6032 containing vppAS and vppAL with a His tag sequence on the N terminus of vppAS	This study
Primers		This study
vppA-F	ccgGAATTCatgaaagtcgattttactgttaa	This study
vppA-R	gtgCTCGAGcaatacagtaggaagcaggag	This study
vppAplus-F	ccgGAATTCatgaaagtcgattttactgttaa	This study
vppAplus-R	gtgCTCGAGtatttatgcctgggctccgtgct	This study
vppA-His-F	atcatcatcatcatcacagcagcaaagtcgattttactgtt	This study
vppA-His-F2	ccgGAATTCatgggcagcagccatcatcatcatcatcacag	This study
vppA-RTq-F	cccgctcaggcgcgcagtc	This study
vppA-RTq-R	tttcccagtctgcatccaa	This study
RT-reg1-F	aaacaatctcggcgtggtc	This study
RT-reg1-R	gcgaacgacccaaagcagt	This study
RT-reg2-F	ttcaacaggcatggatcaagc	This study
RT-reg2-R	ccaactcttcggcaagcatct	This study
RT-reg3-F	gctggcactatcatcaatc	This study
RT-reg3-R	gccgctttgtttgtcattt	This study

^aUnderlined, uppercase nucleotides indicate restriction sites.

Cloning and expression of the vppA genes and biotransformation of nicotine.

Genes with different open reading frames (ORFs) were amplified from genomic DNA of Ochrobactrum sp. SJY1 by PCR using primers vppA-F/vppA-R (for cloning of vppA_S and vppA_L) and vppA_plus-F/vppA_plus-R (for cloning of vppA_S, vppA_L, and ORF3) (Table 1). The gene fragment and plasmid pME6032 (22) were digested with the restriction enzymes EcoRI and XhoI and ligated just downstream of the promoter of the vector to generate pME6032-vppA and pME6032-vppA_plus, respectively (Table 1). Plasmids pME6032-vppA and pME6032-vppA_plus were transferred into P. putida KT2440 (23) to generate P. putida KTVppA and P. putida KTVppA_plus, respectively. Plasmids were transferred into the recipient strain by the Gene Pulser Xcell system (Bio-Rad, USA) according to the present protocol for Pseudomonas aeruginosa. The expression of VppA was induced by adding 1 mM isopropyl-β-thiogalactopyranoside (IPTG) and 25 μg/ml tetracycline (Tet) during the cultivation. The cells were harvested by centrifugation at 6,000 × g for 5 min and washed twice with 0.9% NaCl, and the cell pellets were resuspended with 50 mM phosphate buffer (pH 7.0) to an optical density at 600 nm (OD₆₀₀) of 6.0 (resting cells). Resting cells were determined by their ability for nicotine transformation. Nicotine was added at final concentrations of 1 mg/ml in the resting cells with shaking at 120 rpm under 30°C. Samples were taken at certain time intervals and subjected to spectrum scanning and high-pressure liquid chromatography (HPLC) analysis.

RT-PCR and RT-qPCR.

Ochrobactrum sp. strain SJY1 was cultivated in the presence and absence of nicotine as previously described (7). Total RNA was extracted with the RNAprep pure cell/bacteria kit (TianGen, China) (7). The cDNA was prepared using random hexamers (TaKaRa, Japan) and SuperScript III reverse transcriptase (Invitrogen) according to the manufacturers' instructions. The boundaries of the vppA operon were identified by PCR of the intergenic regions between the adjacent genes using cDNA as a template. Real-time reverse transcription-PCR (RT-qPCR) analysis was performed using the CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA) with RealMasterMix (SYBR green) (TianGen, China), using the following program: 2 min of initial denaturation at 94°C followed by 40 cycles of 20 s of denaturation at 94°C, 20 s of primer annealing at 56°C (target gene) or 60°C (16S rRNA gene), and 20 s of elongation at 72°C. Fluorescence was measured at the end of each cycle, and melting curve analysis was performed at the end of the PCR to verify the product specificity. Primers for reverse transcription-PCR (RT-PCR) and RT-qPCR are listed in Table 1.

Purification and assays of VppA.

The vppA genes were amplified by PCR using primers vppA-His-F/vppA-R, and the PCR product was used as the template for the overlap extension PCR using primers vppA-His-F2/vppA-R. The product of overlap extension PCR was digested and then inserted into plasmid pME6032 to generate pME6032-vppA-His. P. putida KT2440 carrying pME6032-vppA-His (P. putida KTVppA-His) was grown at 30°C to an OD₆₀₀ of 0.8 and induced at 25°C with 0.5 mM IPTG for 12 h. The cells were harvested, washed twice with 25 mM Tris-HCl (pH, 8.0), and then resuspended in the same buffer. The cell suspension was broken by repetitive sonication, and the cell debris was removed by centrifugation at 12,000 × g for 20 min. The supernatant was loaded onto a HisTrap HP column, washed with 25 mM Tris-HCl (pH 8.0), and then eluted with 25 mM Tris-HCl (pH 8.0) with 40 mM imidazole. The eluted fractions were collected, and imidazole was removed by ultrafiltration with a 10-kDa-cutoff-size Millipore filter. VppA activity was measured at 600 nm using a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan) with the addition of nicotine, protein sample, and a different cofactor (NADH, PES, or DCIP). The products of enzyme catalytic reactions were further determined by HPLC, and the reaction samples were terminated by adding three volumes of methanol and filtered with a 0.22-μm filter. All the enzyme activities were measured at 25°C in 50 mM Tris-HCl buffer (pH 8.0). VppB was purified according to the method described previously (7).

To identify the form of cofactor in VppA, the molybdenum concentration in partially purified VppA was determined after HNO₃ digestion for 1 h at 160°C, using an inductively coupled plasma-mass spectrophotometer (ICP-MS). P. putida KTVppA was cultivated in the MSM and MoDM with 1 mg/ml (NH₄)₂SO₄, 5 mg/ml sodium citrate, 1 mM IPTG, and 25 μg/ml Tet, respectively. The nicotine hydroxylation activities of cells from the two growth media were detected by the resting-cell reactions. For further analysis, the recombinant pME6032-vppA was transferred into Escherichia coli DH5α to generate E. coli DHVppA. Nicotine hydroxylation activity of E. coli DHVppA was induced by adding 1 mM IPTG, and the activity was also detected by the resting-cell reactions.

Analytical methods.

Biotransformation of nicotine by resting cells was analyzed by spectrum scanning using a UV-2550 spectrophotometer. The hydroxylation activities of the resting cells and cell extract were followed by measuring the concentration of nicotine and 6HN by HPLC. HPLC analysis was performed at 30°C with an Agilent 1200 system (Agilent, Santa Clara, CA, USA) equipped with an Eclipse XDB-C₁₈ column (5 μm, 4.6 by 250 mm; Keystone Scientific, Bellefonte, PA, USA). For analysis of the product from nicotine biotransformation, the mobile phase consisted of 15% (vol/vol) methanol and 85% (vol/vol) 1 mM H₂SO₄ at a flow rate of 0.5 ml/min. The substrate and product were quantitatively monitored at 259 nm and 300 nm, respectively. Liquid chromatography-mass spectrometry (LC-MS) analysis was performed as previously described on an Agilent 6230 time-of-flight (TOF)-MS equipped with electrospray ionization (ESI) sources (7). The mobile phase of LC-MS consisted of 60% (vol/vol) ddH₂O (0.05% formic acid, vol/vol) and 40% (vol/vol) methanol (0.1% formic acid, vol/vol) at a flow rate of 0.2 ml/min. After the addition of methanol, the samples were treated at 4°C for 10 min, centrifuged at 12,000 × g for 2 min, and then filtered using a 0.22-μm-pore-size filter prior to HPLC or LC-MS analysis.

RESULTS

The vppA genes are responsible for biotransformation of nicotine to 6HN.

Our previous study indicated that the vpp cluster is responsible for nicotine degradation in the VPP pathway (Fig. 1) in Ochrobactrum sp. SJY1. Two open reading frames (ORF2 and ORF1) (7) are located in the vpp cluster, downstream of vppB, and show 13.7% and 36.4% amino acid sequence identity with the large and the small subunits, respectively, of Ndh from Arthrobacter (Fig. 2A) (18, 19). To determine if these two ORFs are responsible for nicotine transformation, subcloning reactions were conducted. Based on the predicted ORFs, subclones containing ORF1 and ORF2 or ORF1 to ORF3 were ligated into the vector pME6032 and heterologously expressed in P. putida KT2440 (Fig. 2A). Biotransformation was carried out with 0.5 mg/ml nicotine as the substrate using resting cells of P. putida KT6032, P. putida KTVppA, and P. putida KTVppA_plus (Table 1), respectively. After a 10-h reaction, the cells were removed by centrifugation and the supernatant was analyzed by UV-visible scanning and HPLC. In the absence of subclones, the spectrum of the reaction system with resting cells of P. putida KT6032 did not change, and no new peak was detected in the HPLC signal. During the reactions with resting cells of both P. putida KTVppA and P. putida KTVppA_plus (Table 1), the substrate peak, with a maximal absorbance at 259 nm, gradually disappeared, giving rise to a new peak with a maximal absorbance at 295 nm (Fig. 2B). A new peak, with a retention time of 5.05 min, was also detected in the HPLC signal, and the peak that was representative of nicotine disappeared. The results indicated that nicotine was transformed to a new product in the resting-cell reactions. The new product was analyzed by HPLC and LC-MS and identified as 6HN, which has the same spectrum and retention time as the 6HN standard and a molecular weight of 179.1179 (Fig. 2C). There was no significant difference between the degradation rates of resting cells of P. putida KTVppA and P. putida KTVppA_plus (data not shown). ORF3 has no homologous sequence in the genome of P. putida KT2440 and is predicted to be a pseudoazurin, which is an electron donor in the denitrification pathway. Thirty-six coding DNA sequences for denitrification were annotated in the genome of the strain SJY1 (6), suggesting that ORF3 may be involved in denitrification reactions in this strain. These data indicate that ORF1 and ORF2, which were designated, respectively, vppA_S and vppA_L (S and L indicate subunits S and L, respectively), are responsible for the conversion of nicotine to 6HN in the VPP pathway. ORF3 is not necessary for the nicotine hydroxylation.

FIG 2.

Biotransformation of nicotine to 6-hydroxynicotine (6HN) by heterologously expressed vppA genes. (A) Transcription orientation of 5 ORFs in the vpp cluster (GenBank accession numbers AIH15808 to AIH15804 from left to right, respectively). (B) Spectrophotometric changes during the transformation of nicotine by resting cells of P. putida KTVppA. The reaction was initiated by the addition of 1 mg/ml nicotine to resting cells of strain KTVppA with an OD₆₀₀ of 6.0, and the spectra were recorded every 20 min. Arrows indicate the direction of spectral changes. (C) Identification of 6HN by LC-MS analysis.

The vppA genes are upregulated in the presence of nicotine.

Despite its unknown function, ORF3 is located immediately downstream of ORF2 in the same orientation. ORFr, a predicted regulator, is located adjacent to, and is transcribed divergently to, ORF1 (Fig. 2A). All four ORFs may be translationally coupled. In order to identify the complete operon of vppA sequences, three primer pairs were designed to target the flanking regions between ORFr and ORF3. We obtained amplicons for the intergenic regions between ORF1 and ORF2 and between ORF2 and ORF3 but not for the intergenic regions between ORFr and ORF1 (Fig. 3A), indicating that, in Ochrobactrum sp. SJY1, the vppA operon consists of three ORFs (vppA_S, vppA_L, and ORF3). Genes involved in nicotine catabolism are usually upregulated when nicotine is present in the growth medium (2, 7). To prove the connection between nicotine degradation and the vppA genes, the expression of vppA_L in the presence and absence of nicotine was studied using RT-qPCR. The results indicated that the expression level of vppA_L transcription significantly increased in the presence of nicotine compared to the vppA_L transcription level in the absence of nicotine (fold change = 5.49) (Fig. 3B), suggesting that vppA_L expression was induced by nicotine or other intermediates of nicotine degradation. Increased expression correlates with previous data, showing that nicotine-induced resting cells of strain SJY1 have higher nicotine transformation rates (7).

FIG 3.

ORFs of the vppA operon and their transcription analysis. (A) RT-PCR analysis of regions I, II, and III. The first two lanes (+ and −) represent the results for positive (genomic DNA) and negative (ddH₂O) templates, respectively, for PCR with primers for regions I, II, and III. The lanes for RNA and cDNA represent the results of PCRs with the template of RNA and cDNA from Ochrobactrum sp. SJY1 cells grown in the presence of nicotine. (B) Quantitative RT-PCR analysis of the relative expression levels of vppA_L using RNA extracted from Ochrobactrum sp. SJY1 grown in the absence (gray columns) or presence (black columns) of nicotine. The locations of the primers for RT-PCR/RT-qPCR are indicated by bars in Fig. 2. The data were normalized to the 16S rRNA gene. Each value is the mean ± SD of the results of three parallel replicates.

VppA is a two-component molybdenum-containing hydroxylase.

A His tag was added to the N terminus of vppA_S, and the recombinant plasmid pME6032-vppA-His was transformed into P. putida KT2440 to generate P. putida KTVppA-His. His-tagged VppA expression was induced in P. putida KTVppA-His (Table 1) and purified by Ni-Sepharose affinity chromatography under nondenaturing conditions. The partially purified VppA was confirmed by SDS-PAGE, and two extra bands of approximately 75 kDa and 17 kDa, which were absent for the control-purified protein from P. putida KT6032, were identified (Fig. 4A). The 17-kDa protein was the His-tagged, small subunit of VppA, which was further confirmed by staining using the InVision His tag in-gel stain (Fig. 4C). A nicotine hydroxylase assay using partially purified VppA indicated that hydroxylation could be detected when external electron acceptors, such as DCIP and PES, were added. A decrease in absorption was observed at 600 nm when using DCIP as the electron acceptor (see Fig. S1A in the supplemental material). HPLC analysis confirmed that nicotine was transformed to 6HN by partially purified VppA in the catalytic reaction (see Fig. S1B in the supplemental material).

FIG 4.

Partially purified His-tagged nicotine hydroxylase from P. putida KTVppA-His. (A) SDS-PAGE of protein markers (lane M), cell extract of P. putida KTVppA-His (lane CE), purified protein from P. putida KT6032 (lane CK), and purified VppA (lane VppA) stained with Coomassie blue. VppA and the control were purified by the same procedures. (B) UV-visible spectra of purified VppA. (C) Gel visualized with Coomassie blue (left) and InVision His tag in-gel stain (right) of markers (lane M), VppB (lane CK), and partially purified nicotine hydroxylase (lane VppA).

Sequence analysis indicated that the small subunit of VppA has two [2Fe-2S] cluster-binding domains. The partially purified VppA turned tinged brown and exhibited maximum absorption at 417 nm, which confirmed that VppA is an iron-sulfur protein (Fig. 4B). The previously reported enzymes for pyridine ring α-position hydroxylation are all molybdenum-containing hydroxylases that require a petrin cofactor. The large subunit of VppA, encoded by vppA_L, is predicted to be a MoCo-binding subunit, which suggests that VppA is also a molybdenum-containing hydroxylase. In order to identify the role of molybdenum in VppA, the concentration of molybdenum in 80 μg/ml partially purified VppA (8.51 ± 0.11 ng/ml molybdenum) and 80 μg/ml cell extract of P. putida KTVppA (3.01 ± 0.09 ng/ml molybdenum) were determined by ICP-MS. The excess molybdenum suggested that molybdenum constitutes the cofactor for VppA. Also, resting cells of P. putida KTVppA were prepared from the ones cultivated in MSM and MoDM, with (NH₄)₂SO₄ and sodium citrate as the nitrogen and carbon sources, respectively, and with IPTG and Tet in the media. Reactions with an initial concentration of 0.5 mg/ml nicotine were carried out with resting cells from the two sources. The results indicated that resting cells from MSM have higher rates of nicotine degradation and 6HN production (see Fig. S2 in the supplemental material), indicating that molybdenum plays an important role in nicotine hydroxylation. During the synthesis of MoCo for molybdenum-containing hydroxylases, GMP or CMP is added to the phosphate group of molybdopterin, forming the dinucleotide variant of molybdenum cofactor (24). E. coli, which uses molybdenum bis-MTP guanine dinucleotide (MGD) as the MoCo (24), cannot synthesize the sulfurated molybdopterin cytosine dinucleotide cofactor (MCD). However, the microbial pyridine α-position hydroxylases that function in nicotine degradation typically use MCD instead of MGD as the MoCo (15, 25). These enzymes cannot perform hydroxylation in E. coli cells. Recombinant plasmid pME6032-vppA was transferred into E. coli DH5α and P. putida KT2440, and both strains were cultivated in LB medium with Tet and IPTG. The resting-cell reactions were performed with the addition of 1 mg/ml nicotine, and only the resting cells of P. putida KTVppA could transform nicotine into 6HN (see Fig. S2B in the supplemental material). The resting cells of E. coli DHVppA did not produce 6HN. A similar experiment was performed with the pyridine α-position hydroxylase Spm from P. putida S16 (2), and Spm was not active in E. coli cells. P. putida KT2440 cells produced the unusual MCD cofactor as the MoCo (15). These results suggest that a cofactor, which should be MCD, from P. putida KT2440 is required for nicotine hydroxylation of VppA.

Nicotine hydroxylase from Ochrobactrum sp. SJY1 can be used as a biocatalyst for the bioproduction of 6HN, a potential precursor for the synthesis of neonicotinoid (26, 27). Under optimized conditions, 0.84 ± 0.09 mg/ml 6HN was produced from 1 mg/ml nicotine after 6-h biotransformation (see Fig. S3 in the supplemental material). The results suggest that bioproduction of 6HN with heterologously expressed VppA is a useful strategy for value-added chemical production from the pollutant compound nicotine.

VppA is a pyridine α-hydroxylase.

Molybdenum-containing hydroxylases typically contain three subunits (or domains) that bind three cofactors, the MoCo, the [2Fe-2S] clusters, and the FAD, for electron transport from the reducing substrate (N-heterocyclic compound) to the oxidizing substrate (the electron acceptor) (Fig. 5) (17, 24). VppA has only two subunits, a large MoCo-binding subunit (VppA_L) and a small [2Fe-2S] cluster-binding subunit (VppA_S). Subunits of VppA have sequence similarity to the subunits of members of the xanthine dehydrogenase family (Fig. 5). The small subunit, VppA_S, harbors the conserved 39-C-X₄-C-G-X-C-X_n-C-59 and 97-C-G-X-C-X₃₀-C-X-C-133 motifs that are involved in the binding of the two [2Fe-2S] clusters (see Fig. S4A in the supplemental material) (15, 28). The large subunit VppA_L contains the active site and the MoCo-binding site in an arrangement (MTP2-MTP1-MTP3) that differs from that observed (MTP1-MTP2-MTP3) in its isozyme, Ndh, from Arthrobacter nicotinovorans and in most members of the xanthine dehydrogenase family (Fig. 5). The MoCo-binding subunits of isoquinoline 1-oxidoreductase (Ior_B) and nicotinate hydroxylase (Nic_B) have the same motif arrangement as VppA_L, and all of the three enzymes catalyze pyridine α-hydroxylation and lack the FAD-binding motif. No other functional motif is observed in the VppA_L or VppA_S subunits. Moreover, no predicted coding sequence, which has sequence similarity to the reported FAD-binding subunit in other molybdenum-containing hydroxylases, was found in the vpp cluster of Ochrobactrum sp. SJY1.

FIG 5.

Molecular architecture of different molybdenum-containing hydroxylases. Ndh_LMS (GenBank accession numbers CAA53088, CAA53087, and CAA53086), nicotine dehydrogenase from A. nicotinovorans; Kdh_LMS (WP_016359451, WP_016359456, and WP_016359457), ketone dehydrogenase from A. nicotinovorans; Spm_ABC (AEJ14617 and AEJ14616), 3-succinoylpyridine dehydrogenase from P. putida; Qox_LMS (GenBank accession numbers CAD61045, CAD61046, and CAD61047), quinaldine 4-oxidase from Arthrobacter ilicis; Hxa (GenBank accession number Q12553), xanthine dehydrogenase from Aspergillus nidulans; Nic_AB (AAN69541 and AAN69542), nicotinate dehydrogenase from P. putida; and Ior_AB (GenBank accession numbers CAA88753 and CAA88754), isoquinoline 1-oxidoreductase from Brevundimonas diminuta. The letters depicted below the proteins indicate the subunit names of the corresponding proteins. The conserved domains are as follows: [FeS], ferredoxin-like [2Fe-2S]-binding domain; FAD, FAD-binding domain; SRPBCC, SRPBCC ligand-binding domain; MPT, domains for binding to the MoCo; CytC, cytochrome c binding domain.

It appears that the small and large subunits of VppA show similar phylogenetic relations with the corresponding subunits from other VppA_S-containing enzymes (see Fig. S4B and S4C in the supplemental material). VppA_S and VppA_L are closely related to Ior_AB (subunits A and B) and are related to Nic_AB. These results suggest that VppA shares a more recent common ancestor with Ior_AB and Nic_AB than with Ndh.

DISCUSSION

Ochrobactrum sp. SJY1 can efficiently degrade nicotine via the VPP pathway. In the previous study, we reported a 97.6-kb vpp cluster and characterized six genes (vppBDEFGH) involved in six catalyzing steps of the VPP pathway (Fig. 1) (7). However, the gene responsible for the first catalyzing step of nicotine degradation in the VPP pathway is still unknown. In the present study, two genes, vppA_S and vppA_L, which are cotranscribed in one vppA operon, were cloned and characterized. After the vppA genes were transformed into the strain P. putida KT2440, nicotine hydroxylation was detected by the resting-cell reactions, and 6HN was the only product. His-tagged VppA, designated KTVppA-His, was partially purified from P. putida. Hydroxylation activity was confirmed using a UV-visible spectrometer and HPLC with nicotine as the substrate and DCIP as the electric acceptor. In addition, the vppA operon, located in the vpp cluster, is approximately 100 bp downstream of the vppB gene. Based on these results, we concluded that the vppA genes, which encode the nicotine hydroxylase, are responsible for the hydroxylation of nicotine to 6HN in the VPP pathway.

The pyridine hydroxylases can be subclassified as α-, β-, or γ-position hydroxylases according to the hydroxylation position on the pyridine ring (10). VppA is classified as a pyridine ring α-position hydroxylase based on its catalytic reaction. This kind of enzyme typically belongs to the family of molybdenum cofactor, Fe-S cluster, and FAD-dependent hydroxylases, such as Ndh (the isozyme of VppA), Spm, and Nic_AB, which are involved in pyridine degradation (18–20). However, VppA is a two-component enzyme, which is different from its isozyme Ndh (18). A MoCo-binding subunit and Fe-S clusters were identified in VppA, but the FAD-binding subunit was not. Subcloning experiments showed that two coding sequences are sufficient for hydroxylation, and only two extra bands were recognized in an SDS-PAGE gel of partially purified VppA compared with that of the control. The existence of molybdenum was confirmed by ICP-MS and Mo deficiency cultivation experiments. Fe-S clusters can be identified from the characteristic absorption peak of purified VppA, and His-tag-specific staining indicated the existence of a [2Fe-2S]-binding subunit. However, no other extra bands were observed by SDS-PAGE, and the UV-visible spectrum did not show the characteristic peak of a flavin cofactor (10). These results suggested that VppA does not have an FAD-binding subunit.

Molybdenum-containing enzymes are ubiquitous and found in nearly all organisms (17, 24). Of interest to drug research are the molybdenum-containing hydroxylases, which not only need the MoCo but also usually require an FAD cofactor for catalytic activity (28, 29). In contrast to flavin-dependent monooxygenases, molybdenum hydroxylases use water instead of oxygen as the ultimate source of the oxygen atom to be incorporated into the substrate, and they generate reducing equivalents in the hydroxylation reaction (30). FAD is an intermediate electron transfer component. In xanthine oxidase, electrons transfer from the Fe-S center to the flavin center to reduce the flavin center (31). VppA does not have an FAD-binding subunit, and neither nicotinate dehydrogenase (Nic_AB) nor isoquinoline 1-oxidoreductase (Ior_AB) has this kind of subunit (15, 32). Also, VppA_L has a different motif arrangement (MTP2-MTP1-MTP3) than the MoCo-binding subunits of those molybdenum-containing hydroxylases that have the FAD-binding subunit. It is interesting that the MoCo-binding subunit of Nic_AB and Ior_AB has the same domain arrangement as VppA. Therefore, rearrangement of the motifs in the MoCo-binding subunit may reconstruct the electron transfer chain, which does not require participation of the FAD cofactor. VppA, Nic_AB, and Ior_AB, therefore, can be subclassified as a group within the molybdenum-containing hydroxylase family that only has the MoCo-binding and the Fe-S cluster-binding components and that has a specific arrangement of motifs in the MoCo-binding subunit.

Three nicotine degradation pathways have been characterized in bacteria (2–4, 7). The pyridine pathway was mainly discovered in Arthrobacter species (3), and the pyrrolidine pathway was typically carried by Pseudomonas strains (2, 33). In contrast, the VPP pathway was reported in at least four strains belonging to four different genera (7, 8, 12, 13), and genes of the VPP pathway from different strains have high sequence identity to each other (9, 14). On the other hand, VppA shows low sequence identity to its isozyme Ndh from Arthrobacter (13.7% and 36.4% sequence identity to the large and small subunits, respectively). However, VppA_L shows 22.1% amino acid sequence identity to the MoCo-binding motif of Nic_B (from positions 1 to 743), which is higher than that to Ndh_L. This is in accordance with previous results showing that genes of the VPP pathway, which may have evolved independently, are not a simple combination of genes from the pyridine pathway and the pyrrolidine pathway (7). Genes of the VPP pathway appear to be distributed across different genera; this supports our previous speculation that strain SJY1 may have obtained the vpp cluster via horizontal gene transfer (7).

The pyridine heterocycles continue to play vital roles in the development of agricultural chemicals and human medicines (27). Microbial degradation of pyridine derivatives, such as nicotine, may produce numerous useful intermediates for agrochemical and pharmaceutical synthesis (26). Here, we demonstrated that the recombinant strain P. putida KTVppA is an efficient biocatalyst for the biotransformation of nicotine to 6HN, which can easily be modified by replacing the hydroxide radical with a halogen element. 6HN can potentially serve as a precursor for the synthesis of a neonicotinoid. In contrast, the formation of 2-substituted pyridine derivatives requires strict conditions for high product yields in organic chemistry methods (26). This study, therefore, not only extends the understanding of molybdenum-containing hydroxylases but also provides a useful potential biocatalyst preparation for nicotine biotransformation.

Seven genes in the VPP pathway have been identified; nevertheless, identification of the enzyme for conversion of 6HPON to HSP is still needed for complete understanding of this pathway. The genes that are involved in nicotine regulation and degradation are usually clustered on the megaplasmid or chromosome (2, 7, 19). Analysis of the vpp cluster may provide novel information, enabling us to further understand the molecular mechanism of the VPP pathway.