Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2015 Sep 23;89(23):12096–12107. doi: 10.1128/JVI.01254-15

Response of Mammalian Macrophages to Challenge with the Chlorovirus Acanthocystis turfacea Chlorella Virus 1

Thomas M Petro a,b,✉, Irina V Agarkova a,c, You Zhou a,e, Robert H Yolken d, James L Van Etten a,c, David D Dunigan a,c,✉
Editor: G McFadden
PMCID: PMC4645302  PMID: 26401040

ABSTRACT

It was recently reported that 44% of the oropharyngeal samples from the healthy humans in a study cohort had DNA sequences similar to that of the chlorovirus ATCV-1 (Acanthocystis turfacea chlorella virus 1, family Phycodnaviridae) and that these study subjects had decreases in visual processing and visual motor speed compared with individuals in whom no virus was detected. Moreover, mice inoculated orally with ATCV-1 developed immune responses to ATCV-1 proteins and had decreases in certain cognitive domains. Because heightened interleukin-6 (IL-6), nitric oxide (NO), and ERK mitogen-activated protein (MAP) kinase activation from macrophages are linked to cognitive impairments, we evaluated cellular responses and viral PFU counts in murine RAW264.7 cells and primary macrophages after exposure to ATCV-1 in vitro for up to 72 h after a virus challenge. Approximately 8% of the ATCV-1 inoculum was associated with macrophages after 1 h, and the percentage increased 2- to 3-fold over 72 h. Immunoblot assays with rabbit anti-ATCV-1 antibody detected a 55-kDa protein consistent with the viral capsid protein from 1 to 72 h and increasing de novo synthesis of a previously unidentified 17-kDa protein beginning at 24 h. Emergence of the 17-kDa protein did not occur and persistence of the 55-kDa protein declined over time when cells were exposed to heat-inactivated ATCV-1. Moreover, starting at 24 h, RAW264.7 cells exhibited cytopathic effects, annexin V staining, and cleaved caspase 3. Activation of ERK MAP kinases occurred in these cells by 30 min postchallenge, which preceded the expression of IL-6 and NO. Therefore, ATCV-1 persistence in and induction of inflammatory factors by these macrophages may contribute to declines in the cognitive abilities of mice and humans.

IMPORTANCE Virus infections that persist in and stimulate inflammatory factors in macrophages contribute to pathologies in humans. A previous study showed that DNA sequences homologous to the chlorovirus ATCV-1 were found in a significant fraction of oropharyngeal samples from a healthy human cohort. We show here that ATCV-1, whose only known host is a eukaryotic green alga (Chlorella heliozoae) that is an endosymbiont of the heliozoon Acanthocystis turfacea, can unexpectedly persist within murine macrophages and trigger inflammatory responses including factors that contribute to immunopathologies. The inflammatory factors that are produced in response to ATCV-1 include IL-6 and NO, whose induction is preceded by the activation of ERK MAP kinases. Other responses of ATCV-1-challenged macrophages include an apoptotic cytopathic effect, an innate antiviral response, and a metabolic shift toward aerobic glycolysis. Therefore, mammalian encounters with chloroviruses may contribute to chronic inflammatory responses from macrophages.

INTRODUCTION

Chloroviruses (family Phycodnaviridae) were discovered over 35 years ago and are distinctive because they are large icosahedral double-stranded DNA (dsDNA) viruses that infect certain unicellular eukaryotic green algae, which are themselves endosymbionts within protists (1). Chloroviruses are classified on the basis of the algal species they infect. NC64A viruses infect Chlorella variabilis NC64A from Paramecium bursaria, Pbi viruses infect Micractinium conductrix Pbi from Paramecium bursaria, hydra viruses infect Chlorella species from Hydra viridis, and SAG viruses infect Chlorella heliozoae SAG 3.83 from the heliozoon Acanthocystis turfacea. Chloroviruses have large linear 290- to 370-kbp dsDNA genomes that encode as many as 400 proteins. The chlorovirus ATCV-1 (A. turfacea chlorella virus 1) is the type SAG 3.83 virus (2, 3). Considerable information on the interaction of chloroviruses with algae is available; however, nothing is known about their possible interaction with mammalian cells. This possible interaction is relevant because a recent report indicated that ATCV-1-like DNA sequences were present in 44% of the oropharyngeal samples from a healthy human cohort (4). Moreover, the presence of ATCV-1 DNA in this cohort was correlated with decreased performance on certain cognitive tests. Experimental mice exposed by gavage to ATCV-1-infected C. heliozoae also exhibited significant cognitive impairments, specifically in recognition memory and sensorimotor gating, that were associated with significant changes in the expression of 1,285 genes in the hippocampus, many of which are associated with immune and inflammatory responses. Therefore, inflammatory responses to ATCV-1 may be associated with decreases in hippocampus activity that is needed for spatial recognition memory (5).

Several inflammatory events and mediators are known to affect the health of the central nervous system (CNS). During certain viral infections, inflammatory macrophages are involved in hippocampal damage (6, 7, 8, 9). Interleukin-6 (IL-6) produced by many cell types, including inflammatory macrophages, is correlated with a decreased hippocampus volume during depression (10), decreased learning (11, 12), impaired spatial learning, and effects at the hippocampus (13). Nitric oxide (NO) produced by macrophages during inflammation is also associated with memory impairments (14). Therefore, ATCV-1 induction of inflammatory macrophages and mediators may be related to certain memory impairments.

However, it is unknown if macrophages can become infected and/or respond to challenges with ATCV-1 or if ATCV-1 can replicate in macrophages. Our working hypothesis is that mouse macrophages interact with, take up, and respond to ATCV-1 in a manner consistent with their potential role in cognitive impairments. Therefore, we challenged the mouse macrophage cell line RAW264.7 and primary inflammatory macrophages from C57BL/6 mice with ATCV-1 and monitored the infectivity and antiviral responses of the macrophages. For comparison, we challenged the BHK-21 fibroblast cell line with ATCV-1 and challenged RAW264.7 cells with chloroviruses PBCV-1 and CVM-1, which are NC64A and Pbi viruses, respectively.

MATERIALS AND METHODS

Cells, viruses, and reagents.

Female C57BL/6 mice were obtained from Harlan Sprague-Dawley (Indianapolis, IN). RAW264.7 and BHK-21 cells were originally obtained from the American Type Culture Collection (Manassas, VA) and grown in the cell culture medium Dulbecco's modified Eagle's medium (DMEM; Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS; Invitrogen) and 50 μg/ml gentamicin (Invitrogen). Inflammatory macrophages were elicited by the intraperitoneal injection of 2 ml of sterile thioglycolate broth into C57BL/6 mice (15). Three days later, their peritoneal cavities were flushed with 2 ml of DMEM and cells were incubated at 106/2 ml of DMEM. After 24 h, nonadherent cells were removed and 1 ml of DMEM was added. Adherent peritoneal exudate cells (PECs) were >90% Mac-1+ as determined by fluorescence-activated cell sorter (FACS) analysis and were thus inflammatory macrophages (16).

ATCV-1 was grown in C. heliozoae SAG 3.83 cells, purified by successive rounds of gradient centrifugation and 1% Triton X-100 and proteinase K treatments as previously described (17), with some modifications. Because of the sensitivity of ATCV-1 to sucrose, two iodixanol gradient centrifugations were substituted for the sucrose gradients. For additional purification of ATCV-1 to remove any extraneous copurifying proteins, an extra treatment with proteinase K and 1% Triton X-100 was added, followed by a third iodixanol gradient centrifugation. Consequently, the ultrapurification procedure resulted in two proteinase treatments and three iodixanol gradient centrifugations. Chlorella viruses PBCV-1 and CVM-1 were grown in Chlorella variabilis strain NC64A and M. conductrix Pbi, respectively, and purified as described previously (17). Stock preparations were maintained in virus stabilization buffer (50 mM Tris-HCl, 10 mM MgCl2, pH 7.8) at 1 × 1011 PFU/ml, which was changed to phosphate-buffered saline (PBS) at 1 × 1010 PFU/ml at the time of use. In one experiment, virus was inactivated by heat treatment at 85°C for 5 min. The ERK MAP kinase inhibitor U0126 was obtained from Promega Corporation (Madison, WI), and for some experiments, U0126 was added to RAW264.7 cells at 40 μM for 30 min prior to a challenge with ATCV-1.

Macrophage challenge with chlorovirus.

RAW264.7 cells or thioglycolate-induced inflammatory macrophages from C57BL/6 mice were incubated overnight at 37°C in DMEM at 5 × 105 or 1 × 106/ml, respectively. After overnight incubation, nonadherent cells were removed and the adherent cells were exposed to 1 μl containing 107 PFU of ATCV-1. After 1 h of incubation, the nonadsorbed ATCV-1 was aspirated off and 1 ml of fresh DMEM was added. Culture supernatants and cellular lysates for RNA and protein analyses were obtained from samples at 0.5 to 72 h after a challenge with ATCV-1. The NO in culture supernatants from ATCV-1-challenged macrophages was quantified with a Griess reagent kit from Invitrogen. To evaluate the state of virus-mediated programmed cell death, ATCV-1-challenged macrophages were stained with Alexa Fluor 647 annexin V (Invitrogen) plus propidium iodide and then FACS analyzed with a Becton Dickinson FACSCalibur; the data were analyzed with FlowJo software (TreeStar, Ashland, OR). To evaluate intracellular ATCV-1, ATCV-1 was incubated with Sytox orange (Invitrogen), washed with PBS, and then suspended in PBS at 1010 PFU/ml. RAW264.7 cells in culture were challenged with 107 PFU of stained ATCV-1 for 1 h, after which excess stained ATCV-1 was removed and the adherent RAW264.7 cells were incubated for 24 h at 37°C. Following incubation, the medium was removed and the cells were washed in PBS, stained with CellMask plasma membrane stain, and fixed in 4% paraformaldehyde–PBS immediately prior to confocal microscopy. Localization of stained ATCV-1 was analyzed by the Kalman protocol for confocal microscopy.

Enumeration of ATCV-1 PFU.

Culture supernatant fractions from macrophages challenged with ATCV-1 were removed and set aside after 1, 24, 48, and 72 h, and macrophages were lysed with 1% Triton X-100 in PBS. The culture supernatants and lysates were combined, and PFU were counted on lawns of C. heliozoae cells in agarose as previously described (18).

RNA preparation and qRT-PCR.

RNA was extracted from ATCV-1-challenged macrophage cells with the PureLink total RNA kit from Ambion/Invitrogen (Carlsbad, CA) according to the manufacturer's specifications. One hundred nanograms to 1 μg of RNA was reverse transcribed in 0.5 mM (each) dATP, dGTP, dTTP, and dCTP and 20 U of RNase inhibitor with EasyScript reverse transcriptase (Lambda Biotech) at 42°C for 50 min, followed by 85°C for 5 min. The cDNA was diluted 1:2, and 1 μl was incubated with a 0.4 μM concentration of the following primer pairs designed for mouse genes (Invitrogen): beta interferon (IFN-β) sense (5′ ATGAACAACAGGTGGATCCTCC 3′) and antisense (5′ AGGAGCTCCTGACATTT CCGAA 3′), IL-6 sense (5′ ATGAAGTTCCTCTCTGCAAGAGACT 3′) and antisense (5′ CACTAGGTTTGCCGAGTAGATCTC 3′), IRF7 sense (5′ CCAGCGAGTGCTGTTTGGAGAC 3′) and antisense (5′ TTCCCTATTTTCCGTGGCTGGG 3′), iNOS sense (5′ CCCTTCCGAAGTTTCTGGCAGCAGC 3′) and antisense (5′ GGCTGTCAGAGCCTCGTGGCTTTGG 3′), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) sense (5′ TTGTCAGCAATGCATCCTGCAC 3′) and antisense (5′ ACAGCTTTCCAGAGGGGCCATC 3′). ACTV-1 major capsid protein mRNA (gene z280l) levels were evaluated by quantitative reverse transcription (qRT)-PCR with primers 5′ ATGGCCGGAGGACTTTCACAGC 3′ (sense) and 5′ AACGGAACCGTTGATGGTCTGC 3′ (antisense). Quantitative PCRs were run on an ABI Prism 7000 thermal cycler at 50°C for 2 min, 95°C for 10 min, and 45 cycles of 95°C for 15 s and 60°C for 30 s. Cycle threshold (CT) values of samples were normalized to the CT of GAPDH and then normalized to the average CT of the control samples, after which data were expressed as relative mRNA levels by the 2ΔΔCT method.

FACS analysis.

RAW264.7 cells were challenged with ATCV-1 at a multiplicity of infection (MOI) of 20 based on algal cell cultures and then incubated at 37°C. After 1 h, nonadsorbed ATCV-1 was removed and fresh cell culture medium was added. After 48 h, cells were harvested and washed in cold PBS, resuspended in annexin V binding buffer, counted with a hemacytometer, and adjusted to 1 × 106/ml, after which 5 μl of Alexa Fluor 647-conjugated annexin V (Invitrogen) was added, followed by 0.4 μg/ml propidium iodide. All samples were analyzed with a Becton Dickinson FACSCalibur, and the data were analyzed with FlowJo software.

PAGE and Western blot analysis.

Cell protein lysates were obtained from RAW264.7 cells challenged with ATCV-1 at 30 min for up to 72 h. Twenty microliters of each lysate in sample buffer with bromophenol blue was electrophoresed on a 10% SDS-Tris-glycine-polyacrylamide gel (SDS-PAGE) and transferred to a nitrocellulose membrane. The membrane was treated with LI-COR (Lincoln, NE) blocking buffer containing fish gelatin for 1 h at room temperature and then incubated in a 1:700 dilution of rabbit anti-ATCV-1 IgG, a 1:1,000 dilution of mouse anti-phospho-ERK (Cell Signaling, Beverly, MA), a 1:1,000 dilution of rabbit anti-ERK antibody (Cell Signaling), a 1:1,000 dilution of rabbit anti-cleaved-caspase 3 antibody (Cell Signaling), or 2 μg/ml mouse anti-tubulin antibody (Invitrogen). These primary antibodies were revealed with either a 1:5,000 dilution of IRDye 800CW goat anti-rabbit IgG (Rockland Immunochemicals, Inc., Gilbertsville, PA) or Alexa Fluor 680-labeled anti-mouse IgG (Rockland). The washed membrane was scanned with a LI-COR Odyssey (Lincoln, NE) infrared imaging system.

IL-6 protein quantification.

To quantify IL-6 in culture supernatants of macrophages challenged with ATCV-1, enzyme-linked immunosorbent assay (ELISA) plates were coated with 1 μg/ml antibody to mouse IL-6 (MP5-20F3; BD Biosciences, San Jose, CA); the plates were blocked with PBS–10% FBS. After washes, cell culture supernatants or serial dilutions of recombinant IL-6 were added to the wells. After 2 h, 1 μg/ml biotinylated antibody to mouse IL-6 (MP5-32C11) was added to each well. After 1 h, streptavidin conjugated to horseradish peroxidase (1:1,000) was added for 30 min and then a tetramethylbenzidine substrate-hydrogen peroxide solution was added to each well. All ELISA reagents were purchased from BD-Pharmingen (BD Biosciences, San Jose, CA). IL-6 was measured by determining optical density at 450 nm with a reference wavelength of 570 nm.

Statistical analysis.

Where appropriate, data were subjected to analysis of variance and the Student t test to determine the significance of differences between the sample means. P values of <0.05 were considered significant.

RESULTS

ATCV-1 was taken up by and persisted within macrophages.

Because DNA sequences resembling that of the chlorovirus ATCV-1 were found in human oropharyngeal tissues and ATCV-1 inoculation of mice increased the expression of several proinflammatory genes within the hippocampus (4), we examined the response of RAW264.7 mouse macrophage and primary inflammatory mouse macrophage cells to a challenge with purified ATCV-1. For comparison, we also challenged BHK-21 cells, a hamster kidney fibroblast cell line, with ATCV-1. In addition, we challenged RAW264.7 cells with the chloroviruses PBCV-1 (NC64A type) and CVM-1 (Pbi type). The viruses were allowed to adsorb to seeded RAW264.7, primary macrophages, or BHK-21 cells for 1 h. Following this initial incubation, the medium was aspirated to remove nonadsorbed virus and replaced with 1 ml of cell culture medium. After 24 and 72 h, cells were examined microscopically for cytopathic effects. RAW264.7 cells challenged with ATCV-1 showed notable signs of stress at 24 h that included membrane blebbing, nuclear fragmentation, and some cell death (Fig. 1A); in contrast, very few cells with cytopathic effects were seen among mock-treated cells or RAW264.6 cells challenged with either PBCV-1 or CVM-1 (data not shown). Inflammatory macrophages did not exhibit significant cell death by 72 h (Fig. 2A). However, inflammatory macrophages challenged with ATCV-1 exhibited prominent dendritic cellular projections, unlike mock-infected cells.

FIG 1.

FIG 1

Open in a new tab

The chlorovirus ATCV-1 was taken up by and persisted within the RAW264.7 macrophage cell line. RAW264.7 cells (5 × 105) grown in culture medium overnight were challenged with 1 × 107 ATCV-1 PFU for 1 h, after which the culture medium containing nonadsorbed ATCV-1 PFU was removed and fresh culture medium was added to the cells. (A) After 24 and 72 h, microscopic differential interference contrast (DIC) images of RAW264.7 cell cultures were taken at ×400 magnification. Vertical panels represent three regions of the cell culture field. (B) After 1, 24, 48, and 72 h, PFU counts in cell extracts plus culture supernatants were assessed by viral plaque assays with C. heliozoae cell cultures. The data are from four separate experiments with five replicates per time point for each experiment (n = 20). (C) PFU counts in cell extracts plus culture supernatants from CVM-1-inoculated cells were assessed by viral plaque assays with M. conductrix cell cultures (n = 5 per time point). Values are means ± standard errors.

FIG 2.

FIG 2

Open in a new tab

The chlorovirus ATCV-1 was taken up and persisted within inflammatory peritoneal exudate macrophage cells (PECs) but not BHK-21 cells. We challenged 5 × 105 RAW264.7 cells, 1 × 106 PEC cells, and 1 × 106 BHK-21 cells grown in culture medium overnight with 1 × 107 ATCV-1 PFU for 1 h, after which we removed the culture medium containing nonadsorbed ATCV-1 PFU, and added fresh culture medium. (A) After 24 and 72 h, microscopic DIC images of PEC cell cultures were taken at ×400 magnification. Vertical panels represent three regions of the cell culture field. (B) After 1, 24, 48, and 72 h, the PFU counts in PEC extracts plus culture supernatants were assessed by viral plaque assays with C. heliozoae cell cultures. (C) After 24, 48, and 72 h, RNA was extracted for qRT-PCR of ATCV-1 major capsid protein mRNA (gene z280l) expression. (D) After 1, 24, 48, and 72 h, PFU counts in BHK-21 cell extracts plus culture supernatants were assessed by viral plaque assays. Values are means ± standard errors (n = 5).

In parallel experiments, after nonadsorbed virus was removed at 1 h, PFU of ATCV-1 and CVM-1 of algal C. heliozoae SAG 3.83 and M. conductrix cells and culture supernatants, respectively, were quantified starting at 1 h through 72 h postchallenge. In four separate experiments with five replicates at each time point, on average, 8% of the initial inoculum (0.8 × 106 PFU/culture) was cell associated at 1 h (Fig. 1B). By 24 h, the ATCV-1 PFU count increased further to an average of 2.6 × 106/culture, declining slightly to 1.9 × 106/culture by 72 h. Comparing the 1-h PFU count with those for the remainder of the time points, significantly more ATCV-1 PFU were seen at 24 to 72 h (n = 20; F = 10.6; P = 0.00001) (Fig. 1B). Therefore, ATCV-1 persisted and appeared to replicate in the RAW264.7 macrophage cell line. In contrast to ATCV-1, an average of 1 × 104 PFU or 0.1% of the initial CVM-1 inoculum was associated with RAW264.7 cells at 1 h (Fig. 1D). The level of CVM-1 in RAW264.7 cells declined at 24 h to an average of 5.6 × 103 PFU/culture and declined further to 2.6 × 103 PFU/culture by 72 h. Thus, ATCV-1 persisted and possibly replicated in RAW264.7 cells while CVM-1 virus did not.

ATCV-1 that associated with primary mouse inflammatory macrophages (PECs) at 1 h was at 2.7 × 105 PFU/culture or 2.7% of the initial inoculum (Fig. 2B). The level of ATCV-1 increased at 24 h to 3.9 × 105 PFU/culture and again at 72 h to an average of 5.0 × 105 PFU/culture. There was a significant increase in the ATCV-1 PFU count at 72 h compared with that at 48 h (P = 0.00001). In contrast to macrophages, BHK-21 cells challenged with an MOI of 20 ATCV-1 PFU exhibited very low number of PFU that were cell associated from 1 to 72 h postchallenge (Fig. 2D). On average, only 41 to 49 ATCV-1 PFU per BHK-21 cell culture were detected from 1 to 72 h postchallenge. To determine if ATCV-1 RNA was expressed in RAW264.7 and PEC macrophages challenged with ATCV-1, total RNA was isolated and mRNA for the ATCV-1 major capsid protein (gene z280l) was measured by quantitative PCR. Both RAW264.7 and PEC macrophages expressed ATCV-1 major capsid protein mRNA starting at 24 h through 72 h postchallenge (Fig. 2C). On average, 40 copies of major capsid protein mRNA at 24 h, 139 copies at 48 h, and 100 copies at 72 h were detected per RAW264.7 cell culture.

To determine if ATCV-1 was internalized by RAW264.7 cells and not simply attached to the cell surface, we stained ATCV-1 with Sytox orange prior to a challenge of cells and then evaluated the RAW264.7 cells by confocal microscopy at 24 h. Sytox orange-stained ATCV-1 was as infectious to C. heliozoae SAG 3.83 cells as nonstained ATCV-1 was, indicating that the stain had no effect on virus infectivity in algae (D. D. Dunigan, unpublished results). No intracellular fluorescence occurred in control RAW264.7 cells, whereas cells challenged with stained ATCV-1 clearly exhibited cell-associated punctate fluorescence consistent with virus association (Fig. 3A). To further examine the interaction of RAW264.7 cells with ATCV-1 PFU, we challenged RAW264.7 cells with Sytox orange-stained ATCV-1; after 24 h, stained the cells with CellMask plasma membrane stain prior to confocal microscopy; and identified intracellular virus by the Kalman protocol for confocal microscopy. In this case, Sytox orange-stained virus was seen intracellularly within and beyond the blue plasma membrane stain in RAW264.7 cells (Fig. 3B).

FIG 3.

FIG 3

Open in a new tab

ATCV-1 virions appeared to be intracellular in RAW264.7 cells at 24 h postchallenge. Purified ATCV-1 was incubated with Sytox orange for 1 h, after which virions were washed twice in PBS and used to challenge RAW cells. RAW cells (5 × 105) grown in culture medium overnight were challenged with 1 × 107 stained ATCV-1 PFU for 1 h, after which the culture medium and nonadsorbed ATCV-1 PFU were removed and fresh culture medium was added. After 24 h, RAW264.7 cells were imaged by fluorescence microscopy (A) or washed once in cell culture medium, fixed in 4% paraformaldehyde, and membrane stained with CellMask plasma membrane stain (B). Panel A represents cells imaged with DIC and fluorescence; panel B represents cells imaged by confocal microscopy with intracellular ATCV-1 identified by the Klaman protocol for confocal microscopy.

ATCV-1 proteins were produced in RAW264.7 cells.

Antiserum to purified ATCV-1 was generated in rabbits following a series of immunizing injections. By Western blot analysis after 108 ATCV-1 PFU equivalents were applied to PAGE gels, rabbit anti-ATCV-1 serum reacted with at least 23 distinct proteins (data not shown). To determine if ATCV-1 proteins could be detected in RAW264.7 cells following a challenge with ATCV-1, protein lysates generated from 16 to 66 h postchallenge were evaluated by Western blot analysis with rabbit anti-ATCV-1 serum. A constant level of a 55-kDa protein similar in size to the ATCV-1 major capsid protein was detected in lysates of RAW264.7 cells from 16 to 66 h postchallenge but not in lysates of mock-challenged cells (Fig. 4A). In addition, a 17-kDa protein appeared at 16 h and its intensity increased from 48 to 66 h postchallenge. No other anti-ATCV-1 IgG-binding proteins were detected. To determine if these two proteins were from phagocytosis of the original ATCV-1 inoculum or generated during the viral challenge, RAW264.7 cells were challenged with either infectious or heat-inactivated ATCV-1. A Western blot assay of protein lysates of cells at 24 to 72 h postchallenge revealed that nearly equal levels of the 55-kDa protein were detected at 24 h in RAW264.7 cells challenged with either infectious or heat-inactivated ATCV-1 (Fig. 4B). However, at 48 and 72 h, the intensity of the 55-kDa protein declined in RAW264.7 cells challenged with heat-inactivated ATCV-1. Moreover, the 17-kDa protein, which appeared in cells challenged with infectious ATCV-1, did not appear at any time in RAW264.7 cells following a challenge with heat-inactivated ATCV-1. More importantly, the RAW264.7 cells did not exhibit a cytopathic effect (Fig. 4C). Therefore, two ATCV-1 antiserum-reacting proteins were detected in RAW264.7 cells challenged with ATCV-1 and infectious particles were apparently required to sustain the expression of these two proteins. It is not known if other ATCV-1 proteins were expressed in RAW264.7 cells but were not produced at a detectable level or were not recognized by the rabbit antisera used in this experiment.

FIG 4.

FIG 4

Open in a new tab

Chlorovirus ATCV-1 proteins were expressed within RAW264.7 cells challenged with infectious ATCV-1. RAW cells (5 × 105) grown in culture medium overnight were challenged with 1 × 107 infectious ATCV-1 PFU or heat-inactivated ATCV-1 for 1 h, after which culture medium and nonadsorbed ATCV-1 PFU were removed and fresh culture medium was added. (A) Immunoblot assay with rabbit anti-ATCV-1 serum of cell lysates 16, 24, 48, and 66 h after a challenge with infectious ATCV-1. (B) Immunoblot assay of cell lysates 24, 48, and 72 h after a challenge with infectious or heat-inactivated ATCV-1(85°C for 5 min). (C) At 72 h following a challenge with infectious or heat-inactivated ATCV-1, microscopic images of RAW264.7 cell cultures were taken at ×400 magnification.

ATCV-1-activated programmed cell death in RAW264.7 cells.

RAW264.7 cells challenged with infectious ATCV-1 exhibited a cytopathic effect and/or died by 72 h. Virus-activated apoptosis is a key antiviral mechanism that limits viral replication (19) but could also contribute to viral persistence through macrophage phagocytosis of apoptotic virus-infected cells (20). Cleavage of caspase 3 (21) and binding of annexin V to phosphatidylserine at the cell membrane (22) are hallmarks of apoptotic cell death. To determine if RAW264.7 cells challenged with ATCV-1 undergo apoptosis, cells were stained with annexin V at 48 h and cell extracts were analyzed by Western blot assay for cleaved caspase 3 at 24 h postchallenge. RAW264.7 cells challenged with ATCV-1 at an MOI of 20 PFU/cell exhibited a significant increase in cleaved caspase 3 at 24 h (Fig. 5A) and robust annexin V staining at 48 h postchallenge (Fig. 5B). Therefore, RAW264.7 cells challenged with ATCV-1 appear to undergo apoptotic programmed cell death, which may be an antiviral mechanism that limits virus replication.

FIG 5.

FIG 5

Open in a new tab

The chlorovirus ATCV-1 induced apoptotic programmed cell death in RAW264.7 cells. RAW26.7 cells (5 × 105) grown in culture medium overnight were challenged with 1 × 107 ATCV-1 PFU, after which culture medium and nonadsorbed ATCV-1 PFU were removed and fresh culture medium was added. (A) Immunoblot assay of cell lysates from one unchallenged RAW264.7 cell culture (Nil) and three ATCV-1-challenged RAW264.7 cell cultures at 24 h with rabbit anti-cleaved-caspase 3 and mouse anti-beta-tubulin antibodies. (B) FACS analysis of propidium iodide (PI) and annexin V staining at 48 h postchallenge with ATCV-1.

ATCV-1 activation of ERK MAP kinases may contribute to apoptosis in RAW264.7 cells.

The MAP kinase ERK is involved in apoptotic programmed cell death in response to DNA-damaging agents but also in response to IFN-α (23). Therefore, we evaluated ATCV-1-challenged RAW264.7 cells for ERK activation by using phospho-specific antibodies in Western blot assays. RAW264.7 cells challenged with ATCV-1 formed phospho-ERK as early as 30 min postchallenge, and it was still present at 60 min but absent at 3 h postchallenge (Fig. 6A). A specific inhibitor of ERK activation, U0126, was used to pretreat RAW264.7 cells during a challenge with ATCV-1 to determine if ERK activation is associated with ATCV-1-induced cell death. Treatment of RAW264.7 cells with 40 μM U0126 during an ATCV-1 challenge inhibited ERK activation (Fig. 6B). Moreover, U0126 prevented the ATCV-1-mediated cytopathic effect and death of RAW264.7 cells (Fig. 6C). Therefore, ERK MAP kinases appear to be involved in the cytopathic effect of ATCV-1 on RAW264.7 macrophages.

FIG 6.

FIG 6

Open in a new tab

ERK MAP kinases are activated in RAW264.7 cells challenged with infectious ATCV-1. (A) RAW264.7 cells (5 × 105) grown in culture medium overnight were challenged with 1 × 107 ATCV-1 PFU. Immunoblot assay of RAW264.7 cell lysates 30, 60, 180, and 360 min after a challenge with infectious ATCV-1 with mouse anti-phospho-ERK1/2 and rabbit anti-ERK1/2 antibodies. (B, C) RAW cells (5 × 105) grown in culture medium overnight were treated with 40 μM U0126 for 30 min prior to a challenge with 1 × 107 PFU of infectious ATCV-1. (B) Phospho-ERK immunoblot assay of RAW264.7 cell lysates at 30, 60, and 120 min and 48 h. (C) Microscopic images of RAW264.7 cell cultures taken at ×400 magnification after 72 h. Vertical panels represent three regions of the cell culture field.

ATCV-1-induced innate antiviral immune responses in macrophages.

A hallmark of viral infection of mammalian cells is rapid induction of IFN-β and IFN response genes (ISGs), such as IRF7 (24). To determine if RAW264.7 cells and primary inflammatory macrophages undergo antiviral responses, the expression of both IFN-β and IRF7 after an ATCV-1 challenge was evaluated by qRT-PCR. RAW264.7 cells and inflammatory macrophages expressed IFN-β at 72 h and IRF7 by 24 h postchallenge with ATCV-1 (Fig. 7 A and B). RAW264.7 cells challenged with the chlorovirus CVM-1 did not respond with any expression of IFN-β or IRF7 mRNA (data not shown). Therefore, macrophages challenged with ATCV-1 appear to undergo some aspects of a canonical innate antiviral response (25).

FIG 7.

FIG 7

Open in a new tab

Chlorovirus ATCV-1-challenged RAW264.7 cells and PEC macrophages express an antiviral response with inflammatory cytokine IL-6. RAW cells (5 × 105) or PEC macrophages (1 × 106) grown in culture medium overnight were challenged with 1 × 107 ATCV-1 PFU for 1 h, after which culture medium and nonadsorbed ATCV-1 PFU were removed and fresh culture medium was added. After 24, 48, and 72 h, RNA was extracted from cellular lysates and for qRT-PCR of IFN-β (A), IRF7 (B), and IL-6 (C) and culture supernatants were collected for ELISA of IL-6 protein (D). Values are means ± standard errors (SE; n = 5).

ATCV-1-induced responses in macrophages consistent with a shift toward an inflammatory phenotype.

In addition to ISGs, macrophages challenged with viruses also express inflammatory cytokines such as IL-6 and inflammatory factors such as NO, both of which have antiviral effects and are also involved in neurological memory impairments (12). Therefore, we evaluated IL-6-inducible NO synthase (iNOS) and NO production from RAW264.7 cells and inflammatory macrophages after either a mock challenge or an ATCV-1 challenge. While RAW264.7 cells expressed much higher levels of IL-6 mRNA starting at 24 h postchallenge (Fig. 7C), both cell types produced similar levels of IL-6 protein within 24 h postchallenge with ATCV-1 (Fig. 7 D). RAW264.7 cells challenged with the chlorovirus CVM-1 did not respond with expression of IL-6 mRNA (data not shown). Likewise, RAW264.7 cells responding to ATCV-1 expressed iNOS and produced NO within 24 h after an ATCV-1 challenge (Fig. 8A and B). In contrast, expression of iNOS from primary inflammatory macrophages did not occur until 72 h postchallenge with ATCV-1. Nevertheless, macrophages interacting with ATCV-1 expressed inflammatory factors, many of which are linked to memory impairments and mental illnesses (14, 26, 27).

FIG 8.

FIG 8

Open in a new tab

Chlorovirus ATCV-1-challenged RAW264.7 cells and PEC macrophages express iNOS and NO and secrete elevated levels of lactate. RAW cells (5 × 105) or PEC macrophages (1 × 106) grown in culture medium overnight were challenged with 1 × 107 ATCV-1 PFU for 1 h, after which culture medium and nonadsorbed ATCV-1 PFU were removed and fresh culture medium was added. After 24, 48, and 72 h, RNA was extracted from cellular lysates and culture supernatants were collected for Griess assay of NO (A), qRT-PCR of iNOS (B), and secreted lactate assay (C, D). Values are means ± standard errors (SE; n = 5).

The plasticity of macrophage phenotypes has been noted to take place in response to a microbial challenge (28, 29). One of the phenotypes consistent with inflammatory macrophages results in a metabolic change such that glycolysis is enhanced and oxidative phosphorylation is reduced (30). This aerobic glycolysis results in rapid ATP formation with increased production of lactic acid. To determine if RAW264.7 cells and PEC macrophages exhibit an inflammatory macrophage phenotype following a challenge with ATCV-1, we measured lactate in the culture supernatants. Both RAW264.7 cells (Fig. 8C) and PEC macrophages (Fig. 8D) that were unchallenged produced slight amounts of lactate over time. However, a challenge of both RAW264.7 cells and PEC macrophages with ATCV-1 significantly elevated lactate production in the cell culture medium starting at 24 h postchallenge, with increasing levels at 48 and 72 h relative to those of mock-challenged cells.

DISCUSSION

The results of the present investigation show that macrophages challenged with the chlorovirus ATCV-1 took up the virus, maintained and possibly replicated infectious units of it, and underwent responses that included apoptosis, morphological changes, and production of inflammatory factors. The data show that ATCV-1 PFU counts increased in both RAW264.7 cells and peritoneal macrophages from 24 h to 72 h postchallenge. This suggests that a small but significant amount of viral replication possibly took place in macrophages challenged with ATCV-1. Another cell type, BHK-21, which is a fibroblastic cell line that supports the replication of several virus types (31, 32), did not maintain ATCV-1 to any extent and did not exhibit any increase in the ATCV-1 PFU count over the 72-h culture period. Thus, macrophages may be uniquely suited to maintain viruses that might infect them. For example, mimiviruses were shown to infect macrophages that phagocytized these giant viruses (33). Moreover, influenza viruses infected macrophages, either directly or through phagocytosis of apoptotic macrophages that were previously infected by influenza viruses (34). In this case, exposure of phosphatidylserine at the outer leaflet of the cell membrane was the basis for annexin V staining of apoptotic cells and was a key feature of apoptotic cells ensuring their phagocytosis by macrophages. Moreover, viral apoptotic mimicry by enveloped viruses through exposure of phosphatidylserine at their envelop is a well-known mechanism of viral persistence (20). We show here that ATCV-1-infected RAW264.7 cells exhibited robust annexin V staining at 48 h postchallenge. Therefore, viral replication notwithstanding, it is likely that phagocytosis of apoptotic macrophages induced by ATCV-1 contributed significantly to the maintenance of ATCV-1 in macrophage populations.

In addition to induction of apoptosis in macrophages, the macrophage responses to ATCV-1 are significant because they included the production by these cells of inflammatory factors that have been linked to memory impairments that occur in mice exposed to ATCV-1 (4). One of the inflammatory factors produced in response to ATCV-1 is IL-6, and its production was induced quickly after a challenge with ATCV-1. The data indicated that most of the accumulation of IL-6 has occurred within 24 h after an ATCV-1 challenge. An interesting aspect of our data is the discrepancy between the amount of IL-6 produced and the relative level of IL-6 mRNA expression. This is likely due to the fact that IL-6 production was controlled posttranscriptionally, whereby IL-6 mRNA was rapidly degraded (35). As a result, production of IL-6 and expression of IL-6 mRNA were not always correlated. Nevertheless, it is noteworthy that macrophages respond to ATCV-1 with robust production of IL-6, an inflammatory cytokine that causes neurological impairments. It is known that during several different types of viral infections, macrophages take up virions, migrate to various anatomical locations, including the CNS, and respond to the viruses by producing inflammatory factors (36). The results reported here indicate that the macrophage could be a host cell that retains ATCV-1 without destroying the virus and responds to the virus with the production of inflammatory factors. Increased levels of proinflammatory cytokines are associated with cognitive impairments in a number of human disorders, including Alzheimer's disease (37), cognitive decline in the elderly (38), stroke (39), and psychiatric disorders (40). However, it remains to be seen if ATCV-1 infects and induces responses in other CNS cell types such as neurons and astrocytes. Moreover, it would not be surprising if brain microglial cells, which are of the macrophage lineage, take up and respond to ATCV-1 with production of inflammatory mediators.

We also show here that macrophages contained a significant number of infectious ATCV-1 PFU for at least 72 h postchallenge and two ATCV-1 proteins appeared to be produced within the macrophages to a degree that was detected by Western immunoblot assay. A 55-kDa protein consistent with the size of the major capsid protein and a 17-kDa protein of unknown identity were produced by RAW264.7 cells challenged with ATCV-1. When heat-inactivated ATCV-1 was used to challenge the RAW264.7 cell line, the 55-kDa protein was detected by Western blot assay for the first 24 h postinfection; however, the level of this protein declined after 24 h. This result suggested that some of the 55-kDa protein detected with infectious ATCV-1 was probably from phagocytosed virus particles but some of the 55-kDa protein was likely synthesized de novo. In contrast, the unknown 17-kDa protein(s) was not detected at any time when RAW264.7 cells were challenged with heat-inactivated ATCV-1. The level of this same protein(s) increased with time after 24 h postchallenge with infectious ATCV-1. These observations suggest that the 17-kDa protein(s) that reacts with ATCV-1 antiserum was synthesized de novo in RAW264.7 cells challenged with ATCV-1. It is likely that other immunoreactive ATCV-1 proteins were synthesized but not detected because they were not produced to a sufficient level in RAW264.7 cells. When purified ATCV-1 (108 viral particles that were heat inactivated and denatured) was electrophoresed on a polyacrylamide gel and rabbit anti-ATCV-1 sera were used in Western blot assays, 23 distinct proteins were detected (data not shown). However, there were only ~180 × 104 PFU in ATCV-1-challenged RAW264.7 cells at 72 h (Fig. 1B). We conclude that the rabbit anti-ATCV-1 sera cannot detect most of these protein unless a threshold of viral particle equivalents is reached, i.e., 107. Further analyses, beyond the scope of this study, are required to determine the origin of these proteins, i.e., either the host or the virus.

Another feature of the ATCV-1 challenge of macrophages was a shift in metabolism in these cells toward aerobic glycolysis. ATCV-1 induced lactate production in both RAW264.7 cells and PECs. This increased lactate production is likely due to the establishment of a macrophage phenotype consistent with M1 macrophages, which are pivotal to host defense but also to inflammation (29, 30, 41). During this shift in metabolism, oxidative phosphorylation in the mitochondria is disrupted and glycolysis is enhanced. Moreover, it is unclear if the shift in metabolism was initiated by ATCV-1 factors or if it was a response to the activation of innate antiviral pathways. Several reports indicate that activation of Toll-like receptor pathways triggers the shift in macrophage and dendritic cell metabolism toward glycolysis and away from oxidative phosphorylation (30, 42). As a result of this shift, pyruvate is preferentially converted to lactate rather than entry into the trichloroacetic acid cycle. Another feature of this shift in metabolism is increased production of NO, which not only impairs mitochondrial activity but also has antiviral activity (43). The response of macrophages to an ATCV-1 challenge was robust production of NO. It remains to be seen if the enhanced production of lactate and NO by macrophages plays any role in the learning impairments associated with an ATCV-1 challenge in mice (4) or plays any role in the antiviral activity of macrophages. NO is a gaseous cell signaling molecule produced by NO synthases and activates the intracellular signaling enzyme guanylate cyclase (44). While NO is needed by the CNS, excess NO is associated with CNS impairments (45). Moreover, there is evidence of activation of microglia, which is part of the macrophage cell lineage, and an increase in iNOS expression in both a rat model of schizophrenia (27) and in patients with schizophrenia (46). Numerous studies have reported that elevated NO production occurs in Alzheimer's disease, multiple sclerosis, and Parkinson's disease (47, 48). Therefore, because macrophages retained and responded to ATCV-1, in addition to their migratory properties in response to inflammation, it is possible that macrophages encountering ATCV-1 could initiate responses detrimental to memory formation.

In addition to inducing a shift in metabolism, RAW264.7 cells challenged with ATCV-1 initiated apoptotic programmed cell death, as evidenced by increased production of cleaved caspase 3 and annexin V staining. Our data suggest that rapid activation of ERK MAP kinases may contribute to the activation of apoptotic death. Addition of the ERK MAP kinase inhibitor U0126 prevented the death of RAW cells in the presence of ATCV-1. Other reports show the involvement of ERK MAP kinase in activation of apoptosis of cells in response to DNA-damaging agents (49) and type I IFNs (23). The mechanism by which ATCV-1 induces activation of ERK MAP kinases or apoptotic programmed cell death is unknown.

In summary, the chlorovirus ATCV-1, a SAG virus that infects the alga C. heliozoae, an endosymbiont of the heliozoon A. turfacea, induced powerful inflammatory responses in mouse macrophages that included a shift in metabolism toward aerobic glycolysis with production of lactate, NO, and IL-6. Moreover, infectious ATCV-1 virions were retained within the macrophages and ATCV-1 proteins were produced by the inoculated mouse macrophage cell line RAW264.7. Moreover, a low level of ATCV-1 replication appeared to occur in RAW264.7 cells. Ultimately, ATCV-1 activated apoptotic programmed cell death in RAW264.7 cells. Therefore, the hypothesis that ATCV-1 could be sustained and replicate within and trigger neuroinflammatory responses with a macrophage cellular host remains valid. However, it remains to be determined if these proinflammatory responses induced by ATCV-1 in macrophages play a role in previously described CNS memory impairments associated with ATCV-1 in both humans and mice (4).

ACKNOWLEDGMENTS

This work was supported by funding from the University of Nebraska Medical Center Department of Oral Biology and College of Dentistry (T.M.P.), the University of Nebraska—Lincoln Agricultural Research Division (D.D.D.), the Stanley Medical Research Institute (J.L.V.E., D.D.D., R.H.Y.), and National Institutes of Health grant P30RR031151 from the COBRE program of the National Center for Research Resources. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Center for Research Resources or the National Institutes of Health.

REFERENCES

  • 1.Van Etten JL, Dunigan DD. 2012. Chloroviruses: not your everyday plant virus. Trends Plant Sci 17:1–8. doi: 10.1016/j.tplants.2011.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bubeck JA, Pfitzner AJ. 2005. Isolation and characterization of a new type of chlorovirus that infects an endosymbiotic Chlorella strain of the heliozoon Acanthocystis turfacea. J Gen Virol 86:2871–2877. doi: 10.1099/vir.0.81068-0. [DOI] [PubMed] [Google Scholar]
  • 3.Fitzgerald LA, Graves MV, Li X, Hartigan J, Pfitzner AJ, Hoffart E, Van Etten JL. 2007. Sequence and annotation of the 288-kb ATCV-1 virus that infects an endosymbiotic chlorella strain of the heliozoon Acanthocystis turfacea. Virology 362:350–361. doi: 10.1016/j.virol.2006.12.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yolken RH, Jones-Brando L, Dunigan DD, Kannan G, Dickerson F, Severance E, Sabunciyan S, Talbot CC Jr, Prandovszky E, Gurnon JR, Agarkova IV, Leister F, Gressitt KL, Chen O, Deuber B, Ma F, Pletnikov MV, Van Etten JL. 2014. Chlorovirus ATCV-1 is part of the human oropharyngeal virome and is associated with changes in cognitive functions in humans and mice. Proc Natl Acad Sci U S A 111:16106–16111. doi: 10.1073/pnas.1418895111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Redish AD, Touretzky DS. 1998. The role of the hippocampus in solving the Morris water maze. Neural Comput 10:73–111. doi: 10.1162/089976698300017908. [DOI] [PubMed] [Google Scholar]
  • 6.Howe CL, Lafrance-Corey RG, Sundsbak RS, Lafrance SJ. 2012. Inflammatory monocytes damage the hippocampus during acute picornavirus infection of the brain. J Neuroinflammation 9:50. doi: 10.1186/1742-2094-9-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Buenz EJ, Rodriguez M, Howe CL. 2006. Disrupted spatial memory is a consequence of picornavirus infection. Neurobiol Dis 24:266–273. doi: 10.1016/j.nbd.2006.07.003. [DOI] [PubMed] [Google Scholar]
  • 8.Poluektova L, Meyer V, Walters L, Paez X, Gendelman HE. 2005. Macrophage-induced inflammation affects hippocampal plasticity and neuronal development in a murine model of HIV-1 encephalitis. Glia 52:344–353. doi: 10.1002/glia.20253. [DOI] [PubMed] [Google Scholar]
  • 9.Moore TC, Cody L, Kumm PM, Brown DM, Petro TM. 2013. IRF3 helps control acute TMEV infection through IL-6 expression but contributes to acute hippocampus damage following TMEV infection. Virus Res 178:226–233. doi: 10.1016/j.virusres.2013.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Frodl T, Carballedo A, Hughes MM, Saleh K, Fagan A, Skokauskas N, McLoughlin DM, Meaney J, O'Keane V, Connor TJ. 2012. Reduced expression of glucocorticoid-inducible genes GILZ and SGK-1: high IL-6 levels are associated with reduced hippocampal volumes in major depressive disorder. Transl Psychiatry 2:e88. doi: 10.1038/tp.2012.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Heyser CJ, Masliah E, Samimi A, Campbell IL, Gold LH. 1997. Progressive decline in avoidance learning paralleled by inflammatory neurodegeneration in transgenic mice expressing interleukin 6 in the brain. Proc Natl Acad Sci U S A 94:1500–1505. doi: 10.1073/pnas.94.4.1500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sparkman NL, Buchanan JB, Heyen JRR, Chen J, Beverly JL, Johnson RW. 2006. Interleukin-6 facilitates lipopolysaccharide-induced disruption in working memory and expression of other proinflammatory cytokines in hippocampal neuronal cell layers. J Neurosci 26:10709–10716. doi: 10.1523/JNEUROSCI.3376-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Samuelsson AM, Jennische E, Hansson HA, Holmang A. 2006. Prenatal exposure to interleukin-6 results in inflammatory neurodegeneration in hippocampus with NMDA/GABA(A) dysregulation and impaired spatial learning. Am J Physiol Regul Integr Comp Physiol 290:R1345–R1356. [DOI] [PubMed] [Google Scholar]
  • 14.Kamat PK, Tota S, Rai S, Swarnkar S, Shukla R, Nath C. 2012. A study on neuroinflammatory marker in brain areas of okadaic acid (ICV) induced memory impaired rats. Life Sci 90:713–720. doi: 10.1016/j.lfs.2012.03.012. [DOI] [PubMed] [Google Scholar]
  • 15.Turchyn LR, Baginski TJ, Renkiewicz RR, Lesch CA, Mobley JL. 2007. Phenotypic and functional analysis of murine resident and induced peritoneal macrophages. Comp Med 57:574–580. [PubMed] [Google Scholar]
  • 16.Petro TM. 2005. Disparate expression of IL-12 by SJL/J and B10.S macrophages during Theiler's virus infection is associated with activity of TLR7 and mitogen-activated protein kinases. Microbes Infect 7:224–232. doi: 10.1016/j.micinf.2004.10.014. [DOI] [PubMed] [Google Scholar]
  • 17.Agarkova IV, Dunigan DD, Van Etten JL. 2006. Virion-associated restriction endonucleases of chloroviruses. J Virol 80:8114–8123. doi: 10.1128/JVI.00486-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Van Etten JL, Burbank DE, Kuczmarski D, Meints RH. 1983. Virus infection of culturable chlorella-like algae and development of a plaque assay. Science 219:994–996. doi: 10.1126/science.219.4587.994. [DOI] [PubMed] [Google Scholar]
  • 19.Chattopadhyay S, Fensterl V, Zhang Y, Veleeparambil M, Yamashita M, Sen GC. 2013. Role of IRF-3-mediated apoptosis in the establishment and maintenance of persistent infection by Sendai virus. J Virol 87:16–24. doi: 10.1128/JVI.01853-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Amara A, Mercer J. 2015. Viral apoptotic mimicry. Nat Rev Microbiol 13:461–469. doi: 10.1038/nrmicro3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nicholson DW, Thornberry NA. 1997. Caspases: killer proteases. Trends Biochem Sci 22:299–306. doi: 10.1016/S0968-0004(97)01085-2. [DOI] [PubMed] [Google Scholar]
  • 22.Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST, van Oers MH. 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 84:1415–1420. [PubMed] [Google Scholar]
  • 23.Panaretakis T, Hjortsberg L, Tamm KP, Bjorklund AC, Joseph B, Grander D. 2008. Interferon alpha induces nucleus-independent apoptosis by activating extracellular signal-regulated kinase 1/2 and c-Jun NH2-terminal kinase downstream of phosphatidylinositol 3-kinase and mammalian target of rapamycin. Mol Biol Cell 19:41–50. doi: 10.1091/mbc.E07-04-0358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Marié I, Durbin JE, Levy DE. 1998. Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7. EMBO J 17:6660–6669. doi: 10.1093/emboj/17.22.6660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sharma S, tenOever BR, Grandvaux N, Zhou GP, Lin R, Hiscott J. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300:1148–1151. doi: 10.1126/science.1081315. [DOI] [PubMed] [Google Scholar]
  • 26.Ghoshal A, Das S, Ghosh S, Mishra MK, Sharma V, Koli P, Sen E, Basu A. 2007. Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis. Glia 55:483–496. doi: 10.1002/glia.20474. [DOI] [PubMed] [Google Scholar]
  • 27.Ribeiro BM, do Carmo MR, Freire RS, Rocha NF, Borella VC, de Menezes AT, Monte AS, Gomes PX, de Sousa FC, Vale ML, de Lucena DF, Gama CS, Macedo D. 2013. Evidences for a progressive microglial activation and increase in iNOS expression in rats submitted to a neurodevelopmental model of schizophrenia: reversal by clozapine. Schizophr Res 151:12–19. doi: 10.1016/j.schres.2013.10.040. [DOI] [PubMed] [Google Scholar]
  • 28.Jha AK, Huang SC, Sergushichev A, Lampropoulou V, Ivanova Y, Loginicheva E, Chmielewski K, Stewart KM, Ashall J, Everts B, Pearce EJ, Driggers EM, Artyomov MN. 2015. Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity 42:419–430. doi: 10.1016/j.immuni.2015.02.005. [DOI] [PubMed] [Google Scholar]
  • 29.Pearce EJ, Everts B. 2015. Dendritic cell metabolism. Nat Rev Immunol 15:18–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Everts B, Amiel E, Huang SC-C, Smith AM, Chang C-H, Lam WY, Redmann V, Freitas TC, Blagih J, van der Windt GJW, Artyomov MN, Jones RG, Pearce EL, Pearce EJ. 2014. TLR-driven early glycolytic reprogramming via the kinases TBK1-IKKε supports the anabolic demands of dendritic cell activation. Nat Immunol 15:323–332. doi: 10.1038/ni.2833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rubio N, De Felipe C, Torres C. 1990. Theiler's murine encephalomyelitis virus-binding activity on neural and non-neural cell lines and tissues. J Gen Virol 71(Pt 12):2867–2872. doi: 10.1099/0022-1317-71-12-2867. [DOI] [PubMed] [Google Scholar]
  • 32.Ross LJ, Watson DH, Wildy P. 1968. Development and localization of virus-specific antigens during the multiplication of herpes simplex virus in BHK 21 cells. J Gen Virol 2:115–122. doi: 10.1099/0022-1317-2-1-115. [DOI] [PubMed] [Google Scholar]
  • 33.Ghigo E, Kartenbeck J, Lien P, Pelkmans L, Capo C, Mege JL, Raoult D. 2008. Amoebal pathogen mimivirus infects macrophages through phagocytosis. PLoS Pathog 4:e1000087. doi: 10.1371/journal.ppat.1000087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fujimoto I, Pan J, Takizawa T, Nakanishi Y. 2000. Virus clearance through apoptosis-dependent phagocytosis of influenza A virus-infected cells by macrophages. J Virol 74:3399–3403. doi: 10.1128/JVI.74.7.3399-3403.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Dhamija S, Kuehne N, Winzen R, Doerrie A, Dittrich-Breiholz O, Thakur BK, Kracht M, Holtmann H. 2011. Interleukin-1 activates synthesis of interleukin-6 by interfering with a KH-type splicing regulatory protein (KSRP)-dependent translational silencing mechanism. J Biol Chem 286:33279–33288. doi: 10.1074/jbc.M111.264754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.McKeever PE, Balentine JD. 1978. Macrophages migration through the brain parenchyma to the perivascular space following particle ingestion. Am J Pathol 93:153–164. [PMC free article] [PubMed] [Google Scholar]
  • 37.Baron R, Babcock AA, Nemirovsky A, Finsen B, Monsonego A. 2014. Accelerated microglial pathology is associated with Aβ plaques in mouse models of Alzheimer's disease. Aging Cell 13:584–595. doi: 10.1111/acel.12210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Elderkin-Thompson V, Irwin MR, Hellemann G, Kumar A. 2012. Interleukin-6 and memory functions of encoding and recall in healthy and depressed elderly adults. Am J Geriatr Psychiatry 20:753–763. doi: 10.1097/JGP.0b013e31825d08d6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ormstad H, Verkerk R, Aass HC, Amthor KF, Sandvik L. 2013. Inflammation-induced catabolism of tryptophan and tyrosine in acute ischemic stroke. J Mol Neurosci 51:893–902. doi: 10.1007/s12031-013-0097-2. [DOI] [PubMed] [Google Scholar]
  • 40.Barbosa IG., Bauer ME., Machado-Vieira R, Teixeira AL. 2014. Cytokines in bipolar disorder: paving the way for neuroprogression. Neural Plast 2014:360481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, Frezza C, Bernard NJ, Kelly B, Foley NH, Zheng L, Gardet A, Tong Z, Jany SS, Corr SC, Haneklaus M, Caffrey BE, Pierce K, Walmsley S, Beasley FC, Cummins E, Nizet V, Whyte M, Taylor CT, Lin H, Masters SL, Gottlieb E, Kelly VP, Clish C, Auron PE, Xavier RJ, O'Neill LAJ. 2013. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature 496:238–242. doi: 10.1038/nature11986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tannahill GM, O'Neill LA. 2011. The emerging role of metabolic regulation in the functioning of Toll-like receptors and the NOD-like receptor Nlrp3. FEBS Lett 585:1568–1572. doi: 10.1016/j.febslet.2011.05.008. [DOI] [PubMed] [Google Scholar]
  • 43.Mehta DR, Ashkar AA, Mossman KL. 2012. The nitric oxide pathway provides innate antiviral protection in conjunction with the type I interferon pathway in fibroblasts. PLoS One 7:e31688. doi: 10.1371/journal.pone.0031688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Knowles RG, Palacios M, Palmer RM, Moncada S. 1989. Formation of nitric oxide from l-arginine in the central nervous system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc Natl Acad Sci U S A 86:5159–5162. doi: 10.1073/pnas.86.13.5159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Paakkari I, Lindsberg P. 1995. Nitric oxide in the central nervous system. Ann Med 27:369–377. doi: 10.3109/07853899509002590. [DOI] [PubMed] [Google Scholar]
  • 46.Yao JK, Leonard S, Reddy RD. 2004. Increased nitric oxide radicals in postmortem brain from patients with schizophrenia. Schizophr Bull 30:923–934. doi: 10.1093/oxfordjournals.schbul.a007142. [DOI] [PubMed] [Google Scholar]
  • 47.Dasgupta S, Jana M, Liu X, Pahan K. 2002. Myelin basic protein-primed T cells induce nitric oxide synthase in microglial cells. Implications for multiple sclerosis. J Biol Chem 277:39327–39333. doi: 10.1074/jbc.M111841200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Roy A, Ghosh A, Jana A, Liu X, Brahmachari S, Gendelman HE, Pahan K. 2012. Sodium phenylbutyrate controls neuroinflammatory and antioxidant activities and protects dopaminergic neurons in mouse models of Parkinson's disease. PLoS One 7:e38113. doi: 10.1371/journal.pone.0038113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sheridan C, Brumatti G, Elgendy M, Brunet M, Martin SJ. 2010. An ERK-dependent pathway to Noxa expression regulates apoptosis by platinum-based chemotherapeutic drugs. Oncogene 29:6428–6441. doi: 10.1038/onc.2010.380. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES