ABSTRACT
The selective accumulation of both DNA components of a bipartite geminivirus, Abutilon mosaic virus, was recorded during early systemic infection of Nicotiana benthamiana plants. Purified nuclei were diagnosed for viral DNA using hybridization specific for DNA A or DNA B to detect these individual genome components either alone or both simultaneously by dual-color staining. Although this virus needs both components for symptomatic infection, DNA A alone was transported to upper leaves, where it was imported into phloem nuclei and replicated autonomously. The coinfection with DNA A and DNA B revealed an independent spread of both molecules, which resulted in a stochastic distribution of DNA A- and DNA A/B-infected nuclei. A population genetics evaluation of the respective frequencies was compared to a model computation. This elucidated a surprisingly simple relationship between the initial frequencies of the viral DNA components and the number of susceptible cells during the course of early systemic infection.
IMPORTANCE For bipartite begomoviruses, DNA B-independent long-distance spread of DNA A has been described before, but it has never been shown whether viral DNA A alone invades nuclei of systemic tissues and replicates therein. This is demonstrated now for the first time. During infection with DNA A and DNA B, a similar solitary spread of DNA A can be recognized at early stages. We describe a population genetics model of how the hit probabilities of DNA A and DNA B for susceptible cells determine the relative frequencies of either genome component during the course of infection.
INTRODUCTION
When in 1908 Godfrey Harold Hardy, a professor of mathematics in Cambridge, and Wilhelm Weinberg, a physician to the poor in Stuttgart, examined mathematical rules in genetics, they founded a new discipline: population genetics (1, 2). Their simple formula (p2 + 2pq + q2 = 1) is known now as the Hardy-Weinberg law and today is a prominent feature of genetics textbooks. It can be applied to panmictic populations of diploid organisms to predict the frequencies (p and q) of two alleles of a gene in the generation of progeny. The formalism may be applied to viruses with two DNA components (DNA A and DNA B), although not directly, since one prerequisite may not be fulfilled: the viral progeny molecules are not necessarily forced to combine in the next cells, like gametes in zygotes. Nevertheless, by envisaging the interior of a plant as a microenvironment for molecular populations of viral DNA molecules, population genetics and microevolutionary scenarios may be inferred.
A corresponding more abstract and mathematical treatment of the topic was developed early for the RNA-containing tobacco mosaic virus (TMV) (3, 4). Kleczkowski examined the hypothetical numbers of infectious units in relation to those of susceptible cells in the local lesion host Nicotiana glutinosa and inferred a best-fit curve between the two numbers based on statistical considerations. The issue has been developed further to a more general concept of understanding virus populations as “quasispecies” (5), with important implications for the microevolution of bacteriophages as well as of human retroviruses. A broad literature has dealt with this question since then (for a recent application to plant viruses, see reference 6 and references therein). Following this view, a simple abstraction may help to understand the systemic infection of geminiviruses with bipartite genomes as well. Considering the initial frequencies of the DNA A (p) and DNA B (q) molecules as well as a certain number of susceptible cells in the plant as target sites of infection, it should be possible to deduce rules from the number of cells infected with DNA A, DNA B, or both DNA A and B if the number of susceptible cells is larger than p and q.
Geminiviruses are important plant pathogens with single-stranded DNA (ssDNA) in their capsids and minichromosomal double-stranded DNA (dsDNA) intermediates during replication and transcription (reviewed in reference 7). Within the genus Begomovirus, several members need two genomic components, named DNA A and DNA B, for full infection. Other members have a single DNA A-like component, in many cases together with one or more of a variety of alpha and beta satellite molecules, with modulating roles in pathogenicity, either necessary for symptom development or not (reviewed in reference 8). The DNA A-like component of monopartite geminiviruses is usually able to fully infect a host plant.
The DNA A of bipartite begomoviruses codes for functions in replication, transcriptional control, and encapsidation, whereas DNA B supplies genes for nuclear shuttling and movement from cell to cell and for long-distance transport in the plant (reviewed in reference 7). Most geminiviruses are confined to the phloem, whereas some can emigrate to mesophyll cells in natural or model hosts (reviewed in reference 9). The Abutilon mosaic virus (AbMV), used in this study, is strictly phloem limited (10–12) and infects nuclei of companion and phloem parenchyma cells (13, 14).
Although this virus is transmitted poorly by mechanical sap inoculation (15) and has lost its transmissibility by the insect vector (whitefly [Bemisia tabaci]) (16), it is delivered easily by agroinfection (17). Mixing agrobacterial cultures each of which carry a plasmid with tandem repeats of DNA A or DNA B, respectively, yields infection rates of close to 100% in the model plant Nicotiana benthamiana. Due to the phloem limitation and the mild course of infection by AbMV, the number of infected nuclei is generally low, in the range of 1% of purified nuclei from foliage leaves (18).
Using dual-color detection of hybridization signals for DNA A and DNA B in isolated nuclei as described previously (19), the accumulation of the two components in individual nuclei was monitored to reveal their fate during early systemic infection of N. benthamiana plants. Their frequencies p and q were evaluated statistically and revealed a simple relationship between the initial internal virus load and the number of susceptible cells.
MATERIALS AND METHODS
Plants, microorganisms, and general methods.
N. benthamiana Domin plants were cultivated under a 16-h light (100 kW h)/8-h dark regime at 20°C and 15°C, respectively (with 60% relative humidity and S2 safety containment) and subjected to stem agroinoculation of AbMV DNA components in the two- to three-leaf stage as described previously (20). Individual plasmid clones AbA (AbMV DNA A) and AbB (AbMV DNA B), as described previously (21) in A. tumefaciens LBA 4404 (22), were combined for full infection or applied singly; AbB alone served as mock control. Between 17 and 20 days postinoculation (dpi), leaf samples were harvested for tissue print and in situ hybridization (ISH) analyses.
Probe preparation and hybridization.
AbMV component-specific probes were generated by PCR, comprising for DNA A the portion between the start codons of AC1 and AV1 and for DNA B the portion between the BC1 and BV1 start codons. Using Taq polymerase, primers CWAC1a3 (5′ ATGCCACCGCCAAAGAAATTTAGAGTACAGG3′; nucleotides [nt] 2611 to 2632 in DNA A) and CWAV1ka (5′CCCCCATATGCCTGGAACATCAAAGAC3′; nt 388 to 407 in DNA A) yielded a fragment from nt 388 to 2632, whereas primers CWBV1a (5′CCCCCATATGTACCCGTCTAGGAATAA3′; positions 548 to 567 in DNA B) and CWBC1a (5′CCCCCCATATGGATTCTCAGTTAGTAAA3′; positions 2238 to 2257 in DNA B) yielded a fragment from nt 548 to 2257 with cloned AbMV DNAs as templates (AbMV A 1.5× in pBlueScript and AbMV B 2.0× in pBIN 19). The fragments were amplified with the following cycles: 95°C for 5 min, 62°C for 2 min, and 72°C for 3 min (1×); 95°C for 1 min, 62°C for 2 min, and 72°C for 3 min (28×); and 95°C for 1 min, 62°C for 2 min, and 72°C for 10 min (1×). Products were gel purified using a GFX elution kit (Amersham Biosciences, Uppsala, Sweden) according to the manufacturer's protocol.
Labeled probes (0.5 μg gel-purified fragments each) AbMV DNA-A-DIG, DNA-A-biotin, DNA-B-DIG, and DNA-B-biotin were prepared using either biotin- or digoxigenin (DIG) nick translation mixes according to the manufacturer's protocols (Roche Diagnostics, Mannheim, Germany). In order to remove free DIG- or biotin-dUTP, probes were further purified by anion-exchange chromatography (Tip 5; Qiagen, Hilden, Germany) and ethanol precipitated from the eluates in the presence of fish sperm DNA (1 mg/ml) as the carrier. The resulting DIG-labeled or biotinylated DNA probes were dissolved in 250 μl of H2O and stored at −20°C.
For single-genome-component detection, 0.5 μg probe DNA (DIG or biotin labeled) was incubated at 95°C for 15 min and added to 200 μl hybridization buffer (19). For double detection, 0.5 μg of each probe was added to 400 μl hybridization buffer.
Detection was performed using four conjugates, anti-DIG—alkaline phosphatase (AP), anti-DIG–peroxidase (POD), streptavidin-POD, and streptavidin-AP, as recommended by the manufacturer (Roche), using the chromogenic substrate 3,3′,5,5′-tetramethylbenzidine (TMB) of the TMB substrate kit (Vector Laboratories, Burlingame, CA, USA) for horseradish peroxidase, yielding blue signals, or Vector Red of the alkaline phosphatase substrate kit I (Vector Laboratories), yielding red signals.
Tissue blots.
To detect viral DNA in systemically infected young leaves (<3 cm in length), cross sections of three leaf petioles of each plant were printed on a Hybond N+ nylon membrane (Amersham Biosciences) in parallel with samples of mock-inoculated plants. Hybridization with DIG-labeled probes and probe visualization with nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) chromogenic substrate and AP has been described previously (23).
Isolation of nuclei.
The protocol for isolation of nuclei is based on a method described previously (18). Young leaves (<3 cm) of N. benthamiana plants were harvested and immersed in ice-cold homogenization buffer (1 M hexylene glycol [2-methyl-2,4-pentanediol; Merck, Darmstadt, Germany], 10 mM morpholinepropanesulfonic acid [MOPS] [pH 7.0], 10 mM MgCl2, 0.01% [wt/vol] polyvinylpyrrolidone [PVP-40] [Sigma-Aldrich, Taufkirchen, Germany], freshly supplemented with 5 mM 2-mercaptoethanol), and the following procedures were performed in the cold room on ice. Centrifugations were done in a Biofuge-13 (Heraeus Sepatech, Osterode, Germany) with a swing-out rotor.
The leaf material was ground in a Waring blender with a 200-ml jar at full speed for 2 min with 5-s intervals. Gross debris was removed by filtration through four sheets of gauze. The detergent Brij 35 (Sigma-Aldrich) was added dropwise to the filtrate under continuous stirring to reach a final concentration (f.c.) of 0.45% (vol/vol), and the suspension rotated further for 5 min.
The cleared suspension was filtered twice through 8 sheets and 16 sheets of gauze. The filtrate was centrifuged (600 rpm, 30 min, 0°C, with brake), the supernatant discarded, and the pellet resuspended in 8 ml gradient buffer (0.5 M hexylene glycol, 10 mM MOPS [pH 7.0], 10 mM MgCl2, 0.3% [vol/vol] Brij 35, 5 mM 2-mercaptoethanol) per gram (fresh weight) of plant material. Twenty milliliters of the suspension per tube was layered on a Percoll (Amersham Biosciences) step gradient (90% [vol/vol], 6 ml; 60%, 8 ml; and 30%, 5 ml [in gradient buffer]). After centrifugation (1,100 rpm, 30 min, 0°C, without brake), nuclei were collected from the 60 to 90% interface in a 5-ml total volume, which was diluted with 25 ml gradient buffer and centrifuged (1,000 rpm, 30 min, 0°C, with brake). The pellet was resuspended in 40 ml gradient buffer and centrifuged (600 rpm, 0°C, with brake), and the resulting washed nuclei were taken in 250 μl gradient buffer without mercaptoethanol for light microscopic examination. Purified nuclei were stored frozen at −80°C or fixed chemically [6% f.c. formaldehyde in microtubule-stabilizing buffer (MTSB) (50 mM piperazine-N,N′-bis(2-ethanesulfonic acid) (PIPES)-KOH (pH 6.9), 5 mM EGTA, 5 mM MgSO4, f.c.] and stored at 4°C.
In situ hybridization of viral DNA in purified nuclei.
Microscope slides were cleaned (24 h in chromic-sulfuric acid, three times in tap water for 10 s each, once in deionized water, and once in distilled water, with drying at 60°C) and dipped into poly-l-lysine solution (catalog no. P8920; Sigma-Aldrich) diluted 1:10 in H2O at room temperature for 5 min. After removing excess solution, slides were dried at 60°C for 1 h or at room temperature over night. Per 5- by 5-mm square, 0.5 μl of the purified nuclei suspension was applied and dried at room temperature overnight.
Loaded slides were placed in the humid chamber of a thermal cycler (Hybaid Omnislide; MWG-Biotech AG, Ebersberg, Germany), and areas with immobilized nuclei were covered with 500 μl prehybridization solution (10 mM Tris-HCl [pH 7.5], 1 mM Na-EDTA, 600 mM NaCl, 1× Denhardt mix, 500 μg/ml sheared fish sperm DNA, 50% [vol/vol] deionized formamide) and incubated at 80°C for 10 to 15 min and at 42°C for 4 to 5 h. Probes were diluted in hybridization solution (10 mM Tris-HCl [pH 7.5], 1 mM Na-EDTA, 600 mM NaCl, 500 μg/ml sheared fish sperm DNA, 5% [wt/vol] dextran sulfate, 50% [vol/vol] deionized formamide, 0.8 ng/μl probe DNA), denatured at 80°C for 15 min, and replaced against the prehybridization solution (30 μl per nucleus immobilization area) to hybridize against viral DNA during the following program in the thermal cycler under a coverslip: 5 min at 80°C, 30 s at 75°C, 30 s at 70°C, 30 s at 50°C, 30 s at 45°C, and 16 to 20 h at 42°C. Thereafter, samples were washed twice at 42°C for 30 min in wash solution 1 (2× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 10 mM Na-EDTA, pH 7.0), once at 65°C for 15 min in wash solution 2 (1× SSC, 10 mM Na-EDTA, pH 7.0), twice at 42°C for 30 min in wash solution 1, and once in ice-cold H2O for 5 s.
For signal detection, the hybridized slides were incubated in AP buffer 1 (100 mM Tris-HCl [pH 7.5], 150 mM NaCl) at room temperature for 10 min, followed by incubation in 500 μl blocking solution (5% [wt/vol] bovine serum albumin [BSA] in AP buffer 1) at room temperature for 1 h in a humid chamber. Blocking solution was removed as carefully as possible and replaced by 140 μl conjugate solution (3 μl antibody or streptavidin conjugate solution per ml AP dilution buffer consisting of 1% [wt/vol] BSA in AP buffer 1), with further incubation for 60 to 90 min. Washings were done in AP buffer 1 twice for 15 min to remove surplus conjugate and once in AP buffer 3 (100 mM Tris-HCl [pH 9.5], 100 mM NaCl, 50 mM MgCl2) for 5 min for equilibration.
After removing excess buffer from the slides, 140 μl detection solution was added and covered by a coverslip. Detection solutions from Vector Laboratories were used according to the provider's protocol: for Vector Red alkaline phosphatase substrate kit I this was 5 ml Tris-HCl (pH 8.2), 2 drops reagent 1, 2 drops reagent 2, and 2 drops reagent 3, and for the TMB substrate kit for horseradish peroxidase it was 5 ml H2O, 2 drops buffer stock solution, 3 drops TMB stock solution, 2 drops stabilization solution, and 2 drops H2O2 stock solution.
Vector Red substrate was incubated at 37°C for 30 to 40 min, and TMB was incubated at room temperature for 10 min in the dark. In double-detection experiments, the AP reaction was followed by the POD reaction as described previously (24). Between the two detection stages, slides were washed with H2O and AP buffer 3. Final washing in H2O was followed by drying at room temperature and, after storage in the dark, by microscopy. The samples were mounted in VectaMount (permanent mounting medium; Vector Laboratories) and dried at room temperature overnight.
Light microscopy was performed using a Zeiss Axiophot and transmitted light adjusted to a color temperature of 3200 K with a dark gray filter, mostly at a magnification of ×400 (40× objective lens). To obtain comparable image color documentation for all samples, the Canon PowerShot G1 camera was exposed at 1/60 s with a 3.2 aperture. Electronic images were processed in SigmaScan Pro version 5.0.0 (SPSS Inc., Erkrath, Germany) to investigate the color composition of stains on nuclei hybridized with virus DNA component-specific probes.
Model calculations.
Model computation of the statistical chances of DNA A and DNA B to reach 1 out of 100 susceptible cells were performed with the aid of Microsoft Excel. In a spreadsheet, 100 cells were independently assigned to DNA A and DNA B per cell by chance with the frequencies p and q. The resulting frequencies of DNA A, DNA B, and DNA A and B, as well as empty cells, were counted, from which relative values for DNA A- or DNA A- and B-containing cells were calculated. The resulting best-fit curves (see Fig. 6) are polynomic approximations of second order.
FIG 6.
Model computation results for different initial frequencies of DNA A or DNA B (px initial; both equal) after randomized distribution to 100 cells. Four y values per x value represent repeated calculations for DNA A (red circles)- or DNA A and B (blue-filled red circles)-containing cells in relative proportions (DNA A only/DNA A and B). Boxes for the determined values in Table 2 for 17 dpi, 19 dpi, and 20 dpi show the projections of the observed data to the model data. Interestingly, these projections were found not as an arbitrary distribution but as a systematic trend, which can explain nicely the varying primary data depending on the growth of the viral population during the time course of infection.
RESULTS
After a first (local) infection is raised by pinpricking agroinfectious clones of the begomoviral genome components into shoot nodes of N. benthamiana seedlings, initial viral multiplication and cell-to-cell spread are limited to tissues close to these inoculation sites. A second phase follows, with long-distance transport of viral DNAs in phloem sieve elements and phloem-internal (systemic) infection of the next nucleate cells after egress from the sieve tubes, predominantly in sink tissues of developing organs. Bipartite geminiviruses could have evolved different options to disseminate their genomic components during the latter process: (i) independent DNA A and DNA B transport, (ii) coupled DNA A and DNA B transport, or (iii) high internal infection pressure to ensure statistically that DNA A and DNA B meet in the next accessible cells of target organs by chance. Although bipartite begomoviruses, by definition, need both DNA components for full infection, it was observed early that some DNA A transport to systemic leaves can occur in the absence of DNA B, namely, for AbMV (17) and African cassava mosaic virus (25) in N. benthamiana. Whether this transport is productive and is followed by nuclear import and replication has never been examined in closer detail.
In order to investigate the DNA B-independent spread of AbMV DNA A, N. benthamiana plants were agroinfected with DNA A alone, and its systemic spread was monitored first by tissue blot hybridization with DNA A-specific probes employed on prints of leaf petioles from above the inoculation site (Fig. 1; Table 1). In five independent experiments at an early stage of infection (17 to 20 days postinoculation [dpi]), 44% ± 16% (arithmetic mean ± standard deviation) of the plants showed definite hybridization signals, which appeared as single or a few dots per petiole cross section as usual for a phloem-limited geminivirus (10). All these plants lacked symptoms, like the mock-inoculated control plants (data not shown). This result confirmed earlier observations for AbMV and other begomoviruses of a relevant DNA B-independent spread of DNA A (17, 20, 25) but did not answer whether DNA A enters next nuclei in phloem cells of upper leaves. Therefore, a second approach was used: nuclei of these plants were purified and subjected to in situ hybridization with a DNA A-specific probe (Fig. 2). Strong hybridization signals (red color) occurred and were indeed confined to nuclei at the expected low concentration (see below). Not only does this result show that DNA A alone is imported into nuclei, but the strength of the signals also supports the interpretation that DNA A must have been replicated in these nuclei. Thus, DNA A is independently mobile in the plant.
FIG 1.
Tissue blot hybridization detecting geminiviral DNA in leaf petioles from systemically infected shoots at 17 days after mock (3 plants), AbMV DNA A (30 plants), or DNA A and DNA B (30 plants) agroinoculation. After hybridization with a DNA A-specific probe, signals were detected via NBT-BCIP staining. Petiole pigments indicate positions of cross-sectional prints (three per plant). Samples judged to be positive for infection are highlighted by boxes.
TABLE 1.
Systemic infection rates upon agroinoculation with AbMV DNA A alone as determined by tissue blot hybridization
| Expt | dpi | No. of inoculated plants | No. of infected plants | % of infected plants |
|---|---|---|---|---|
| 1 | 17 | 29 | 12 | 41 |
| 2 | 20 | 59 | 25 | 42 |
| 3 | 19 | 78 | 45 | 58 |
| 4 | 20 | 91 | 53 | 58 |
| 5 | 18 | 120 | 24 | 20 |
| Mean ± SD | 44 ± 16 |
FIG 2.
Ensembles of nuclei from plants infected with AbMV DNA A alone after in situ hybridization with DNA A-DIG probe, treatment with DIG-AP conjugate, and Vector Red substrate. Clear and strong red signals within inclusion bodies support the conclusion that DNA A can enter nuclei and is amplified in the infected cells. Bars, 10 μm.
Next, it was interesting to know whether this autonomous tropism is also true during combined infection with DNA B. To answer this question, plants were agroinfected with DNA A and DNA B, their nuclei purified, and viral DNA types therein selectively detected by dual-color staining of the hybridization probes. Different combinations of probes and detection procedures were tested (data not shown). Since the combination shown in Fig. 3 allowed for a similarly sensitive detection of DNA A and DNA B simultaneously, it was chosen for all subsequent tests. Upon single detection, red DNA A and blue DNA B was clearly discriminated (Fig. 3I and II), whereas in double detection, various shades of violet (Fig. 3III and IV) in addition to the pure colors were observed. Faint background color as well as low background spots in the various control samples, including nuclei from mock-inoculated plants and samples treated with hybridization buffer lacking probe DNA, were different enough to judge the strong signals within the nuclei as proper viral DNA indicators. As documented in Fig. 4, the appearance of differentially colored nuclei in the same area demonstrates the power of the differentiation. Furthermore, the violet colors of doubly labeled nuclei can be efficiently discriminated from the singly labeled samples (Fig. 5a versus b and c) at higher magnification. To scrutinize this subjective assignment of colors, the electronic images taken under the same photographic conditions were analyzed using image evaluation software (data not shown). Most of the assignments were supported by this more objective assessment, although differentiation between the red and the violet nuclei was easier and more efficient than that between the blue and the violet, for both the red and the blue colors. The bias with this color combination, however, is less important for the conclusions if DNA B alone has no chance for replication in systemically infected cells, as discussed below.
FIG 3.
Experimental design for comparative nuclei labeling by in situ hybridization. Treatments I to VIII were done on nuclei from virus-infected and mock-inoculated plants immobilized on the same respective slide (grid patterns contain 12 samples/slide) and revealed the expected color changes as exemplified by the images below. Strong signals concentrated in the nuclei from virus-infected plants were taken as virus positive (I to IV); faint background color can be discriminated reliably. Bars, 10 μm.
FIG 4.
Nuclei as in Fig. 3 but after infection of the plants with DNA A and DNA B. In situ hybridization with DNA A-DIG and DNA B-biotin probe, detection via DIG-AP and S-POD conjugate, and serial application of Vector Red and TMB substrates were performed. Red (DNA A), blue (DNA B), and violet (DNA A and B) can be differentiated. Bars = 10 μm.
FIG 5.
Nuclei as in Fig. 4 at higher magnification. (a) Double labeling of DNA A and B; (b) single labeling of DNA B (blue); (c) single labeling of DNA A (red). Bars, 10 μm.
On this basis, six in situ hybridization assays from four independent nuclei preparations were evaluated quantitatively (Table 2). Although some variability between experiments has to be considered, in total 42% of the infected nuclei were definitively red and thus contained DNA A alone, 8% appeared blue and thus had only DNA B, and 50% were violet as a sign of mixed DNA A and B accumulation. Of course, traces of one component on the background of the other cannot be excluded, but this would not change the results for the model discussed below. Since we have used DNA B alone as mock controls routinely during the past decades and have not detected any DNA A-independent replication of this component, it is likely that the few blue nuclei have to be counted as DNA A/B-infected nuclei with a low DNA A proportion. The overall ratio then would be 42% DNA A to 58% DNA A/B.
TABLE 2.
Relationship of nuclei infected with AbMV DNA A, DNA B, or botha
| Slide | ISH expt | Nucleus prepn | dpi | No. of signal-containing nuclei/2,000 nuclei |
|||
|---|---|---|---|---|---|---|---|
| AbMV A (red) | AbMV B (blue) | AbMV A+B (violet) | Total | ||||
| 71 | 1 | 1 | 17 | 6 | 0 | 2 | |
| 8 | 0 | 0 | |||||
| 5 | 0 | 4 | |||||
| 2 | 6 | 3 | |||||
| 9 | 0 | 2 | |||||
| 16 | 0 | 2 | |||||
| 23 | 0 | 8 | |||||
| 72 | 0 | 2 | 0 | ||||
| 9 | 0 | 0 | |||||
| 4 | 0 | 7 | |||||
| 9 | 2 | 0 | |||||
| 3 | 3 | 5 | |||||
| 8 | 1 | 6 | |||||
| 29 | 0 | 0 | |||||
| 91 | 2 | 3 | 0 | 4 | |||
| 0 | 1 | 10 | |||||
| Total | 134 | 15 | 53 | 202 | |||
| % of total | 66 | 7 | 26 | ||||
| 205 | 3 | 2 | 20 | 6 | 4 | 16 | |
| 205 | 6 | 6 | 17 | ||||
| 8 | 7 | 22 | |||||
| Total | 20 | 17 | 55 | 92 | |||
| % of total | 22 | 18 | 60 | ||||
| 208 | 4 | 3 | 19 | 7 | 0 | 0 | |
| 208 | 7 | 0 | 6 | ||||
| 11 | 0 | 6 | |||||
| 225 | 5 | 6 | 1 | 15 | |||
| 7 | 6 | 12 | |||||
| 8 | 1 | 17 | |||||
| Total | 46 | 8 | 56 | 110 | |||
| % of total | 42 | 7 | 51 | ||||
| 228 | 6 | 4 | 20 | 9 | 4 | 15 | |
| 228 | 21 | 4 | 54 | ||||
| 26 | 2 | 71 | |||||
| Total | 56 | 10 | 140 | 206 | |||
| % of total | 27 | 5 | 68 | ||||
| Total | 256 | 50 | 304 | 610 | |||
| % of total | 42 | 8 | 50 | ||||
After double labeling, nuclei were counted according to their red, blue, or violet signals. Note that blue signals may be overestimated if only a small amount of red stain is present in the same nucleus.
These results support the notion that DNA A and DNA B spread independently through the phloem and at a low rate during this early stage of infection. The relatively high number of nuclei that contain only DNA A hints at a low ratio of founder molecules to the amount of susceptible cells. To further scrutinize this ratio, a control experiment was performed for which nuclei from doubly infected plants were hybridized with both probes and incubated with both substrates, but one of the conjugates was omitted to reveal pure red or blue colors. In addition, an inverted-color probe/substrate combination was applied, staining DNA B targets red (Table 3). The results revealed the same trend and a significant difference for DNA A and DNA B detection: 1.05% ± 0.22% of the isolated nuclei contained DNA A-specific label, and 0.74% ± 0.14% contained DNA B-specific label. Assuming that DNA B alone is unable to replicate and, consequently, to generate a relevant signal in the nuclei (DNA B = 0), the frequency of DNA A alone was 0.4% and that of DNA A/B was 0.7%, or the relative ratio was 36% ± 18% for DNA A alone and 63% ± 18% for DNA A/B. This approximates, within the limits of determination, roughly the simple equation 2p + q = 1 for the frequencies of DNA A (p) and DNA B (q), indicating that probably the same numbers of DNA B molecules are transported, although not all are propagated and remain “lethal,” if entering a nucleus alone. Note that both complementary double-detection systems revealed ratios of the same dimensions (42:58 versus 36:63). The initial frequencies p and q may vary at the beginning of an inoculation experiment and between experiments, as indicated by the variation shown in Table 2, as discussed below. However, since the frequencies p and q are interdependent due to the helper function of DNA B on the transport of DNA A, as well as of DNA A on the replication of DNA B, an equilibrium state can be expected after a certain time.
TABLE 3.
Control experiments to compare efficiencies of signal detectiona
| Slide | ISH expt | Color (DNA) | No. of nuclei |
% detection | ||
|---|---|---|---|---|---|---|
| Total | Red | Blue | ||||
| 242 | 1 | Red (A) | 3,021 | 37 | 0 | 1.2 |
| 2,417 | 22 | 0 | 1.2 | |||
| 243 | 2,556 | 34 | 0 | 1.3 | ||
| 2,728 | 30 | 0 | 1.1 | |||
| 124 | 2 | 1,031 | 8 | 0 | 0.8 | |
| 2,085 | 15 | 0 | 0.7 | |||
| Mean ± SD | 1.05 ± 0.22 | |||||
| 244 | 1 | Blue (B) | 2,350 | 0 | 21 | 0.9 |
| 2,417 | 0 | 22 | 0.9 | |||
| 245 | 2,780 | 0 | 20 | 0.7 | ||
| 123 | 2 | Red (B) | 1,795 | 10 | 0 | 0.6 |
| 1,955 | 12 | 0 | 0.6 | |||
| Mean ± SD | 0.74 ± 0.14 | |||||
After double detection as described for Table 2, one of the conjugates (DIG-AP or S-POD) was omitted, and one experiment with red detection of DNA B was added. The difference of detection for both DNAs was significant (t test, P < 0.04).
DISCUSSION
The clear separation of red and blue/violet signals, i.e., of DNA A- and DNA A/B-containing nuclei, indicates that only few viral molecules reach a relatively large number of susceptible cells at the first stage of systemic infection and that both components move independently. Correspondingly, only a low number of nuclei were infected by AbMV DNAs. Using the same technique, the coinfection of two closely related monopartite begomoviruses, tomato yellow leaf curl virus (TYLCV) and tomato yellow leaf curl Sardinia virus (TYLCSV), showed a similar segregation of the progeny for the respective single or combination of viruses in Solanum lycopersicum (1.3%:1.8%:1.3%) and N. benthamiana (5.5%:7.4%:6.4%) plants, with a remarkable proportion of coinfected nuclei (19). Although the infection rates were different in the two hosts, these values translate to similar relative frequencies (30:41:30 or 28:38:33). This is roughly a one-to-one ratio for TYLCV (p) and TYLCSV (q), assuming that the doubly infected nuclei were hit by both viruses at equal frequencies on average. There is currently no hint that TYLCV and TYLCSV are genetically interdependent, although symptoms were synergistically enhanced upon coinfection. Whether similar ratios can be observed for other virus-host combinations is currently unknown. In contrast, AbMV DNA A and DNA B depend on each other, at least partially.
This is the first report that definitively shows independent transport through the plant, import into new nuclei, and replication there of DNA A alone. Considering the low frequencies discussed above, only few founder molecules can have entered every next target nucleus, which would not have been detected as a strong signal by the in situ hybridization technique applied. Consequently, the observed signals likely do represent viral DNA after amplification at this site. An autonomous spread of agrobacteria has been considered and discussed earlier (17) but is not likely to occur in N. benthamiana, since in situ hybridization with probes comprising the nontransferred vir genes did not show any signal in previous work (C. Wege, unpublished data).
Contrary to expectations, blue nuclei were detected, although at low frequency. A software-aided evaluation of the color channels in electronic images (data not shown) revealed that the subjectively assigned colors were not well separated for individual data points, in spite of the discriminating trend lines. The control experiment reported in Table 3 showed that blue or red detection of DNA B yielded similar values. Therefore, the blue nuclei may be explained either by a technical limit to detect a small amount of red stain blended with a strong blue signal or by a coinfection with variant DNA A molecules of the quasispecies population that are impaired in their own replication. For the population genetics view in this case, it may be justified to count the blue nuclei as doubly infected because of the broad knowledge that DNA B is not able to replicate alone.
In order to deepen the understanding of the data obtained, a simple model with a numerical approximation for the hit statistics of viral DNA in susceptible cells has been developed using Microsoft Excel-aided calculations. With the assumption that DNA A and DNA B of similar titers encounter susceptible cells independently at various ratios and by chance, repetitive computations yielded clouds of values. These can be approximated by polynomic curves (Fig. 6) for the ratios of DNA A- or DNA A/B-containing cells with respect to the ratios of viral DNAs and cells. The two curves cross over at a certain point of initial viral DNA frequencies, separating a stage in which DNA A alone is most prominent from another in which DNA A/B levels dominate. This result may already explain the seemingly contradictory distributions of the respective values in Table 2. Moreover, and most interestingly, when the observed data were used to find the projections in the model calculation (Fig. 6, boxes), a remarkable correlation between the time course of infection (Fig. 6, dpi) and the kind of ratio was revealed. What was discussed in Results just as a variation now becomes a systematic trend: higher initial virus levels during the progress of systemic infection will necessarily result in more cells that were hit by the two DNA components simultaneously.
The population genetics view thus elucidates a simple stochastic topic to improve the understanding of early systemic geminivirus infection.
ACKNOWLEDGMENTS
We thank Werner Preiss, Conny Kocher, Sigi Kober, and Alexandra Schwierzok for excellent technical assistance, Björn Krenz for helpful discussions, and Diether Gotthardt for caring for the plants.
REFERENCES
- 1.Hardy GH. 1908. Mendelian proportions in a mixed population. Science 28:49–50. doi: 10.1126/science.28.706.49. [DOI] [PubMed] [Google Scholar]
- 2.Weinberg W. 1908. Über den Nachweis der Vererbung beim Menschen. Jahreshefte Vereins Vaterländische Naturkunde Württemberg 64:369–382. [Google Scholar]
- 3.Kleczkowski A. 1950. Interpreting relationships between the concentrations of plant viruses and numbers of local lesions. J Gen Microbiol 4:53–69. doi: 10.1099/00221287-4-1-53. [DOI] [PubMed] [Google Scholar]
- 4.Kleczkowski A. 1949. The transformation of local lesion counts for statistical analysis. Ann Appl Biol 36:139–152. doi: 10.1111/j.1744-7348.1949.tb06404.x. [DOI] [PubMed] [Google Scholar]
- 5.Biebricher CK, Eigen M. 2006. What is a quasispecies? Curr Top Microbiol Immunol 299:1–31. [DOI] [PubMed] [Google Scholar]
- 6.Gonzalez-Jara P, Fraile A, Canto T, Garcia-Arenal F. 2009. The multiplicity of infection of a plant virus varies during colonization of its eukaryotic host. J Virol 83:7487–7494. doi: 10.1128/JVI.00636-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Jeske H. 2009. Geminiviruses. Curr Top Microbiol Immunol 331:185–226. [DOI] [PubMed] [Google Scholar]
- 8.Briddon RW, Stanley J. 2006. Subviral agents associated with plant single-stranded DNA viruses. Virology 344:198–210. doi: 10.1016/j.virol.2005.09.042. [DOI] [PubMed] [Google Scholar]
- 9.Wege C. 2007. Movement and localization of Tomato yellow leaf curl viruses in the infected plant, p 185–206. In Czosnek H. (ed), Tomato yellow leaf curl virus disease. Springer, Dordrecht, The Netherlands. [Google Scholar]
- 10.Wege C, Saunders K, Stanley J, Jeske H. 2001. Comparative analysis of tissue tropism of bipartite geminiviruses. J Phytopathol 149:359–368. doi: 10.1046/j.1439-0434.2001.00640.x. [DOI] [Google Scholar]
- 11.Wege C, Gotthardt RD, Frischmuth T, Jeske H. 2000. Fulfilling Koch's postulates for Abutilon mosaic virus. Arch Virol 145:2217–2225. doi: 10.1007/s007050070052. [DOI] [PubMed] [Google Scholar]
- 12.Horns T, Jeske H. 1991. Localization of Abutilon mosaic virus DNA within leaf tissue by in-situ hybridization. Virology 181:580–588. doi: 10.1016/0042-6822(91)90891-E. [DOI] [PubMed] [Google Scholar]
- 13.Jeske H, Menzel D, Werz G. 1977. Electron microscopic studies on intranuclear virus-like inclusions in mosaic-diseased Abutilon sellowianum Reg. Phytopathol Z 89:289–295. doi: 10.1111/j.1439-0434.1977.tb02869.x. [DOI] [Google Scholar]
- 14.Abouzid AM, Barth A, Jeske H. 1988. Immunogold labeling of the Abutilon mosaic virus in ultrathin sections of epoxy resin embedded leaf tissue. J Ultrastruct Res 99:39–47. [Google Scholar]
- 15.Wege C, Pohl D. 2007. Abutilon mosaic virus DNA B component supports mechanical virus transmission, but does not counteract begomoviral phloem limitation in transgenic plants. Virology 365:173–186. doi: 10.1016/j.virol.2007.03.041. [DOI] [PubMed] [Google Scholar]
- 16.Höhnle M, Höfer P, Bedford ID, Briddon RW, Markham PG, Frischmuth T. 2001. Exchange of three amino acids in the coat protein results in efficient whitefly transmission of a nontransmissible Abutilon mosaic virus isolate. Virology 290:164–171. doi: 10.1006/viro.2001.1140. [DOI] [PubMed] [Google Scholar]
- 17.Evans D, Jeske H. 1993. DNA B facilitates, but is not essential for, the spread of Abutilon mosaic virus in agroinoculated Nicotiana benthamiana. Virology 194:752–757. doi: 10.1006/viro.1993.1316. [DOI] [PubMed] [Google Scholar]
- 18.Pilartz M, Jeske H. 2003. Mapping of Abutilon mosaic geminivirus minichromosomes. J Virol 77:10808–10818. doi: 10.1128/JVI.77.20.10808-10818.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Morilla G, Krenz B, Jeske H, Bejarano ER, Wege C. 2004. Tete a tete of tomato yellow leaf curl virus and tomato yellow leaf curl Sardinia virus in single nuclei. J Virol 78:10715–10723. doi: 10.1128/JVI.78.19.10715-10723.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pohl D, Wege C. 2007. Synergistic pathogenicity of a phloem-limited begomovirus and tobamoviruses despite negative interference. J Gen Virol 88:1034–1040. doi: 10.1099/vir.0.82653-0. [DOI] [PubMed] [Google Scholar]
- 21.Frischmuth T, Roberts S, von Arnim A, Stanley J. 1993. Specificity of bipartite geminivirus movement proteins. Virology 196:666–673. doi: 10.1006/viro.1993.1523. [DOI] [PubMed] [Google Scholar]
- 22.Hoekema A, Hirsch PR, Hooykaas PJJ, Schilperoort RA. 1983. A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303:179–180. doi: 10.1038/303179a0. [DOI] [Google Scholar]
- 23.Richter K, Kleinow T, Jeske H. 2014. Somatic homologous recombination in plants is promoted by a geminivirus in a tissue-selective manner. Virology 452:287–296. doi: 10.1016/j.virol.2014.01.024. [DOI] [PubMed] [Google Scholar]
- 24.Hopman AH, Wiegant J, Raap AK, Landegent JE, van der Ploeg M, van Duijn P. 1986. Bi-color detection of two target DNAs by non-radioactive in situ hybridization. Histochemistry 85:1–4. doi: 10.1007/BF00508646. [DOI] [PubMed] [Google Scholar]
- 25.Klinkenberg FA, Stanley J. 1990. Encapsidation and spread of African cassava mosaic virus DNA A in the absence of DNA B when agroinoculated to Nicotiana benthamiana. J Gen Virol 71:1409–1412. doi: 10.1099/0022-1317-71-6-1409. [DOI] [Google Scholar]






