Glycyrrhizic Acid-Mediated Subdual of Myeloid-Derived Suppressor Cells Induces Antileishmanial Immune Responses in a Susceptible Host

Abstract

CD11b⁺ Gr1⁺ myeloid-derived suppressor cells (MDSCs), a heterogeneous population of precursor cells, modulate protective immunity against visceral leishmaniasis by suppressing T cell functions. We observed that CD11b⁺ Gr1⁺ MDSCs, which initially expanded in soluble leishmanial antigen (SLA)-immunized mice and later diminished, suppressed proliferation of T cells isolated from SLA-immunized mice, but to a lesser extent than the case in naive mice. This lesser suppression of MDSCs accompanied the expression of F4/80 and the production of Cox-2, arginase I, nitric oxide, and PGE2. However, with SLA immunization, there was no difference in the expression of interleukin-2 (IL-2) or gamma interferon (IFN-γ) by T cells, in contrast to the case in nonimmunized mice, in which there is an influence. Glycyrrhizic acid (a triterpenoid compound)-mediated inhibition of Cox-2 in myeloid-derived suppressor cells influenced the capacity of T cells to proliferate and the expression of IL-2 and IFN-γ in Leishmania donovani-infected BALB/c mice. Further characterization confirmed that administration of glycyrrhizic acid to L. donovani-infected BALB/c mice results in an impairment of the generation of MDSCs and a reciprocal organ-specific proliferation of IFN-γ- and IL-10-expressing CD4⁺ and CD8⁺ T cells. Comprehensive knowledge on the Cox-2-mediated regulation of myeloid-derived suppressor cells might be involved in unlocking a new avenue for therapeutic interventions during visceral leishmaniasis.

INTRODUCTION

Visceral leishmaniasis (VL), or kala-azar, caused by the protozoan parasite Leishmania donovani, is the most severe form of leishmaniasis (1–3). A major obstacle is imposed by immunosuppression during successful therapy against VL. In particular, myeloid-derived suppressor cells (MDSCs) coexpressing the CD11b (α chain of α_Mβ₂ integrin; found on monocytes and granulocytes) and Gr1 (glycosylphosphatidylinositol [GPI]-linked myeloid differentiation marker) antigens in mice were recently implicated in this context. Although CD11b⁺ Gr1⁺ cells are not exclusively suppressor cells, suppressor cells are included in this population (4, 5). Originally described in 1984 as “natural suppressor cells” (6), MDSCs recently gained much attention in various infection and inflammation models, including models of Leishmania infection (7–10). Besides the lymphocytic population of regulatory T cells (Tregs), MDSCs have a myeloid origin and evoke a suppressive function on T cells (11, 12), dampening immunotherapy. The intrinsic susceptibility of the Ethiopian population suffering from leishmaniasis through the generation of myeloid cells indicates the significance of myeloid cells (among which MDSCs are included) from a therapeutic point of view (13). Despite suppressed T cell functions, Gr1⁺ cells have been shown to be essential for the production of early Th1 cytokines in murine draining lymph nodes (14). However, the suppression mechanism of MDSCs includes production of cyclooxygenase-2 (Cox-2) and arginase I and blocking of T cell function by depleting l-arginine (15). Interestingly, pharmacological inhibition of Cox-2 blocked the expression of arginase I in lung carcinoma (16), though it was not clear how suppression of Cox-2 in MDSCs could affect Leishmania infection in a susceptible host.

On the other hand, glycyrrhizic acid (GA), a predominant bioactive component of the root of Glycyrrhiza glabra, has been reported to evoke antileishmanial activity through regulation of Cox-2 production (17). MDSCs exert a suppressive function on T cells that is dependent on the production of arginase I (11, 12). We aimed to investigate how MDSCs and their pharmacological manipulation affect the host immune response against L. donovani infection. Here we show that MDSCs from soluble leishmanial antigen (SLA)-immunized BALB/c mice are less immunosuppressive than infection-induced MDSCs and fail to inhibit the induction of Th1 cytokines. Immunization of BALB/c mice with SLA resulted in reduced production of arginase I, Cox-2, inducible nitric oxide synthase (iNOS), and prostaglandin E2 (PGE2) in MDSCs. Moreover, pharmacological inhibition of Cox-2 by GA in BALB/c mice rendered the MDSCs nonsuppressive. In summary, we demonstrated an antileishmanial effect of Cox-2 inhibition by GA in myeloid-derived suppressor cells, a strategy that may be useful for eliminating the suppressive effect of MDSCs in relevant pathological contexts.

MATERIALS AND METHODS

Reagents and chemicals.

RPMI 1640 medium, M-199 medium, penicillin, streptomycin, and Tri reagent were purchased from Sigma-Aldrich (St. Louis, MO). Fetal calf serum (FCS) was purchased from Gibco BRL (Grand Island, NY). Deoxynucleoside triphosphates (dNTPs), Revert Aid Moloney murine leukemia virus (M-MuLV) reverse transcriptase, oligo(dT), RNase inhibitor, and other chemicals required for cDNA synthesis were bought from Fermentas (Ontario, Canada). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies were obtained from Santa Cruz Biotechnology (San Jose, CA). [³H]thymidine was obtained from Amersham Biosciences. Primers for reverse transcriptase PCR (RT-PCR) were purchased from Bangalore Genei (India). GA was isolated from licorice root and then purified and characterized (18); the lipopolysaccharide (LPS) level was <0.1 ng/mg.

Animals and parasites.

BALB/c mice were purchased from the National Centre for Laboratory Animal Sciences (India). L. donovani strain AG-83 (MHOM/IN/1983/AG-83) was maintained in vitro in medium 199 (Sigma-Aldrich) containing 10% fetal calf serum (Gibco BRL, NY). Stationary-phase promastigotes obtained by suitable transformation were used for experiments. Six- to 8-week-old BALB/c mice were injected intravenously via the tail vein with 2 × 10⁷ L. donovani promastigotes (19). Treated mice were sacrificed at the times indicated in the figures. This study was carried out in strict accordance with the recommendations of the Institutional Animal Ethical Committee of the Bose Institute (registration number 1796/PO/ERe/S/14/CPCSEA).

Preparation of SLA and immunization of mice.

Late-log-phase promastigotes of L. donovani were used to prepare SLA as previously described (20). In brief, 2 × 10⁸ promastigotes/ml were washed in chilled sterile phosphate-buffered saline (PBS). Upon five cycles of freezing and thawing, the suspension was cleared by centrifugation at 8,000 × g for 20 min at 4°C, and the supernatant was collected and stored at −80°C. The protein concentration of the supernatant containing SLA was estimated by the Bradford method (21). BALB/c mice were injected intraperitoneally with 5 μg of SLA in 100 μl of Freund's complete adjuvant (FCA; Sigma-Aldrich). One month later, mice were boosted (Freund's incomplete adjuvant [FIA] replaced FCA), and 8 weeks after the initial injection, mice were challenged with different dilutions of L. donovani parasites to monitor the course of successful immunization every week compared with the nonimmunized infected BALB/c mice (22). MDSCs were collected 4 weeks after the booster dose was administered.

Treatment schedule.

After 2 weeks of L. donovani infection, various groups of infected mice (five mice per group) were administered glycyrrhizic acid at 75 mg/kg of body weight/day. The dose was administered five times, every alternate day, by intraperitoneal injection. Control groups received intraperitoneal injection of PBS alone. Mice from all groups were sacrificed at 30 days posttreatment.

Isolation of CD11b⁺ Gr1⁺ MDSCs and sorting of F4/80⁺ and F4/80⁻ MDSCs.

Briefly, a single-cell suspension of splenocytes or hepatocytes was incubated with anti-CD11b magnetic beads (BD Biosciences). The positive fraction was sorted per the manufacturer's instructions and incubated with anti-Gr1 magnetic beads (BD Biosciences). The double-positive fraction (CD11b⁺ Gr1⁺) was sorted and used as MDSCs for subsequent experiments. Moreover, magnetically activated cell sorting (MACS)-sorted CD11b⁺ Gr1⁺ cells were subjected to fluorescence-activated cell sorter (FACS) analysis using fluorescein isothiocyanate (FITC)-conjugated CD11b and phycoerythrin (PE)-conjugated Gr1 Abs, and the purity was routinely found to be >90%. The CD11b⁺ Gr1⁺ cells were incubated with anti-mouse F4/80 antibody and sorted to obtain highly purified populations, using a FACSAria flow cytometer (BD Biosciences). The sorted populations (both F4/80⁺ and F4/80⁻) used in each experiment were >95% pure. Appropriate controls for cell viability were performed using propidium iodide/annexin V staining.

Isolation and purification of T cells.

Single-cell suspensions were prepared by crushing spleens or livers collected from respective groups of mice, and after the removal of red blood cells by hypotonic lysis, the T cells were isolated using a glass wool column, and CD4⁺ and CD8⁺ T cells were MACS sorted by positive selection (CD8⁺ or CD4⁺ Imag beads; BD Bioscience, CA) per the manufacturer's instructions. Total splenic T cells and CD4⁺ and CD8⁺ T cells were fractionated to remove CD25⁺ populations (MagCellect T_reg isolation kit; R&D Systems). The purities of CD25⁻ T cells, CD4⁺ CD25⁻ T cells, and CD8⁺ CD25⁻ T cells were routinely >95% (FACSVerse; Becton Dickinson). The CD25⁻ fraction of T cells was cultured 1:1 in RPMI 1640 medium with CD11b⁺ Gr1⁺ MDSCs. CD11b⁺ Gr1⁺ MDSCs were treated with 50 μg/ml mitomycin C for 20 min at 37°C prior to the coculture. T cells were isolated thereafter and stimulated with anti-CD3/CD28 antibodies (1 μg/ml [each]) or SLA (5 μg/ml).

Flow cytometry.

Splenocytes or hepatocytes from SLA-immunized or L. donovani-infected BALB/c mice were stained with a PE-labeled Gr1 antibody (clone RB6-8C5) and an FITC-labeled CD11b antibody (clone M1/70). For intracellular cytokine staining, brefeldin A (10 μg/ml; BD Biosciences) was added 4 h before harvesting to arrest the cytokine secretion, and cells were fixed with 3% paraformaldehyde for 15 min on ice, permeabilized (0.1% saponin), and then stained (BD Biosciences). Cells were analyzed using a FACSVerse flow cytometer (Becton Dickinson, San Diego, CA).

Isolation of RNA and reverse transcriptase PCR.

Total RNA was extracted by use of Tri reagent (Sigma-Aldrich, St. Louis, MO) from MDSCs or from the CD25-negative fraction of total T cells from differently treated mice according to the standard protocol. The total RNA was reverse transcribed using Revert Aid M-MuLV reverse transcriptase (Fermentas, Ontario, Canada). GAPDH was used as a loading control. Sequences of the PCR primers are listed in Table 1. PCR-amplified products (obtained using a PerkinElmer Gen Amp 2400 PCR system) were subsequently size fractioned in a 2% agarose gel, stained with ethidium bromide, and visualized under UV light. Densitometric analyses of bands were performed using Quantity One 4.6.1 (basic) software (Bio-Rad).

TABLE 1.

Primers used for this study

Target	Primer sequence (5′ → 3′)
	Forward	Reverse
IL-2	ATGTACAGCATGCAGTCTGCA	GGCTTGTTGAGATGATGCTTT
IFN-γ	AGCTCTTCCTCATGGCTGTTTC	TGTTGCTGATGGCCTGATTGT
Cox-2	GGAGAGACTATCAAGATAGTGATC	ATGGTCAGTAGACTTTTACAGCTC
Arginase I	GGATTGGCAAGGTGATGGAA	TCCGAAGCAAGCCAAGGTTA
iNOS	GAGATTGGAGTTCGAGACTTCTGTG	TGGCTAGTGCTTCAGACTTC
GAPDH	GTTGTCTCCTGCGACTTCAACA	TCTCTTGCTCAGTGTCCTTGCT

Immunohistochemistry study.

Spleens from respective groups of mice were fixed in paraformaldehyde for 4 h, kept in a 30% sucrose solution for 24 h, and then frozen in OCT, cryosectioned into 6-μm sections, and kept on polylysine-coated glass slides. Tissue sections were then fixed in chilled methanol for 10 min and blocked with 3% bovine serum albumin (BSA) in PBS for 1 h at room temperature. After rinsing in PBS, primary antibodies against arginase I (abcam) were added at a 1:100 dilution in PBS, allowed to incubate overnight at room temperature in a moist environment, and washed in PBS, and then FITC-conjugated secondary antibodies were added (1:1,000) for 45 min at room temperature, avoiding direct exposure to light. The slides were rinsed in PBS, washed with distilled water, and mounted with DAPI (4′,6-diamidino-2-phenylindole) mounting medium. Fluorescence staining was visualized under a fluorescence microscope (Leica DM4000B; Leica, Wetzlar, Germany).

T cell proliferation assay.

The T cell proliferation assay was performed as described elsewhere (23). The CD25-negative fraction of T cells from splenocytes of SLA-immunized or L. donovani-infected BALB/c mice was cultured at 2 × 10⁵ cells/well in the presence of plate-bound anti-CD3/CD28 antibodies (1 μg/ml [each]) in a round-bottom 96-well plate for 24 h. MDSCs were added at 2 × 10⁵ cells/well, and after 24 and 48 h, 1 μCi [³H]thymidine was added to each well. Cells were harvested 18 h later, and uptake of [³H]thymidine was measured as an index of proliferation by using a liquid scintillation counter (Tri-Carb 2800TR; PerkinElmer).

Preparation of cell lysate and immunoblot analysis.

MDSCs from different treatment groups were MACS sorted and lysed using lysis buffer for isolation of protein. Equal amounts of protein (30 μg) were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were subsequently transferred to a nitrocellulose membrane (Millipore, Bedford, MA). The membrane was blocked overnight with 3% bovine serum albumin in Tris-saline buffer (pH 7.5), and immunoblotting was performed to detect Cox-2 (Santa Cruz Biotechnology), arginase I (abcam), iNOS (Santa Cruz Biotechnology), and GAPDH (Santa Cruz Biotechnology) as described previously (17). Densitometric analyses of bands were performed using Quantity One 4.6.1 (basic) software (Bio-Rad).

Cytokine profiling of T cells.

The cytokine secretion profile of splenic T cells was determined using an in vitro restimulation assay. The CD25-negative fraction of 1 × 10⁶ T cells from SLA-immunized BALB/c mice was seeded in a 96-well round-bottom plate in 200 μl complete RPMI medium and cocultured or not with 1 × 10⁶ MDSCs and antigen-presenting cells (APCs) (treated with mitomycin C at 50 μg/ml for 20 min at 37°C prior to the coculture) that had been pulsed with SLA for 48 h. Bone marrow-derived dendritic cells were the source of these APCs. In brief, 1 ml (1 × 10⁶ cells) of nonadherent cells from the bone marrow was plated with granulocyte-macrophage colony-stimulating factor (GM-CSF) (150 U/ml; R&D Systems) and interleukin-4 (IL-4) (75 U/ml; R&D Systems). Half of the medium was replaced on alternate days, and fresh medium with GM-CSF and IL-4 was added. After 7 days, these cells were used as the source of APCs in subsequent experiments.

T cells were subsequently MACS sorted and stimulated with anti-CD3/CD28 or SLA for 48 h. Cell-free supernatants were collected and then stored at −80°C until further use or analyzed for IL-10, transforming growth factor beta (TGF-β), IL-2, and gamma interferon (IFN-γ) by using matched antibody pairs (BD Bioscience). Enzyme-linked immunosorbent assays (ELISAs) were performed according to the manufacturer's instructions (17).

Generation of nitrite and PGE2.

The generation of nitrite was measured by the Griess reaction, using a nitric oxide colorimetric assay kit (Boehringer Mannheim Biochemicals). Cell culture was performed at a density of 1 × 10⁶ cells/ml in 24-well tissue culture plates (Tarson). Forty-eight hours after LPS (100 ng/ml) treatment, the supernatant was collected and the level of nitrite was measured per the manufacturer's instructions. Data are expressed in micromoles of nitrite. Similarly, the supernatant was subjected to sandwich ELISA to measure PGE2 (R&D Systems) per the manufacturer's instructions. Data are expressed in picograms per milliliter (17).

Determination of splenic and hepatic parasite burdens.

Mice from different groups were sacrificed at various weeks, as indicated. The parasite burdens of splenic and hepatic tissue imprints were measured by examining methanol-fixed, Giemsa-stained tissue samples from the respective organs by using a microscope (Olympus). Data are presented in Leishman-Donovan units (LDU) (17).

Statistical analysis.

All experiments were performed at least in triplicate, and a minimum of 5 mice were used per group. The data, presented as mean values ± standard deviations (SD), are from one experiment that was performed at least three times. One-way analysis of variance (ANOVA) (using the statistical package Instat3) was employed to assess the significance of the differences. A P value of <0.01 was considered to be significant, and a P value of <0.001 was considered to be highly significant.

RESULTS

MDSCs from SLA-immunized mice are less immunosuppressive in nature than MDSCs from L. donovani-infected BALB/c mice.

Leishmania infection in mice elicits monocytes with features of MDSCs (8). In order to investigate the impact of both soluble leishmanial antigen (SLA) and L. donovani infection on the in vivo expansion of CD11b⁺ Gr1⁺ MDSCs, we immunized BALB/c mice with SLA (Fig. 1A) and separately infected another group of mice with L. donovani. We frequently monitored the process of immunization in different groups of BALB/c mice by a subsequent challenge with L. donovani at different dilutions to examine if SLA immunization was successful (Fig. 1A; see Fig. S1A in the supplemental material). Flow cytometric analysis of splenocytes isolated at various weeks indicated an expansion of CD11b⁺ Gr1⁺ MDSCs, which peaked at the 4th week in the spleens of SLA-immunized BALB/c mice, followed by a sharp decline, whereas CD11b⁺ Gr1⁺ MDSCs gradually expanded in L. donovani-infected mice, and expansion continued until the 8th week postinfection (Fig. 1B and its inset). In the liver, CD11b⁺ Gr1⁺ MDSCs could not expand much in SLA-immunized mice (Fig. 1B and its inset). Since CD11b⁺ Gr1⁺ MDSCs have been reported to suppress T cell proliferation (7), we tested CD11b⁺ Gr1⁺ MDSCs from SLA-immunized (iMDSCs), L. donovani-infected (nMDSCs), and control (MDSCs) mice for their effect on T cell proliferation. We observed that iMDSCs were not as effective at inhibiting the proliferation of T cells as nMDSCs, though the levels of inhibition of T cell proliferation by MDSCs from either L. donovani-infected or control mice were comparable (Fig. 1C). Our results suggested that SLA immunization in BALB/c mice elicited a population of splenic CD11b⁺ Gr1⁺ cells whose suppressive capacity on T cells was lower than that of nMDSCs or MDSCs.

FIG 1.

A differential pattern of expansion of CD11b⁺ Gr1⁺ MDSCs in immunized or L. donovani-infected BALB/c mice accompanies a differential capacity of T cell suppression. (A) Immunization schedule. (B) Flow cytometric analyses of CD11b⁺ Gr1⁺ cells isolated from spleens and livers of SLA-immunized and Leishmania donovani-infected BALB/c mice. Data are from 1 of 3 experiments performed in the same way and yielding similar observations. (Inset) Graphical representation of flow cytometric analyses of CD11b⁺ Gr1⁺ cells isolated from spleens and livers of SLA-immunized and Leishmania donovani-infected BALB/c mice. (C) Results of thymidine uptake assays to establish the effects of MDSCs on proliferation of T cells isolated from SLA-immunized, L. donovani-infected, and PBS control BALB/c mice. MDSC, iMDSC, and nMDSC denote MDSCs isolated from PBS control, SLA-immunized, and L. donovani-infected mice, respectively. Cell proliferation was assayed, and data are expressed as mean counts per minute (CPM) ± SD. Data are representative of at least three experiments. *, P < 0.01; ***, P < 0.001.

SLA-induced CD11b⁺ Gr1⁺ MDSCs do not inhibit the Th1 cytokine response.

We cultured T cells from SLA-immunized mice with iMDSCs or nMDSCs for 48 h in the presence of mitomycin C-treated APCs pulsed with SLA. T cells were subsequently purified by MACS and stimulated with either anti-CD3/CD28 or SLA for 48 h, and supernatants were subjected to ELISA. MDSCs from SLA-immunized mice induced IL-2 and IFN-γ in T cells isolated from SLA-immunized mice (Fig. 2A and B; see Fig. S1B in the supplemental material). However, nMDSCs failed to generate IL-2 and IFN-γ in T cells from SLA-immunized mice (Fig. 2A and B; see Fig. S1B), whereas the level of TGF-β or IL-10 remained unchanged. These data suggested that iMDSCs, in contrast to nMDSCs, were not capable of suppressing the Th1 cytokine response in T cells from SLA-immunized mice. We also performed similar experiments with T cells from L. donovani-infected BALB/c mice and observed significant decreases in TGF-β and IL-10 levels when iMDSCs were cocultured with T cells. However, no difference was observed for IL-2 or IFN-γ (Fig. 2C and D; see Fig. S1C). Our experiments suggest that iMDSCs cannot inhibit the Th1 immune response in T cells from immunized BALB/c mice but that nMDSCs do, whereas iMDSCs suppress the Th2 response in T cells from infected mice, but nMDSCs do not.

FIG 2.

iMDSCs do not suppress IFN-γ and IL-2 production by T cells isolated from SLA-immunized mice but do suppress TGF-β and IL-10 production by T cells isolated from L. donovani-infected mice. (A) Immunosorbent assays were performed to determine the effects of iMDSCs and nMDSCs on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from SLA-immunized mice. Data are presented as means ± SD. N.S., not statistically significant; ***, P < 0.001. (B) RT-PCR analysis was performed to determine the effects of iMDSCs and nMDSCs on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from SLA-immunized mice. Data are from 1 representative experiment among experiments performed at least 3 times. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH. (C) Immunosorbent assays were performed to determine the effects of iMDSCs and nMDSCs on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from infected mice. Data are presented as means ± SD. ***, P < 0.001. (D) RT-PCR analysis was performed to determine the effects of iMDSCs and nMDSCs on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from infected mice. Data are from 1 representative experiment among experiments performed at least 3 times. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH.

SLA immunization differentially affects the expression of F4/80 and Ly6C but reduces the levels of arginase I, Cox-2, and iNOS in CD11b⁺ Gr1⁺ MDSCs.

Since F4/80 and Ly6C expression is associated with the maturation of cell types (24, 25), we investigated the effect of SLA immunization or L. donovani infection of BALB/c mice on the expression of F4/80 and Ly6C on splenic MDSCs. Immunization with SLA marginally decreased the expression of F4/80, whereas its expression peaked at the 4th week post-L. donovani infection, followed by a gradual decline (Fig. 3A and B) at later times. In addition, Ly6C expression initially increased in SLA-immunized mice but later declined, but the increased expression of Ly6C was maintained in infected mice (Fig. 3A and B), indicating that the maturation levels of MDSCs were different. The suppressive function of MDSCs directly correlates with the expression of arginase I, Cox-2, iNOS, and PGE2 (15, 16). We therefore hypothesized that expression of these molecules would be lower in the splenic iMDSCs. Decreased expression of all these molecules was observed at both the mRNA and protein levels in the MDSCs of SLA-immunized BALB/c mice compared to those of L. donovani-infected mice (Fig. 3C and D). Expression levels of arginase I, Cox-2, iNOS, nitrite, and PGE2 were even lower in the F4/80⁻ fraction of CD11b⁺ Gr1⁺ cells than in the sorted F4/80⁺ fraction. From these observations, we established that the altered phenotype of iMDSCs included a low expression level of Ly6C, a marginally low expression level of F4/80, and decreased expression of arginase I, Cox-2, and iNOS.

FIG 3.

MDSCs from SLA-immunized mice show a marginal decrease in expression of F4/80 and reduced levels of arginase I, Cox-2, iNOS or nitrite, and PGE2. (A) Flow cytometric analyses of F4/80 and Ly6C expression on CD11b⁺ Gr1⁺ splenic MDSCs from SLA-immunized or Leishmania donovani-infected BALB/c mice. Data are representative of at least three independent experiments, all of which were performed in the same way and yielded similar results. (B) Graphical representation of flow cytometric analyses of F4/80 and Ly6C expression on CD11b⁺ Gr1⁺ MDSCs. Frequencies of F4/80⁺ and Ly6C⁺ splenic MDSCs from SLA-immunized or Leishmania donovani-infected BALB/c mice were plotted and compared with those for infected mice. (C) RT-PCR and immunoblot analyses of expression of arginase I, Cox-2, and iNOS by MDSCs from SLA-immunized (iMDSC), L. donovani-infected (nMDSC), and control (MDSC) BALB/c mice. Data are representative of at least three independent experiments, all of which were performed in the same way and yielded similar results. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH. (D) Generation of nitrite and PGE2 by splenic MDSCs. Data are presented as means ± SD. ***, P < 0.001.

Treatment with GA reduces arginase I, Cox-2, and PGE2 expression but induces nitrite production in MDSCs.

All our previous experiments with MDSCs obtained from SLA-immunized BALB/c mice pointed to significant roles for arginase I and Cox-2 in controlling the suppressive capacity of these myeloid-derived suppressor cells. Since GA can effectively inhibit the expression of infection-induced Cox-2 in BALB/c mouse-derived peritoneal macrophages (17) and pharmacological inhibition of Cox-2 blocks the induction of arginase I (16), we tested if GA could also downregulate the expression of infection-induced Cox-2 in myeloid-derived suppressor cells. We treated infected or uninfected BALB/c mice with GA (Fig. 4A) and isolated the MDSCs from their spleens. MDSCs from both groups of mice showed that GA treatment of BALB/c mice infected or not with L. donovani reduced the levels of Cox-2 and arginase I but elevated iNOS production at both the mRNA and protein levels (Fig. 4B). Production of nitrite by MDSCs similarly correlated with the expression of iNOS (Fig. 4C). However, GA treatment reduced infection-induced PGE2 production (Fig. 4C). It is noteworthy that MDSCs from GA-treated mice either previously immunized with SLA or infected with L. donovani were functionally indistinguishable (see Fig. S1D to F in the supplemental material). Next, we examined if GA could modulate the generation of MDSCs in both the spleen and liver. We observed that GA treatment reduced the frequency of MDSCs in the spleens of infected BALB/c mice (Fig. 4E and its inset) compared to those of infected mice which were left untreated (Fig. 1B). However, expression of F4/80 on splenic MDSCs changed marginally. As a consequence, we went on to conclude that GA rendered the MDSCs less suppressive and inhibited their generation.

FIG 4.

Effect of GA on expression of arginase I, Cox-2, and iNOS by MDSCs. (A) Schedule for glycyrrhizic acid treatment. (B) RT-PCR and immunoblot analyses of the expression of arginase I, Cox-2, and iNOS by MDSCs isolated from GA-treated infected BALB/c mice. Changes in expression of arginase I, Cox-2, and iNOS at the mRNA and protein levels were determined by RT-PCR and immunoblotting, respectively. Data are representative of at least three independent experiments, all of which were performed in the same way and yielded similar results. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH. Data are presented as means ± SD. ***, P < 0.001. (C) Generation of nitrite and PGE2 by splenic MDSCs. Data are presented as means ± SD. ***, P < 0.001. (D) Immunohistochemistry study of arginase I expression in the spleen. Spleens from L. donovani-infected BALB/c mice were examined 30 days after treatment by staining with arginase I. Results are representative of three independent experiments, all of which were done in the same way and yielded similar results. (E) Flow cytometric analyses of CD11b⁺ Gr1⁺ cells isolated from spleens and livers of treated BALB/c mice. Data are from 1 of 3 experiments performed in the same way and yielding similar observations. (Inset) Graphical representation of flow cytometric analyses of CD11b⁺ Gr1⁺ cells isolated from spleens and livers of L. donovani-infected BALB/c mice treated with GA. The frequency of CD11b⁺ Gr1⁺ MDSCs is compared with that in the L. donovani-infected BALB/c mice from Fig. 1. (F) Flow cytometric analyses of F4/80 expression on CD11b⁺ Gr1⁺ splenic MDSCs from L. donovani-infected BALB/c mice treated with GA. Data are from 1 of 3 independent experiments performed in the same way and yielding similar results.

Administration of GA to L. donovani-infected BALB/c mice restores the capacity of T cells to proliferate and secrete Th1 cytokines even in the presence of MDSCs.

Next, we checked the effect of the MDSCs from GA-treated BALB/c mice on proliferation of both CD4⁺ and CD8⁺ T cells. MDSCs isolated from GA-treated BALB/c mice could not inhibit proliferation of either CD4⁺ or CD8⁺ T cells when stimulated with SLA or anti-CD3/CD28 (Fig. 5A). Moreover, we also checked the effects of these MDSCs on cytokine secretion by T cells. T cells from SLA-immunized mice were cultured with MDSCs isolated from GA-treated or untreated BALB/c mice for 48 h in the presence of mitomycin C-treated APCs pulsed with SLA. T cells were subsequently purified and stimulated with either anti-CD3/CD28 or SLA. T cells isolated from SLA-immunized mice and cocultured with MDSCs from GA-treated L. donovani-infected mice produced higher levels of IL-2 and IFN-γ than T cells from SLA-immunized mice cocultured with MDSCs from L. donovani-infected mice at both the mRNA and protein levels. The levels of IL-10 and TGF-β remained unaltered (Fig. 5B and C). Similarly, T cells from infected mice expressed reduced levels of TGF-β and IL-10 at both the protein and mRNA levels when cocultured with MDSCs isolated from GA-treated BALB/c mice, whereas the levels of IL-2 and IFN-γ remained unchanged (Fig. 5D and E). To test if GA can influence the differentiation of T cells, we cultured T cells isolated from naive mice, SLA-immunized mice, and L. donovani-infected BALB/c mice in vitro and then treated them with GA (see Fig. S2A to C in the supplemental material). Our data rule out any possibility of GA influencing the differentiation of T cells. Collectively, the findings suggested that treatment of BALB/c mice with GA rendered the MDSCs inefficient at inhibiting the Th1 response.

FIG 5.

Effect of GA on restoration of T cell proliferation and induction of Th1/Th2 cytokines. (A) Effect of MDSCs from GA-treated infected mice on proliferation of CD4⁺/CD8⁺ T cells. In vitro proliferation of splenic CD4⁺/CD8⁺ T cells was determined in a coculture setting with MDSCs from BALB/c mice administered GA. T cell proliferation was measured as described in Materials and Methods. Cell proliferation is expressed as mean CPM ± SD. ***, P < 0.001. Data are representative of at least three experiments. (B) Immunosorbent assays were performed to determine the effects of MDSCs from GA-treated infected mice on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from SLA-immunized mice. Data are presented as means ± SD. ***, P < 0.001. (C) RT-PCR analysis of the expression of TGF-β, IL-10, IL-2, and IFN-γ by T cells from SLA-immunized mice cocultured with MDSCs isolated from GA-treated infected mice. Data are representative of at least three independent experiments, all of which were performed in the same way and yielded similar results. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH. (D) Immunosorbent assays were performed to determine the effects of MDSCs from GA-treated infected mice on IL-2, IFN-γ, TGF-β, and IL-10 production by T cells from infected mice. Data are presented as means ± SD. ***, P < 0.001. (E) RT-PCR analysis of the expression of TGF-β, IL-10, IL-2, and IFN-γ by T cells from infected mice cocultured with MDSCs isolated from GA-treated infected mice. Data are representative of at least three independent experiments, all of which were performed in the same way and yielded similar results. Densitometric measurements were performed using Bio-Rad Quantity One software, and the values for genes were normalized against GAPDH.

GA treatment decreases organ-specific proliferation of IL-10-producing CD4⁺ and CD8⁺ T cells but increases the level of IFN-γ-producing CD4⁺ and CD8⁺ T cells during L. donovani infection.

IL-10-producing T cells, which expand during visceral leishmaniasis, have been implicated in immunosuppression (26–28). Leishmania-specific IFN-γ-producing T cells have been shown to expand as part of the Th1 response (29, 30). Therefore, we checked the effects of GA treatment on IL-10- and IFN-γ-producing CD4⁺ and CD8⁺ T cells in both the spleen and liver. Treatment with GA, which inhibited infection-induced Cox-2 in MDSCs (Fig. 4B), downregulated IL-10-secreting CD4⁺ and CD8⁺ T cells and upregulated IFN-γ-secreting CD4⁺ and CD8⁺ T cells in both the spleen and liver during L. donovani infection (Fig. 6). Therefore, we demonstrated that the suppression of MDSCs by GA treatment accompanied a restoration of IFN-γ-secreting splenic and hepatic CD4⁺ and CD8⁺ T cells in L. donovani-infected BALB/c mice.

FIG 6.

Reciprocal induction of IFN-γ- and IL-10-secreting CD4⁺ and CD8⁺ T cells by GA in L. donovani-infected BALB/c mice. Flow cytometric analyses were performed to determine the frequencies of IFN-γ- and IL-10-secreting T cells in L. donovani-infected BALB/c mice treated with GA. At 2 weeks post-L. donovani infection, mice were treated with GA as described in Materials and Methods. Data are from one of three experiments performed in the same way and yielding similar results. The bar diagrams at the bottom show the cell frequencies.

DISCUSSION

Immunotherapy against visceral leishmaniasis is challenging partly because of immunosuppression (31–34). Myeloid cells are a major source of T cell suppression in many diseases, including leishmaniasis (13). In the present study, we aimed to shed light on inhibition of the suppression mechanism employed by MDSCs in the context of L. donovani infection. The infection-induced expansion of MDSCs, which suppressed the immune response during active disease, could be rendered inefficient for suppression by treatment with glycyrrhizic acid, which inhibits arginase I and Cox-2. Since one of the immunopathological consequences of visceral leishmaniasis is antigen-specific suppression of T cell responses (35), a gradual expansion of MDSCs in L. donovani-infected BALB/c mice is consistent with immunosuppression to establish the infection by favoring the survival of the parasites. SLA-immunized BALB/c mice resisted the expansion of these MDSCs to direct the host's immune system toward a self-healing phenotype at a 1 × 10⁶ dilution of parasites or lower (see Fig. S1A in the supplemental material).

iMDSCs (less suppressive than nMDSCs), generated in SLA-immunized mice, inhibit T cell function significantly, though MDSCs from immunized mice are less suppressive and their suppression capacity is homogenous regardless of the source of T cells (immunized mice or naive mice). The expression of various suppressive molecules in iMDSCs (such as Cox-2 and PGE2), though to lower levels than those in nMDSCs, could be a plausible explanation. This suggests the existence of an intrinsic difference between MDSCs from SLA-immunized mice and those from L. donovani-infected mice (Fig. 1). Our data also suggest that SLA-immunized mice bear a Th1-like response which is dominant over the Th2 response in the same mice. However, L. donovani-infected mice bear a Th2-like immune response which is dominant over the Th1 immune response. This could explain why Th2 cytokines in SLA-immunized mice were not altered much, as there was no significant alteration in the production of Th1 cytokines by T cells from L. donovani-infected BALB/c mice. Coculture experiments further strengthened this view, as MDSCs from SLA-immunized mice could not suppress cytokine production when stimulated with SLA. Our data suggest that cytokine production by T cells cocultured with iMDSCs is independent of the suppressive capacity of iMDSCs on T cells. Since L. donovani infection is established in 2 to 4 weeks in BALB/c mice (34), it is feasible to speculate that once the infection is established, F4/80 retains a normal level of expression on MDSCs; however, as there is no increase in F4/80 expression (in contrast to what is found in infected mice) but an initial increase followed by a decrease in Ly6C expression on MDSCs in immunized mice (Fig. 3A), the MDSCs in immunized mice seem to stay immature, which is a criterion for MDSCs. Despite that, because F4/80 is also expressed on differentiated macrophages, which are necessary for controlling Leishmania infection (36), correlation of F4/80 expression as a suppressive parameter is not sufficient to explain these complex findings. In line with our finding that MDSCs from SLA-immunized mice are less immunosuppressive than MDSCs from infected mice, Cox-2, arginase I, iNOS, and PGE2, all of which contribute to immunosuppression, are expressed less in MDSCs from SLA-immunized mice.

Corroborating our previous observation that Cox-2 can be inhibited effectively by GA administration, we found that GA did reduce the expression of Cox-2, arginase I, and PGE2 in the MDSCs of infected mice; however, it increased NO production (17). In our model, it appears that NO alone cannot suppress T cell functions but serves as a Th1 mediator, whereas decreased production of other suppressive molecules (Cox-2 and arginase I) rendered the MDSCs nonimmunosuppressive. Further study is required to explain this complex finding. MDSCs from GA-treated L. donovani-infected mice showed an impaired capacity to inhibit T cell proliferation in the presence of either SLA or anti-CD3/CD28 and had a restored ability to induce IL-2 and IFN-γ in T cells from SLA-immunized mice. Withdrawal of immunosuppression alone cannot be sufficient to mount an effective immune response. GA induced the proliferation of IFN-γ⁺ splenic and hepatic CD4⁺/CD8⁺ T cells while decreasing the frequency of IL-10⁺ splenic and hepatic CD4⁺/CD8⁺ T cells, a prerequisite for developing a successful immune response against L. donovani infection in a susceptible host.

Taking all the data together, we opine a plausible involvement of MDSCs during L. donovani infection and suggest that, by reducing the immunosuppressive capacity of MDSCs, an effective T cell-mediated host-protective immune response can be restored by using a suitable immunotherapeutic, such as glycyrrhizic acid.