Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2015 Jul 26;21(4):505–517. doi: 10.1007/s12298-015-0315-1

Development of an efficient in vitro plant regeneration system amenable to Agrobacterium- mediated transformation of a recalcitrant grain legume blackgram (Vigna mungo L. Hepper)

Manish Sainger 1, Darshna Chaudhary 1, Savita Dahiya 1, Ranjana Jaiwal 2, Pawan K Jaiwal 1,✉
PMCID: PMC4646867  PMID: 26600677

Abstract

An efficient, rapid and direct multiple shoot regeneration system amenable to Agrobacterium-mediated transformation from primary leaf with intact petiole of blackgram (Vigna mungo) is established for the first time. The effect of the explant type and its age, type and concentration of cytokinin and auxin either alone or in combination and genotype on multiple shoot regeneration efficiency and frequency was optimized. The primary leaf explants with petiole excised from 4-day-old seedlings directly developed multiple shoots (an average of 10 shoots/ explant) from the cut ends of the petiole in 95 % of the cultures on MSB (MS salts and B5 vitamins) medium containing 1.0 μM 6-benzylaminopurine. Elongated (2–3 cm) shoots were rooted on MSB medium with 2.5 μM indole-butyric acid and resulted plantlets were hardened and established in soil, where they resumed growth and reached maturity with normal seed set. The regenerated plants were morphologically similar to seed-raised plants and required 8 weeks time from initiation of culture to establish them in soil. The regeneration competent cells present at the cut ends of petiole are fully exposed and are, thus, easily accessible to Agrobacterium, making this plant regeneration protocol amenable for the production of transgenic plants. The protocol was further successfully used to develop fertile transgenic plants of blackgram using Agrobacterium tumefaciens strain EHA 105 carrying a binary vector pCAMBIA2301 that contains a neomycin phosphotransferase gene (nptII) and a β-glucuronidase (GUS) gene (uidA) interrupted with an intron. The presence and integration of transgenes in putative T0 plants were confirmed by polymerase chain reaction (PCR) and Southern blot hybridization, respectively. The transgenes were inherited in Mendelian fashion in T1 progeny and a transformation frequency of 1.3 % was obtained. This protocol can be effectively used for transferring new traits in blackgram and other legumes for their quantitative and qualitative improvements.

Keywords: Direct shoot regeneration, Primary leaf, Blackgram, Agrobacterium tumefaciens

Introduction

Blackgram (Vigna mungo L. Hepper) is a key grain legume with its origin (Lukoki et al. 1980) and center of genetic diversity in India (Zeven and de Wet 1982). Because of its high protein content and perfect combination of all nutrients, including proteins (25–26 %), carbohydrates (60 %), fat (1.5 %), minerals, amino acids and vitamins (Karamany 2006), it is extensively used in Asia especially in India and now also grown in the Southern United States, the West Indies, Japan and other tropics and subtropics (Delic et al. 2009). Viral and fungal pathogens lead to severe yield losses in blackgram (Sahoo and Jaiwal 2008) and to overcome this problem, attempts have been made to obtain resistant cultivars either by conventional breeding or genetic transformation. Due to limited genetic variation among cultivated accessions and sexual incompatibility with wild relatives, genetic engineering is a good alternative for conventional breeding. However, for the production of a transgenic crop, a well-defined in vitro shoot regeneration system is required.

Direct shoot regeneration alleviates somaclonal variation frequent in plants generated from cultured cells or tissues (Dayal et al. 2003; Mujib 2005). Direct shoot organogenesis and whole plant regeneration in blackgram has been achieved from cotyledonary node (Franklin and Ignacimuthu 2000; Saini et al. 2003; Muruganantham et al. 2005; Mony et al. 2010), cotyledon and embryonic axis (Sen and Guha-Mukherjee 1998; Ignacimuthu and Franklin 1999), shoot apex (Das et al. 2002a, b; Saini and Jaiwal 2005) and epicotyl (Saini and Jaiwal 2002) explants. Indirect shoot organogenesis via callus formation has been reported from various blackgram explants (Das et al. 2002a, b; Varalaxmi et al. 2007; Harisaranraj et al. 2008; Srivastava and Pandey 2011). Although, direct shoot regeneration from leaf petiole explants has been reported in a few legumes, e.g. soybean (Wright et al. 1987), cowpea (Muthukumar et al. 1995), mungbean (Mahalakshmi et al. 2006) and pigeonpea (Dayal et al. 2003, Gawali et al. 2010), there are no reports on direct multiple shoot regeneration from petioles of primary leaves in blackgram. In the present study, we report a simple one step (direct) method for successful and efficient shoot regeneration from petioles of primary leaf explants. This method has been found amenable to Agrobacterium-mediated genetic transformation of blackgram as evident from the transformation studies involving transient GUS expression at the regeneration site, the presence and integration of transgenes in T0 plants and their inheritance in T1 progeny in Mendelian fashion.

Materials and methods

Plant material, bacterial strain and vector

Seeds of commercially grown blackgram cultivars, T-9, PS-1 and PS-2 were obtained from the Pulse Research Laboratory, Division of Genetics, Indian Agriculture Research Institute, New Delhi. For detailed studies, PS-1 showing the best regeneration response was used. Binary vector, pCAMBIA2301 (www.cambia.org) was used for optimization of parameters affecting Agrobacterium-mediated transformation and further transformation studies. It contains genes for neomycin phosphotransferase (NPT II) (nptII) and β-glucuronidase (GUS) (uidA), both driven by the cauliflower mosaic virus (CaMV) 35S promoter (Fig. 2). The uidA gene contains an intron in the coding region to ensure that it would be expressed only in plant cells and not in Agrobacterium. The presence of the binary vector in the Agrobacterium was confirmed by colony PCR using primers specific to uidA genes.

Fig. 2.

Fig. 2

Open in a new tab

A schematic representation of the T-DNA of pCAMBIA2301 containing the uid A (GUS) and nptII genes (not drawn to scale). The position of HindIII is indicated on the T-DNA. No other HindIII sites are present on pCAMBIA2301 (total size 11.6 kb). LB/RB: left and right T-DNA border sequences

Explant preparation, multiple shoot induction and plant regeneration

Healthy and uniform mature seeds were rinsed with 70 % alcohol (v/v) for 1 min and then surface sterilized in 0.2 % (w/v) aqueous solution of mercuric chloride for 5 min. The seeds were subsequently rinsed with autoclaved distilled water for 4–5 times. Sterilized seeds were germinated on MSB medium [MS (Murashige and Skoog 1962) salts, B5 (Gamborg et al. 1968) vitamins, 3 % sucrose and 0.8 % agar as a gelling agent] supplemented with 10.0 μM BA. The primary leaves with petiole attached were excised from in vitro raised 4-day-old seedlings and were cultured with petiolar cut end slightly embedded in MSB medium containing different concentrations of BA (0–10.0 μM) for multiple shoot induction.

The shoot multiplication response of BA was compared with other cytokinins, by culturing the explants on MSB basal medium containing kinetin, zeatin, 2-iP and TDZ at an equimolar concentration of 1.0 μM. The effect of auxins (IAA or NAA) on shoot regeneration response of BA was studied by culturing the explants on MSB basal medium containing either 0.5 or 1.0 μM of IAA or NAA along with 1.0 μM BA. The effect of the presence or absence of lamina on the primary leaf petiole (excised at node) was studied by culturing the primary leaf petiole with whole lamina or without lamina or transverse proximal or longitudinal half of lamina on MSB basal medium supplemented with 1.0 μM BA. The effect of the age of explant on multiple shoot induction was determined by culturing the primary leaf explants excised from 2 to 10-day-old seedlings. In order to study the effect of genotype on shoot regeneration, explants were excised from seedlings of different cultivars, T-9, PS-1 and PS-2, and cultured on MSB medium supplemented with 1.0 μM BA.

All the culture work was performed under aseptic conditions in laminar air flow cabinet. In all the cases, the pH of the medium was adjusted to 5.8 with 1 N NaOH and 1 N HCl prior to autoclaving at 121 °C under a pressure of 15 psi for 20 min. All the cultures were maintained at 26 ± 2 °C under 16 h photoperiod of cool -white fluorescent light of intensity 80 μEm−2 s−1. The well-developed shoots (2–3 cm) were excised from the proliferating explants and transferred to medium containing half-strength MS salts, full-strength B5 vitamins, 3 % sucrose and 2.5 μM IBA for rooting. The rooted shoots were established in pots containing soil as per the method described by Saini and Jaiwal (2005).

For each treatment, 24 explants were cultured and each experiment was repeated at least thrice. Cultures were observed every day and the data pertaining to the number of explants forming shoots, the number of shoots and the length of shoots per explant were recorded after 28 days of culture. The data was subjected to the analyses of variance (ANOVA) and significant treatment differences were selected by Newman-Keul’s multiple range test (Bruning and Kintz 1977).

Selection system

To determine the concentration of the selective agent for the selection of transformed shoots, the primary leaf explants were cultured on shoot regeneration medium (MSB + 1.0 μM BA) containing different concentrations of kanamycin (0–90 mgl−1) as a selective agent. The explants were subcultured on the same fresh medium with same levels of antibiotic after every 2 weeks till 4 weeks. The data on the number of explants forming shoots and the number of shoots per explant was recorded after 4 weeks of culture. The shoots regenerated from untransformed (control) explants were transferred to rooting medium (MSB + 2.5 μM IBA) containing different concentrations of kanamycin (0–10 mgl−1) to determine the kanamycin concentration that suppressed the root induction.

Optimization of transformation protocol and regeneration of transformants

Various factors influencing transformation efficiency of blackgram were optimized using transient GUS expression. A. tumefaciens strain EHA105 (pCAMBIA2301) was grown in liquid YEP (yeast extract 10.0 gl−1, peptone 10.0 gl−1, NaCl 5.0 gl−1, pH −7.2) medium containing 10 mgl−1 rifampicin (for bacterial selection) and 5 mgl−1 tetracycline (for plasmid selection) for overnight at 28 °C on an orbital shaker (Orbitek, India) at 220 rpm until the O.D. of bacterial suspension reached 0.7 at 600 nm. The bacterial culture was centrifuged at 6000 rpm in a 15 ml tube (Tarson, India) for 5 min. The pellet was resuspended in liquid MSB medium containing 1.0 μM BA and 100 μM acetosyringone. The primary leaf explants with petiole excised from 4-day-old in vitro raised seedlings were inoculated by immersing in Agrobacterial suspension (containing 106 to 109 cells/ml of bacteria) for 10–40 min with gentle shaking at 80 rpm. The explants were blotted dry on sterile filter paper and co-cultivated on filter paper moistened with liquid MSB co-cultivation medium containing 1.0 μM BA adjusted to pH (5.0–5.8) for 1–4 days at 22–28 °C under light conditions. The effect of phenolic-acetosyringone (30–130 μM) and thiol compounds, L-cysteine (0–7 mM) and dithiothreitol (DTT) (0.5–2.0 mM) in bacterial inoculation and co-cultivation media were also studied. After co-cultivation, the explants were washed with sterile distilled water, blotted dry on sterile filter paper and immersed in freshly prepared X-gluc (5-bromo-4-chloro-3-indolyl-β-glucuronide) solution at 37 °C overnight in darkness according to Jefferson (1987). The staining solution was removed the following day and the tissues were decolorized using 70 % alcohol and examined under a stereo-microscope. For each variable in the experiment, 24 explants were used and each experiment was repeated thrice. The frequency of transient GUS expression was calculated as the number of explants showing blue sectors (due to the large cut surface area) at the site of regeneration out of the total number of agro-inoculated explants.

To generate transgenic plants of blackgram, primary leaf explants with petiole excised from 4-day-old seedlings raised in vitro on MSB medium containing 10.0 μM BA were immersed in Agrobacterium suspension prepared in liquid MSB + 1.0 μM BAP + 5.0 mM L-cysteine + 1.5 mM DTT + acetosyringone (100 μM) (adjusted to pH- 5.5) for 20 min with occasional shaking at 24 °C. Agro-inoculated explants were blotted on sterile filter paper and co-cultured in Petri dish lined with filter paper moistened with liquid MSB + 1.0 μM BA, 5.0 mM L-cysteine and 1.5 mM DTT for 3 days under 16 h photoperiod at 24 °C. After co-cultivation, explants were washed 3–4 times with sterile distilled water with vigorous stirring and blotted dry on sterile filter paper. The explants were cultured on semi-solid MSB medium containing 1.0 μM BA, 70 mgl−1 kanamycin and 500 mgl−1 cefotaxime for shoot regeneration. The explants were sub-cultured on to a fresh medium containing same levels of antibiotics after every 2 weeks for a total of 4 weeks. Green shoots recovered on selection medium were rooted on medium containing half-strength MS salts, full-strength B5 vitamins, 3 % sucrose, 2.5 μM IBA, 10.0 mgl−1 kanamycin and 500 mgl−1 cefotaxime. The putative transformed plants were established in soil and grown to maturity to collect seeds. The seeds were sown in soil to raise the T1 plants.

DNA extraction

The total plant genomic DNA was extracted from fresh young leaves of putative transformed (T0) and non-transformed (control) plants by the CTAB (cetyl trimethyl ammonium bromide) method (Rogers and Bendich 1988).

Polymerase chain reaction analysis

Putative transgenic plants (T0) were screened by PCR for the presence of the nptII gene. Plant genomic DNA isolated from the leaf tissue was used as a template to amplify 680-bp coding region of nptII gene by using specific primers 5′ CTGGGCACAACAGACAATCG 3′ and 5′ GCGATACCGTAAAGCACGAG 3′. PCR was carried out with Taq DNA polymerase (MBI Fermentas). Twenty five microlitre (μl) reaction mixture (total volume) consisted of ~100 ng of plant DNA, 0.25 μl of each primer (forward and reverse each of nptII gene), 2.5 μl of 10× PCR buffer, 1.5 μl of 15 mM MgCl2, 0.5 μl of 200 mM dNTPs mix and 1 Unit of Taq DNA polymerase. The amplification reaction was carried out using a thermal cycler (Applied Biosystem) under following conditions: 1 cycle of 94 °C for 5 min, 30 cycles of 94 °C for 40 s , 56 °C for 40 s and 72 °C for 1 min followed by a final extension at 72 °C for 5 min for detection of nptII gene amplification. PCR amplified DNA fragments were analyzed by electrophoresis on 1 % agarose gel and visualized with ethidium bromide (Sambrook et al. 1989). DNA from non-transformed (control) plant was used as a negative control while the plasmid (pCAMBIA2301) was used as a positive control.

Southern blot hybridization

10 microgram (μg) of genomic DNA from transformed and non transformed (control) plants were digested with HindIII (10 U/μl) restriction enzyme in 100 μl reaction volume, separated on a 0.9 % agarose gel, blotted on positively charged nylon membrane (Amersham) and fixed by ultraviolet (UV) cross-linking. The blot was hybridized with dCT-[P32]- labeled probe following the supplier’s instructions (Bio-Rad, USA). The membrane was washed in 2x SSC ( 0.3 M NaCl, 0.03 M trisodium citrate 2.H20, pH-7.0) twice for 15 min each at room temperature in 1x SSC for 1 min at 65 °C and finally in 0.5x SSC for 5 min at room temperature. The membrane was processed for autoradiography.

PCR analysis of T1 transgenic plants

Plants from T1 progeny were screened by polymerase chain reaction (PCR) for the presence of nptII gene. DNA from non-transformed (control) plant was used as a negative control while the plasmid (pCAMBIA2301) was used as a positive control.

Results and discussion

Plant regeneration through multiple shoot induction

The regeneration potential of primary leaf explants with petioles excised from in vitro raised seedlings on BA (10.0 μM) was evaluated further on MSB medium with various concentrations of BA (0.0–10.0 μM) (Table 1). The explants on MSB basal medium alone showed expansion of leaf lamina in size and swelling of the petiolar region within a week of culture. Subsequently, the petiolar cut end developed an average of 2.0 shoots in 90 % of the cultures within 4 weeks. This is in contrast to earlier reports, where no shoot regeneration was noticed on MSB basal medium from leaf petioles of V. radiata (Mahalakshmi et al. 2006). This may be due to the pretreatment of the initial explants during seed germination with cytokinin (BA) which has resulted in significant increase in the regeneration frequency (data not shown). Presumably, pretreatment on cytokinin activates and/or induces proliferation of pre-existing competent cells in the tissue that results in enhanced regeneration process. Addition of BA in MSB medium further improved the regeneration frequency and shoots per explant. BA induced direct multiple shoots from the cut end of the explants (Figs. 1 and 2). BA at 1.0 μM concentration was optimal inducing 10 shoots per explant in 95 % of the cultures.

Table 1.

Influence of plant growth regulators [μM] on induction of multiple shoots from 4-days- old primary leaf with petiole explants of Vigna mungo cv. PS-1

Kinetin (μM) Zeatin (μM) 2-ip (μM) TDZ (μM) BA (μM) NAA (μM) IAA (μM) Frequency of regenerating explants (%) Mean number of shoots per explants (Mean ± S.E.)2 Mean shoot length per explants (cm) (Mean ± S.E.)2
1.0 – – – – – – 88 3.1 ± 0.4a 5.2 ± 0.6a
– 1.0 – – – – – 80 1.6 ± 0.2b 6.4 ± 0.8a
– – 1.0 – – – – 50 1.8 ± 0.6b 2.1 ± 0.2b
– – – 1.0 – – – 87 2.1 ± 0.7b 1.2 ± 0.1b
– – – – 0 – – 90 2.0 ± 0.2b 1.6 ± 0.3b
– – – – 0.5 – – 95 6.5 ± 0.3c 1.3 ± 0.1b
– – – – 1.0 – – 95 10.0 ± 0.8d 1.1 ± 0.3b
– – – 2.0 – – 95 8.0 ± 0.4e 0.9 ± 0.1b
– – – – 5.0 – – 95 Shoot buds and callusing of tissue No shoot formation
– – – – 1.0 0.5 – 90 4.3 ± 0.6f 1.2 ± 0.6b
– – – – 1.0 1.0 – 90 Friable yellowish callus No shoot formation
– – – – 1.0 – 0.5 95 3.6 ± 0.5af 1.1 ± 0.4b
– – – – 1.0 – 1.0 95 Green compact callus No shoot formation
Open in a new tab

Culture medium: MSB (MS salts + B5 vitamins)

Data based on 24 explants per treatment and each experiment repeated thrice. Data scored after 28 days of culture

Means followed by the same letter are not significantly different according to Newman-Keuls multiple-range test (P = 0.05)

Fig. 1.

Fig. 1

Open in a new tab

a-f In vitro regeneration of multiple shoots from 4-day-old primary leaf explants of Vigna mungo cv. PS1 a Primary leaf explant with petiole excised from 4-day-old in vitro-raised seedlings on MSB medium containing 10.0 μM BA b Direct shoot regeneration from primary leaf petiole on MSB medium supplemented with 1.0 μM BA c Multiple shoot regeneration on MSB medium supplemented with 1.0 μM BA after 4 weeks of culture d Induction of roots on in vitro regenerated shoot on MSB basal medium supplemented with 2.5 μM IBA e Establishment of an in vitro regenerated plant in pot containing soil f A regenerated plant with flower and pods

However, BA at higher concentration (5.0 μM) induced shoot buds along with callus at the cut end of the petiole. The shoot length showed inverse correlation with the increase in BA concentration. These results point towards higher requirement of cytokinin (10.0 μM) for induction and differentiation of multiple shoots from leaf petiole. However, greatly reduced BA concentration (1.0 μM) proved to be crucial for development of shoots. The shoot regeneration from leaf petiole explants has also been achieved either directly on BA containing medium in V. radiata (Mahalakshmi et al. 2006) or indirectly through callus formation on 2,4-5-T and then transferring callus to 5.0 μM BA in V. unguiculata (Muthukumar et al. 1995). Multiple shoot regeneration from leaf petiole explants of pigeon pea has also been obtained on medium containing same levels of dual cytokinins, BA (5.0 μM) and kinetin (5.0 μM) (Dayal et al. 2003; Villiers et al. 2008). In pigeon pea, an additional step of elongation of multiple shoot is required on medium containing GA3 (Dayal et al. 2003; Villiers et al. 2008). However, regeneration frequency in these studies is far from optimum. The maximum shoot regeneration from leaf petiole explants was only 46 % in Cajanus cajan (Villiers et al. 2008) and 84 % in V. radiata (Mahalakshmi et al. 2006). However, in the present study 95 % shoot regeneration response was achieved on MSB medium containing BA as a sole growth regulator. Other cytokinins like kinetin, zeatin, 2-ip and TDZ reduced the regeneration response and shoot number when used at equimolar concentration (1.0 μM) (Table 1).

Among cytokinins, BA was found to be the most effective for induction of higher regeneration frequency and the maximum number of multiple shoots (10) in V. mungo. Similar morphogenetic response was obtained in V. radiata but with a higher concentration of BA (Mahalakshmi et al. 2006). Addition of NAA or IAA to BA enriched medium decreased the number of shoots regenerated from leaf petiole explants. However, the regeneration frequency of the explant was not much affected. Thus shoot forming response of BA (1.0 μM) was not improved when it was supplemented with auxins either NAA or IAA each at 0.5 or 1.0 μM concentration. Both the auxins at higher concentration (1.0 μM) in combination with 1.0 μM BA induced callus at the cut end of petioles. The nature of callus differed with the type of auxin. NAA induced yellow creamish friable callus whereas IAA induced light greenish callus which did not regenerate shoots even on transfer to shoot induction medium (Table 1). In contrast to present study, the maximum shoot regeneration response was achieved on 0.5 μM NAA and 22 μM BA in Cajanus cajan (Srinivasan et al. 2004). Explants comprising of the petiole with basal half of the lamina or the petiole with complete lamina proved to be efficient for shoot regeneration (95 %) than the explants without lamina (60 %) (Table 2). The explants with lamina produced 10 shoots per explant while those without lamina produced a single shoot per explant. This indicates that the presence of lamina was essential to elicit full regeneration potential of petiole and induction of multiple shoots. Similar beneficial role of the lamina on shoot induction has also been demonstrated in Cajanus cajan (Dayal et al. 2003) and V. radiata (Mahalakshmi et al. 2006). The primary leaves with petiole excised from seedlings of different ages on MSB medium containing 1.0 μM BA showed increase in the regeneration frequency and the number of shoots per explant up to 4-days, thereafter, both the parameters decreased. The decrease in number of shoots per explant was more than the decrease in frequency of regeneration. The explants excised from 4-day-old seedlings were more responsive for shoot regeneration than those from 10-day-old seedlings (Table 3). These results are in agreement with those obtained in Cajanus cajan (Srinivasan et al. 2004), and are in contrast to those obtained in V. radiata (Mahalakshmi et al. 2006).

Table 2.

Effect of explant type on in vitro shoot regeneration from Vigna mungo cv. PS-1

Explant type Frequency of regenerating explants (%) Mean number of shoots per explants (Mean ± S.E.)2 Mean shoot length per explants (cm) (Mean ± S.E.)2
Entire primary leaf with petiole 90 10.0 ± 0.8a 1.6 ± 0.3a
Transverse basal half of primary leaf with petiole 95 10.0 ± 0.6a 1.1 ± 0.3a
Longitudinal half of primary leaf with petiole 90 3.3 ± 0.3b 1.3 ± 0.4a
Leaf petiole without lamina 60 1.3 ± 0.0c 1.1 ± 0.5a
Primary leaf without petiole 0 0 0
Open in a new tab

Culture medium: MSB (MS salts + B5 vitamins) + BA (1.0 μM)

2Data based on 24 explants per treatment and each experiment repeated thrice. Data scored after 28 days of culture

Means followed by the same letter are not significantly different according to Newman-Keuls multiple-range test (P = 0.05)

Table 3.

Effect of age of the donor seedling on regeneration from primary leaf with petiole explants of Vigna mungo cv. PS-1

Age in days Frequency of regenerating explants (%) Mean number of shoots per explant (Mean ± S.E)2 Mean shoot length per explants(cm) (Mean ± S.E)2
2 70 3.1 ± 0.8a 1.6 ± 0.3a
3 85 7.2 ± 0.3b 1.3 ± 0.1a
4 95 10.0 ± 0.8c 1.1 ± 0.3a
5 95 8.0 ± 0.4d 1.0 ± 0.3a
6 90 6.5 ± 0.3e 1.5 ± 0.1a
7 85 4.0 ± 0.2f 1.3 ± 0.3a
10 70 3.8 ± 0.3f 1.4 ± 0.4a
Open in a new tab

Culture medium: MSB (MS salts + B5 vitamins) + BA (1.0 μM)

2Data based on 24 explants per treatment and each experiment repeated thrice. Data scored after 28 days of culture

Means followed by the same letter are not significantly different according to Newman-Keuls multiple-range test (P = 0.05)

The shoot regeneration response of 4-day-old leaf petiole explants with half lamina on 1.0 μM BA was tested to determine its applicability to other blackgram cultivars, PS-1, PS-2 and T-9. Genotype had a marked effect on regeneration frequency and shoots per explant. Highest regeneration frequency (95 %) was obtained with PS-1 with ten shoots per explant with an average length of 1.1 cm (Table 4). Similar genotypic differences in shoot regeneration from other explants have also been reported in previous studies in Vigna mungo (Saini and Jaiwal 2002; Saini et al. 2003; Saini and Jaiwal 2005).

Table 4.

In vitro shoot regeneration of 4-day-old primary leaf with petiole explants obtained from different cultivars of Vigna mungo

Cultivar Frequency of regenerating explants (%) Mean number of shoots per explant (Mean ± S.E.)2 Mean shoot length per explant (cm) (Mean ± S.E.)2
PS-1 95 10.0 ± 0.8a 1.1 ± 0.3a
T-9 90 6.6 ± 0.7b 1.2 ± 0.4a
PS-2 80 7.0 ± 0.3b 1.0 ± 0.3a
Open in a new tab

Culture medium: MSB (MS salts + B5 Vitamins) + BA (1.0 μM)

2Data based on 24 explants per treatment and each experiment repeated thrice. Data scored after 28 days of culture

Means followed by the same letter are not significantly different according to Newman-Keuls multiple-range test (P = 0.05)

Selection

Kanamycin has been successfully employed as a selectable marker in transformation of various legume crops like Vigna mungo (Karthikeyan et al. 1996; Saini et al. 2003; Saini and Jaiwal 2005; Bhomkar et al. 2008), Vigna unguiculata (Muthukumar et al. 1995; Chaudhary et al. 2007), Cicer arietinum (Krishanamurthy et al. 2000), Pisum sativum (Grant et al. 1998), Arachis hypogea (Sharma and Anjaiah 2000), Vigna radiata (Jaiwal et al. 2001) and Vigna angularis (Yamada et al. 2001). The sensitivity of plant cells to the selective agent depends upon the genotype, the explant type, size and developmental stage of tissue(s). So it is compulsory to determine the lowest concentration of the selective agent that suppresses growth and proliferation of untransformed cells. The survival (determined by necrosis of explants), regeneration frequency and the average number of shoots per explant decreased with increasing kanamycin concentration. Kanamycin at 70 mgl−1 in shoot regeneration medium drastically reduced the survival as well as the regeneration frequency of the explants and completely bleached the non-transformed shoots. Kanamycin concentrations higher than 70 mgl−1 were lethal causing necrosis of explants and complete inhibition of regeneration. Therefore, 70 mgl−1 kanamycin was choosen for the selection of the transformed shoots in the transformation experiments. Root induction was completely inhibited in non-transformed (control) shoots cultured on MSB + 2.5 μM IBA medium containing 10.0 mgl−1 kanamycin.

Optimization of transformation protocol

Several chemical and physical parameters are pre-requisites for efficient transformation by A. tumefaciens. Bacterial concentration (cells/ml), inoculation time, co-cultivation period, addition of phenolic compound (acetosyringone) and various antioxidants in co-cultivation medium are significant factors affecting competence of tissue(s) and Agrobacterium virulence for achieving the maximum transformation frequencies. These factors were optimized to improve the transformation efficiency on the basis of transient uidA expression using primary leaf explants (Table 5).

Table 5.

Effect of different transformation parameters on transient GUS activity in primary leaf petiole explants of Vigna mungo co-cultivated with Agrobacterium tumefaciens strain EHA105 harboring binary vector pCAMBIA2301

Factor Variable % explant showing GUS activity
Bacterial concentration (cells/ml) 106 67a
107 88b
108 80b
109 76b
Inoculation time (minutes) 10 60a
20 85b
30 79b
40 61a
Co-cultivation time (days) 1 58a
2 76b
3 89c
4 81bc
Acetosyringone (μM) 30 60a
50 69b
70 76b
100 90c
130 82bc
pH 5.0 59a
5.2 71b
5.5 82c
5.8 66b
Co-cultivation temperature (°C) 22 55a
24 73b
26 68b
28 48c
L- cysteine (mM) 0.0 58a
2.0 69b
5.0 85c
7.0 79c
DTT (mM) 0.5 59a
1.0 66b
1.5 81c
2.0 74c
Open in a new tab

Data based on 24 explants per treatment and each experiment repeated thrice

Mean values within column for each factor separately followed by same letter are not significantly different according to Newman-Keuls multiple-range test (p = 0.05)

Of the four different bacterial concentrations (106, 107, 108, 109 cells/ml), the maximum transformation frequency was observed at a concentration of 107 cells/ml with a constant increase up to 107 cells/ml and decrease theiroff, as reported in tobacco, Arabidopsis thaliana (Lin et al. 1994) and other grain legumes (Bean et al. 1997). Too much bacteria results in Agrobacterial aggregation or trouble in eliminating them after co-cultivation or oversensitive reply of explants with less regeneration potential. So the concentration of bacteria used for transformation is an important parameter that may influence the number of transformed cells/explant in various species (Fillati et al. 1987; Saini and Jaiwal 2007).

Variable transient GUS expression were found when explants were incubated with bacterial suspension for 10 to 40 min with utmost transformation frequency in explants incubated for 20 min with gentle shaking at 90 rpm. Further increase caused difficulty in bacterial elimination instead of any increase in transformation frequency which remains unaffected.

For primary leaf explants, 3-days of co-cultivation period was optimal and any further increase had negative effect on regeneration potential of explants due to bacterial overgrowth, decreasing the transformation frequency. Most of the Vigna species, Vigna unguiculata (Chaudhary et al. 2007) and Vigna radiata (Jaiwal et al. 2001; Sonia et al. 2007) required 2–3 days co-cultivation period for the maximum transformation frequency.

Addition of acetosyringone (100 μM), to the bacterial-suspension medium and co-cultivation medium increased transformation rate of Vigna mungo with greater GUS activity. Similar affirmative effects has been reported in several leguminous species such as Pisum sativum (Svabova and Griga 2008), Glycine max (Santarem et al. 1998; Ko and Korban 2004), Vigna angularis (Yamada et al. 2001), Phaseolus vulgaris (De Clercq et al. 2002), Vigna mungo (Saini et al. 2003; Muruganantham et al. 2007), Vigna unguiculata (Popelka et al. 2006) and Vigna radiata (Sonia et al. 2007). Acetosyringone increases transformation potential of Agrobacterium strain by enhancing vir functions during transformation (Stachel et al. 1986) and has been used in several other plant species also (Atkinson and Gardner 1991; Kaneyashi et al. 1994).

Maximum frequency of transient GUS expression was recorded at pH-5.5, in the presence of acetosyringone (100 μM). The vir gene induction and transformation are influenced by the pH of co-cultivation medium. Low pH and acetosyringone together may be crucial to vir gene induction (Kapila et al. 1997). They can affect the Agrobacterium virulence to a long extent however, variations have been found across species (Godwin et al. 1991). Our results were in accordance with these observations. Higher transformation frequency has been reported at low pH of bacterial inoculation and co-culture media (Popelka et al. 2006; Sonia et al. 2007; Solleti et al. 2008).

Inclusion of antioxidants like L-cysteine (5.0 mM) and DTT (1.5 mM) completely inhibited the browning and necrosis of explants cells and increased the number of explants showing intense GUS activity. They have been used for co-cultivation in order to enhance the final efficiency of the transformation protocol. L-cystein acts as a nutritional supplement and is involved in pathogen-defense response. Its has thiol group which acts as an antioxidant or wound inhibitor. DTT is also an efficient antioxidant with potential anti-necrotic property and is least toxic for plant cells (Svabova and Griga 2008). The beneficial role of thiol compounds on greater survival of explants during co-cultivation has been reported in soybean (Olhoft et al. 2001, 2003; Zeng et al. 2004), Vigna unguiculata (Popelka et al. 2006), Zea maize (Frame et al. 2002) and Vitis vinifera (Das et al. 2002a, b).

During co-cultivation, temperature is an important factor affecting T-DNA transfer. In the present study, transformation frequency was highest when co-cultivation was performed at 24 °C. Co-cultivation at low temperature has been reported in several instances (Fullner and Nester 1996; Kapila et al. 1997; Dillen et al. 1997; Popelka et al. 2006). It has also been found that the temperature dependence profile of T-DNA transfer does not parallel with that of vir gene induction, indicating that another factor possibly the formation of a conjugal pilus is causing temperature sensitivity of T-DNA transfer (Fullner et al. 1996).

Transformation and GUS activity

The applicability of the present regeneration protocol for Agrobacterium-mediated transformation and the competency of the regeneration competent meristmetic cells at cut end of primary leaves were determined by inoculating the explants with A. tumefaciens. The uidA gene contained an intron in the coding region so that it would not be expressed in Agrobacterium. Eighty five percent of the explants showed endogenous GUS activity immediately after co-cultivation at regenerating sites of the primary leaves indicating the amenability of explants to Agrobacterium-mediated transformation. The endogenous GUS activity was not found in non transformed (control) explants (Fig. 3). Histochemical GUS assay has also been used to confirm the presence of the GUS gene and hence transformation of chrysanthemum ‘Orlando’ petal explants (Song et al. 2012)

Fig. 3.

Fig. 3

Open in a new tab

a-b Transient GUS expression in primary leaf explants inoculated with Agrobacterium tumefaciens strain EHA 105 harboring a binary vector pCAMBIA2301 that contained uid A (GUS) and nptll genes a. The non-transformed (control) primary leaf with petiole explant showing no GUS activity b. Primary leaf explant with petiole showing transient GUS activity at the regeneration site after 3 days of co-cultivation with Agrobacterium tumefaciens EHA105 (pCAMBIA2301)

Regeneration of transformants

A total of 230 explants produced 79 green shoots on kanamycin selection medium and 66 were rooted (28.69 %) in the presence of kanamycin (10 mgl−1) and cefotaxime (500 mgl−1). Sixty six rooted shoots when transferred to soil, 55 of them survived (23.91 %), matured and produced transgenic seeds in the green house (Table 6). The seeds were sown to raise the T1 plants. Establishment of plants required approximately 2 months. Molecular analysis confirmed their transgenic nature.

Table 6.

Summary of the transformation of 4-day-old primary leaf explants of Vigna mungo cv. PS-1

Expt. no. No. of explants inoculated with Agrobacterium suspension No. of shoots recovered on selection mediuma No. of shoots rooted on selection mediumb No. of putative transgenic plants established in soil No. of plants positive for nptII gene by PCR No. of plants positive for nptII by Southern blot hybridization
1 85 31 27 25 9 3
2 75 27 22 20
3 70 21 17 10
Total 230 79 66 55
Open in a new tab

Cocultured with Agrobacterium tumefaciens strain EHA105 containing a binary vector pCAMBIA2301

a Selection medium for shoot regeneration: MSB + BA (1.0 μM) + kanamycin (70 mgl−1) + cefotaxime (500 mgl−1)

b Selection medium for root induction: MSB + IBA (2.5 μM) + kanamycin (10 mgl−1) + cefotaxime (500 mgl−1)

Molecular analysis of transgenic plants

PCR analysis for nptII and virA genes

PCR analysis showed amplification of an expected fragment of 680 bp which corresponds to the coding region of nptII gene and shows the presence of transgene in nine out of 55 putative transformed plants (Fig. 4). Untransformed (control) plants did not show any amplification. The negative results could be due to the survival of non-transformed shoots on the selection medium. Since most of the legumes including Vigna species show high tolerance to kanamycin (Saini and Jaiwal 2005) hence the high number of escaped shoots on selection may be a possibility. PCR analysis of nptII positive plants with vir primers did not show any amplification thus ruling out the possibility of Agrobacterium contamination in the transformed plants.

Fig. 4.

Fig. 4

Open in a new tab

Molecular analysis of primary transformants of Vigna mungo transformed with Agrobacterium tumefaciens strain EHA105 harboring a binary vector pCAMBIA2301 that contained uid A (GUS) and nptII genes a PCR analysis of putative transformants with primers specific to the coding region of nptII gene Lane M: DNA Molecular weight marker (1 kb) Lane C: DNA from non-transformed (control) plant Lane P: positive plasmid DNA Lanes 1 to 10: DNA from transformed plants (T0) b. PCR analysis of putative transformants with primers specific to the coding region of vir A gene Lane M: DNA Molecular weight marker (1 kb) Lane C: DNA from non-transformed (control) plant Lane P: Plasmid DNA Lanes 1 to 9: DNA from transformed plants (T0)

Southern hybridization

Southern analysis of T0 plants positive for nptII gene by PCR was performed to confirm the integration of nptII gene into their genome and to determine its copy number. The genomic DNA of PCR positive plants was isolated and digested with HindIII and hybridized with 680 bp amplicon of nptII gene (probe). nptII probe was hybridized to digested DNA from transgenic plants but not to untransformed (control) plants, indicating that nptII gene was integrated into blackgram genome. Digestion with HindIII and subsequent probing with nptII coding region identifies border fragments between the T-DNA and plant DNA. Untransformed (control) plant DNA did not hybridize to the nptII probe. However, the bands size with the nptII probe were greater than nptII containing HindIII fragment (2.1 kb) establishing the integration of the nptII gene into genome of the plant. The hybridization pattern showed that three plants had a single copy of T-DNA integrated in the genome (Fig. 5) Hybridization signals in all the three plants were of the same size indicating that these plants are derived from a single transformation event. However, six plants that were PCR positive were negative after southern analyses which may be due to the incomplete insertion, unstable integration of the transferred gene into plant genome and hence its loss (Hess et al. 1990; Langridge et al. 1992). Thus, southern analysis established the existence and integration of the transgene in the transformants. A stable transformation frequency of 1.3 % (number of the southern positive plants / total number of explants inoculated with Agrobacterium x 100) was obtained.

Fig. 5.

Fig. 5

Open in a new tab

Southern hybridization of genomic DNA from primary leaf explants with Agrobacterium tumefaciens strain EHA105 harboring a binary vector pCAMBIA2301 that contained uid A (GUS) and nptII genes. a. Southern blot analysis of genomic DNA of transformed and non- transformed control plants. The DNA was digested with HindIII, and blot was probed with the PCR amplified fragment (680 bp) of nptII gene. Lane M: DNA Molecular weight marker (1 kb) Lane C: DNA from untransformed (control) plant Lanes 1–3: DNA from transformed plants Lane P: Plasmid DNA

PCR analysis of T1 progeny

All the three Southern positive T0 plants were self fertilized to produce seeds. PCR was done by using nptII specific primers to analyze the progeny of the T0 plants and segregation for the presence and absence of nptII-amplified band in a simple Mendelian 3:1 ratio was observed suggesting a single integration site (Table 7), (Fig. 6). Statistical analysis of the progeny also confirmed inheritance and segregation of the transgene in 3:1 ratio at 0.05 % significance level.

Table 7.

Segregation ratios of the nptII gene in selfed progenies of T0 transformed V. mungo cv. PS-1

Transformants Total number of T0 seeds collected Number of T1 plants raised in pots Number of plants positive for nptII by PCR Number of plants negative for nptII by PCR (p value) χ2 –Test Expected segreg-ation ratio
1 40 20 15 5 0.49 (p < 0.05) 3:1
2 32 14 10 4 0.56 (p < 0.05) 3:1
3 35 16 12 4 0.82 (p < 0.05) 3:1
Open in a new tab
Fig. 6.

Fig. 6

Open in a new tab

PCR analysis of T1 plants using primers specific to nptII gene Lane M: DNA Molecular weight marker (1 kb) Lane C: DNA from non-transformed (control) plant Lane P: Positive plasmid DNA Lanes1 to 6: DNA from T1 transformed plants Lane N: Negative control (water)

In conclusion, morphologically normal and fertile plants of V. mungo have been regenerated via direct shoot organogenesis from the leaf petiole explants on MSB medium containing BA as sole growth regulator for the first time. The type and concentration of cytokinin, type and age of explant, preconditioning of explants and genotype significantly influenced the regeneration response. Earlier less number of shoots per explant from various explants were reported (Saini and Jaiwal 2002; Saini et al. 2003; Saini and Jaiwal 2005). Similarly, the previous studies on plant regeneration via indirect organogenesis also reported a very low regeneration frequency with a few shoots (Srivastava and Pandey 2011). Because of direct regeneration, the somaclonal variations are low and the time required for establishing a plant in pot is only 8 weeks. Moreover, regeneration site, i.e. cut end of the petiole is fully exposed to Agrobacterium, therefore such explants are more suitable for Agrobacterium-mediated genetic transformation for the production of transgenic plants. Since the plant is recalcitrant to transformation, the various factors affecting the efficiency of gene transfer were optimized. The effect of inclusion of antioxidants (L-cysteine and DTT) in co-cultivation medium was not reported previously in blackgram. The presence of 5 mM L-cysteine and 1.5 mM DTT in the co-cultivation medium inhibited the browning/necrosis of explant cells and increased the number of explants showing intense GUS activity. Similar results were observed in several plant species (Dan 2008). The presence and integration of transgenes in T0 plants was confirmed by PCR and Southern blot analysis. The T0 plants transmitted transgenes to progeny in Mendelian fashion as revealed by PCR.

Acknowledgments

Authors are thankful to the Center for Application of Molecular Biology to International Agriculture (CAMBIA) for plasmid pCAMBIA2301 and Dr. P. A. Kumar, NRC on Plant Biotechnology, IARI, New Delhi for providing laboratory facilities for the Southern blot hybridization. PKJ is grateful to Department of Biotechnology, New Delhi for financial support to his laboratory for improvement of grain legumes. MS is thankful to Council of Science and Industrial Research, Department of Biotechnology and Department of Science and Technology, New Delhi for research fellowships.

References

  1. Atkinson RG, Gardner R. Agrobacterium-mediated transformation of pepino and regeneration of transgenic plants. Plant Cell Rep. 1991;10:208–212. doi: 10.1007/BF00234297. [DOI] [PubMed] [Google Scholar]
  2. Bean SJ, Gooding PS, Mullineaux PM, Davies DR. A simple system for pea transformation. Plant Cell Rep. 1997;16:513–519. doi: 10.1007/BF01142315. [DOI] [PubMed] [Google Scholar]
  3. Bhomkar P, Upadhyay CP, Saxena M, Muthusamy A, Prakash NS, Pooggin M, Hohn T, Sarin NB. Salt stress alleviation in transgenic Vigna mungo L. Hepper (blackgram) by over expression of the glyoxalase 1 gene using a novel Cestrum yellow leaf curling virus (CmYLCV) promoter. Mol Breed. 2008;22:169–181. doi: 10.1007/s11032-008-9164-8. [DOI] [Google Scholar]
  4. Frame BR, Shou H, Chikwamba RK, Zhang Z, Xiang CH, Fonger TM, Degg SEK, Li B, Nettleton DS, Pei D, Wang K. Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binary vector system. Plant Physiol. 2002;129:13–22. doi: 10.1104/pp.000653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bruning JL, Kintz BL. Computational handbook of statistics. 2. Glenview: Scott, Foresman and Co; 1977. [Google Scholar]
  6. Chaudhary D, Madanpotra S, Jaiwal R, Saini A, Kumar P, Jaiwal PK. Agrobacterium tumefaciens-mediated high frequency genetic transformation of an Indian cowpea (Vigna unguiculata L.Walp) cultivar and transmission of transgene into progeny. Plant Sci. 2007;172:692–700. doi: 10.1016/j.plantsci.2006.11.009. [DOI] [Google Scholar]
  7. Dan Y. Biological functions of antioxidants in plant transformation. In Vitro Cell Dev Biol Plant. 2008;44:146–161. doi: 10.1007/s11627-008-9110-9. [DOI] [Google Scholar]
  8. Das DK, Bhomkar P, Shiva Prakash N, Bhalla Sarin N. Improved method of regeneration of blackgram (Vigna mungo L.) through liquid culture. In Vitro Cell Dev Biol Plant. 2002;38:456–459. doi: 10.1079/IVP2002336. [DOI] [Google Scholar]
  9. Das PK, Roy M, Mandal N. In vitro organogenesis from shoot tip in blackgram. Indian J Genet Plant Breed. 2002;62:91–92. [Google Scholar]
  10. Dayal S, Lavanya M, Devi P, Sharma KK. An efficient protocol for shoot regeneration and genetic transformation of pigeonpea (Cajanus cajan L.) using leaf explants. Plant Cell Rep. 2003;21:1072–1079. doi: 10.1007/s00299-003-0620-y. [DOI] [PubMed] [Google Scholar]
  11. De Clercq J, Zambre M, Van Montagu M, Dillen W, Angenon G. An optimized Agrobacterium-mediated transformation procedure for Phaseolus acutifolius. A. Gray. Plant Cell Rep. 2002;21:333–340. doi: 10.1007/s00299-002-0518-0. [DOI] [Google Scholar]
  12. Delic D, Stajkovic O, Kyzmanovic D, Rasulic N, Knezevic S, Milicic B. The effects of rhizobial inoculation on growth and yield of Vigna mungo L. in Serbian soils. Biotechnol Anim Husb. 2009;25:1197–1202. [Google Scholar]
  13. Dillen W, DeClercq J, Kapila J, Zhambre M, Montaque MV, Angenon G. The effect of temperature on Agrobacterium-mediated gene transfer to plants. Plant J. 1997;12:1459–1463. doi: 10.1046/j.1365-313x.1997.12061459.x. [DOI] [Google Scholar]
  14. Fillati JJ, Sellmer J, Mc Cown B, Haissing B, Comai L. Agrobacterium-mediated transformation and regeneration of Populus. Mol Gen Genet. 1987;206:192–199. doi: 10.1007/BF00333574. [DOI] [Google Scholar]
  15. Franklin G, Ignacimuthu S. Differential morphogenetic response of cotyledonary explants of Vigna mungo. Biol Plant. 2000;43:1–4. doi: 10.1023/A:1026587904785. [DOI] [Google Scholar]
  16. Fullner KJ, Nester EW. Temperature affects the T-DNA transfer machinery of Agrobacterium tumefaciens. J Bacteriol. 1996;178:1498–1504. doi: 10.1128/jb.178.6.1498-1504.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fullner KJ, Lara JC, Nester EW. Pilus assembly by Agrobacterium T-DNA transfer genes. Science. 1996;273:1107–1109. doi: 10.1126/science.273.5278.1107. [DOI] [PubMed] [Google Scholar]
  18. Gamborg OL, Miler RA, Ojima K. Nutrient requirement of suspension culture of soybean root cells. Exp Cell Res. 1968;50:151–158. doi: 10.1016/0014-4827(68)90403-5. [DOI] [PubMed] [Google Scholar]
  19. Gawali MP, Akhare AA, Gahukar SJ. In vitro regeneration of pigeonpea from leaf with petiole explants. Asian Sci. 2010;5:34–38. [Google Scholar]
  20. Godwin I, Todd G, Ford-Lloyd B, Newbury HJ. The effect of acetosyringone and pH on Agrobacterium-mediated transformation vary according to plant species. Plant Cell Rep. 1991;9:671–675. doi: 10.1007/BF00235354. [DOI] [PubMed] [Google Scholar]
  21. Grant JE, Cooper PA, Gilpin BJ, Hoglund SJ, Reader JK, Pither Joyece MD, Timmerman-Vaughan GM. Kanamycin is effective for selecting transformed peas. Plant Sci. 1998;139:159–164. doi: 10.1016/S0168-9452(98)00184-8. [DOI] [Google Scholar]
  22. Harisaranraj R, Saravana BS, Suresh K. Callus Induction and plant regeneration of Vigna mungo (L.) Hepper via half seed explant. Ethnobot Leafl. 2008;12:577–585. [Google Scholar]
  23. Hess D, Dressler K, Nimmrichter R. Transformation experiments by pipetting Agrobacterium into the spikelets of wheat ( Triticum aestivum L.) Plant Sci. 1990;72:233–244. doi: 10.1016/0168-9452(90)90087-5. [DOI] [Google Scholar]
  24. Ignacimuthu S, Franklin G. Regeneration of plantlets from cotyledon and embryogenic axis explants of Vigna mungo L. Hepper. Plant Cell Tissue Organ Cult. 1999;55:75–78. doi: 10.1023/A:1026481310822. [DOI] [Google Scholar]
  25. Jaiwal PK, Kumari R, Ignacimuthu S, Potrykus I, Sautter C. Agrobacterium tumefaciens-mediated genetic transformation of mungbean (Vigna radiata L. Wilczek) a recalcitrant grain legume. Plant Sci. 2001;161:239–247. doi: 10.1016/S0168-9452(01)00352-1. [DOI] [PubMed] [Google Scholar]
  26. Jefferson RA. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep. 1987;5:387–405. doi: 10.1007/BF02667740. [DOI] [Google Scholar]
  27. Kaneyashi J, Kobayashi S, Nakamura Y, Shigemoto N, Doi Y. A simple and efficient gene transfer system of trifoliate orange. Plant Cell Rep. 1994;13:541–545. doi: 10.1007/BF00234507. [DOI] [PubMed] [Google Scholar]
  28. Kapila J, DeRycke R, Van Montagu M, Angenon G. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci. 1997;122:101–108. doi: 10.1016/S0168-9452(96)04541-4. [DOI] [Google Scholar]
  29. Karamany EL. Double purpose (forage and seed) of mungbean production 1-effect of plant density and forage cutting date on forage and seed yields of mungbean (Vigna radiata (L.) Wilczeck) Res J Agric Biol Sci. 2006;2:162–165. [Google Scholar]
  30. Karthikeyan AS, Sharma KS, Veluthambi K. Agrobacterium tumefaciens-mediated transformation of Vigna mungo (L.) Hepper. Plant Cell Rep. 1996;15:328–331. doi: 10.1007/BF00232365. [DOI] [PubMed] [Google Scholar]
  31. Ko TS, Korban SS. Enhancing the frequency of somatic embryogenesis following Agrobacterium-mediated transformation of immature cotyledon of soybean (Glycine max (L.) Merrill) In Vitro Cell Dev Biol Plant. 2004;40:552–558. doi: 10.1079/IVP2004566. [DOI] [Google Scholar]
  32. Krishanamurthy KV, Suhasini K, Sagare AP, Meixner M, de Kathen PT, Schieder O. Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) embryo-axes. Plant Cell Rep. 2000;19:235–240. doi: 10.1007/s002990050005. [DOI] [PubMed] [Google Scholar]
  33. Langridge P, Brettschneider R, Lazzeri P, Lorz H. Transformation of cereals via Agrobacteriumand the pollen pathway: a critical assessment. Plant J. 1992;2:631–638. doi: 10.1111/j.1365-313X.1992.00631.x. [DOI] [Google Scholar]
  34. Lin JJ, Garcia-Assad N, Kuo J. Effect of Agrobacterium cell concentration on the transformation efficiency of tobacco and Arabidopsis thaliana. Focus. 1994;16:72–77. [Google Scholar]
  35. Lukoki L, Marechal R, Otoul E. Les ancetres sauvages des haricots cultives: Vigna radiata (L.) Wilczek et V. mungo (L.) Hepper. Bull Jard Bot Nat Belg. 1980;50:385–391. doi: 10.2307/3667837. [DOI] [Google Scholar]
  36. Mahalakshmi SL, Leela T, Manoj Kumar S. Enhanced genetic efficiency of mungbean by use of primary leaf explants. Curr Sci. 2006;91:93–98. [Google Scholar]
  37. Mony SA, Haque MS, Alam MM, Hasanuzzaman M, Nahar K. Regeneration of blackgram (Vigna mungo L.) on changes of hormonal condition. Not Bot Hort Agrobot Cluj. 2010;38:140–145. [Google Scholar]
  38. Mujib A. In vitro regeneration of Sandal ( Santalum album L.) from leaves. Turk J Bot. 2005;29:63–67. [Google Scholar]
  39. Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant. 1962;15:473–497. doi: 10.1111/j.1399-3054.1962.tb08052.x. [DOI] [Google Scholar]
  40. Muruganantham M, Ganapathi A, Amutha S, Vengadesan G, Selvaraj N. Shoot regeneration from immature cotyledonary nodes in black gram (Vigna mungo (L.) Hepper) Indian J Biotechnol. 2005;4:551–555. [Google Scholar]
  41. Muruganantham M, Amutha S, Selvaraj N, Vengadesan G, Ganapathi A. Efficient Agrobacterium-mediated transformation of Vigna mungo using immature cotyledonary node explants and phosphinothricin as the selection agent. In Vitro Cell Dev Biol Plant. 2007;43:550–557. doi: 10.1007/s11627-007-9060-7. [DOI] [Google Scholar]
  42. Muthukumar B, Marriyamma M, Gananam A. Regeneration of plants from primary leaves of cowpea. Plant Cell Tiss Org Cult. 1995;44:153–155. doi: 10.1007/BF00034232. [DOI] [Google Scholar]
  43. Olhoft PM, Lin K, Galbraith J, Nielsen NC, Somers DA. The role of thiol compounds increasing Agrobacterium-mediated transformation of soybean cotyledonary node cells. Plant Cell Rep. 2001;20:731–737. doi: 10.1007/s002990100388. [DOI] [Google Scholar]
  44. Olhoft PM, Flagel LE, Denovan CM, Somers DA. Efficient soybean transformation using hygromycin B selection in the cotyledonary node method. Planta. 2003;216:723–735. doi: 10.1007/s00425-002-0922-2. [DOI] [PubMed] [Google Scholar]
  45. Popelka C, Gollasch S, Moore A, Molvig L, Higgins TJV. Genetic transformation of cowpea (Vigna unguiculata L.) and stable transmission of the transgenes to progeny. Plant Cell Rep. 2006;25:304–312. doi: 10.1007/s00299-005-0053-x. [DOI] [PubMed] [Google Scholar]
  46. Rogers SO, Bendich AJ. Extraction of DNA from plant tissues. In: Gelvin SB, Schilperoot RA, editors. Plant molecular biology mannual. Dordrecht: Kluwer Acad. Publ; 1988. pp. 1–11. [Google Scholar]
  47. Sahoo L, Jaiwal PK. Asiatic beans. In: Kole C, Hall TC, editors. A compendium of transgenic crop plants. Oxford: Blackwell Publ; 2008. pp. 115–132. [Google Scholar]
  48. Saini R, Jaiwal PK. Age, position in mother seedling, orientation and polarity of the epicotyl segments of blackgram (Vigna mungo L. Hepper) determines its morphogenic response. Plant Sci. 2002;163:101–109. doi: 10.1016/S0168-9452(02)00062-6. [DOI] [Google Scholar]
  49. Saini R, Jaiwal PK. Transformation of a recalcitrant grain legume, Vigna mungo L. Hepper using Agrobacterium tumefaciens-mediated gene transfer to shoot apical meristem cultures. Plant Cell Rep. 2005;24:164–171. doi: 10.1007/s00299-005-0934-z. [DOI] [PubMed] [Google Scholar]
  50. Saini R, Jaiwal PK. Agrobacterium tumefaciens—mediated transformation of blackgram: an assessment of factors influencing the efficiency of uidA gene transfer. Biol Plant. 2007;51:69–74. doi: 10.1007/s10535-007-0014-z. [DOI] [Google Scholar]
  51. Saini R, Makani S, Jaiwal PK. Stable genetic transformation of Vigna mungo L. Hepper via Agrobacterium tumefaciens. Plant Cell Rep. 2003;21:851–859. doi: 10.1007/s00299-003-0574-0. [DOI] [PubMed] [Google Scholar]
  52. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  53. Santarem ER, Trick HN, Essig JS, Fines JJ. Sonication assisted Agrobacterium-mediated transformation of soybean immature cotyledons: Optimization of transient expression. Plant Cell Rep. 1998;17:752–759. doi: 10.1007/s002990050478. [DOI] [PubMed] [Google Scholar]
  54. Sen J, Guha-Mukherjee S. In vitro induction of multiple shoots and plant regeneration in Vigna. In Vitro Cell Dev Biol Plant. 1998;34:276–280. doi: 10.1007/BF02822733. [DOI] [Google Scholar]
  55. Sharma KK, Anjaiah V. An efficient method for the production of transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium tumefaciens-mediated genetic transformation. Plant Sci. 2000;159:7–19. doi: 10.1016/S0168-9452(00)00294-6. [DOI] [PubMed] [Google Scholar]
  56. Solleti SK, Bakshi S, Sahoo L. Additional virulence genes in conjunction with efficient selection scheme and compatible culture regime enhance recovery of stable transgenic plants of cowpea via Agrobacterium tumefaciens- mediated transformation. J Biotechnol. 2008;135:97–104. doi: 10.1016/j.jbiotec.2008.02.008. [DOI] [PubMed] [Google Scholar]
  57. Song JY, Sivanesan I, Jeong RB. Use of petal explants for successful transformation of Dendranthema × grandiflorum Kitamura ‘Orlando’ mediated by Agrobacterium tumefaciens. Afr J Biotechnol. 2012;11:9141–9148. [Google Scholar]
  58. Sonia SR, Singh RP, Jaiwal PK. Agrobacterium tumefaciens mediated transfer of Phaseolus vulgaris α-amylase inhibitor-1 gene into mungbean Vigna radiata (L.) Wilczek using bar as selectable marker. Plant Cell Rep. 2007;26:187–198. doi: 10.1007/s00299-006-0224-4. [DOI] [PubMed] [Google Scholar]
  59. Srinivasan T, Verma VK, Kirti PB. Efficient shoot regeneration in pigeon pea, Cajanus cajan (L.) Millsp. using seedling petioles. Curr Sci. 2004;86:30–32. [Google Scholar]
  60. Srivastava P, Pandey A. Standardization of callus induction and plant regeneration form leaf explants of black gram (Vigna mungo var. silvestris) Int J Inn Biol Chem Sci. 2011;1:1–6. [Google Scholar]
  61. Stachel SE, Nester EW, Zambryski P. A plant cell factor induces Agrobacterium tumefaciens vir gene expression. Proc Natl Acad Sci U S A. 1986;83:379–383. doi: 10.1073/pnas.83.2.379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Svabova L, Griga M. The effect of cocultivation treatments on transformation efficiency in pea (Pisum sativum L.) Plant Cell Tissue Organ Cult. 2008;95:293–304. doi: 10.1007/s11240-008-9443-4. [DOI] [Google Scholar]
  63. Varalaxmi V, Vijayalakshmi A, Yadav SK, Venkateswarlu B, Maheswari M. Efficient plant regeneration from cotyledons of black gram (Vigna mungo (L.) Hepper) Indian J Biotechnol. 2007;6:414–417. [Google Scholar]
  64. Villiers SD, Emongor Q, Njeri R, Gwata E, Hoisington D, Njagi I, Silim S, Sharma K. Evaluation of the shoot regeneration response in tissue culture of pigeonpea (Cajanus cajan [L.] Millsp.) varieties adapted to eastern and southern Africa. Afr J Biotechnol. 2008;7:587–590. [Google Scholar]
  65. Wright MS, Ward DV, Hinchee MA, Carnes MG, Kaufman RJ. Regeneration of soybean (Glycine max L. Merr.) from cultured primary leaf tissue. Plant Cell Rep. 1987;6:83–89. doi: 10.1007/BF00276659. [DOI] [PubMed] [Google Scholar]
  66. Yamada T, Teraishi M, Hattori K, Ishimoto M. Transformation of azuki bean by Agrobacterium tumefaciens. Plant Cell Tiss Org Cult. 2001;64:47–54. doi: 10.1023/A:1010635832468. [DOI] [Google Scholar]
  67. Zeng P, Vadnais DA, Zhang Z, Polacco JC. Refined glufosinate selection in Agrobacterium-mediated transformation of soybean (Glycine max. (L.) Merill) Plant Cell Rep. 2004;22:478–482. doi: 10.1007/s00299-003-0712-8. [DOI] [PubMed] [Google Scholar]
  68. Zeven AC, de Wet JMJ. Dictionary of cultivated plants and their regions of diversity excluding most ornamentals forest trees and lower plants. 2. Wageningen: Pudoc; 1982. [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES