Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Nov 15.
Published in final edited form as: Cancer Res. 2015 Nov 2;75(22):4830–4838. doi: 10.1158/0008-5472.CAN-15-0709

Amphiregulin is a critical downstream effector of estrogen signaling in ERα-positive breast cancer

Esther A Peterson 1, Edmund C Jenkins 1, Kristopher A Lofgren 1,2, Natasha Chandiramani 1, Hui Liu 1, Evelyn Aranda 1, Maryia Barnett 1, Paraic A Kenny 1,2,*
PMCID: PMC4651747  NIHMSID: NIHMS728164  PMID: 26527289

Abstract

Estrogen stimulation promotes epithelial cell proliferation in estrogen receptor (ERα)-positive breast cancer. Many ERα target genes have been enumerated, but the identities of the key effectors mediating the estrogen signal remain obscure. During mouse mammary gland development, the EGF receptor ligand amphiregulin acts as an important stage-specific effector of estrogen signaling. In this study, we investigated the role of amphiregulin in breast cancer cell proliferation using human tissue samples and tumor xenografts in mice. Amphiregulin was enriched in ERα-positive human breast tumor cells and required for estrogen-dependent growth of MCF7 tumor xenografts. Further, amphiregulin levels were suppressed in patients treated with endocrine therapy. Suppression of EGF receptor signaling appeared necessary for the amphiregulin response in this setting. Our findings implicate amphiregulin as a critical mediator of the estrogen response in ERα-positive breast cancer, emphasizing the importance of EGF receptor signaling in breast tumor pathogenesis and therapeutic response.

Keywords: Amphiregulin, Epidermal Growth Factor Receptor, breast cancer, tamoxifen, aromatase inhibitors

Introduction

Estrogen is an essential hormone for mammary gland development and is a key driver of proliferation during the development of estrogen receptor positive (ERα+) breast tumors. The actions of estrogen are primarily mediated by its receptor, the ERα transcription factor, which is required for mammary gland development (1). Microarray and chromatin immunoprecipitation experiments have identified several hundred estrogen-responsive genes in breast cancer cells (2, 3), however, among these targets, the identity of the key effectors of this proliferative signal in breast cancer remains unclear. A more detailed understanding of the mechanisms involved will provide insight into the processes driving ERα+ breast tumor initiation and progression.

Analysis of human mammary glands demonstrated that it is the epithelial cells adjacent to ERα+ cells (rather than the ERα+ cells themselves) which enter the cell cycle following estrogen stimulation (4), implicating an estrogen-responsive paracrine growth factor in proliferation control. In the mouse, mammary gland development from ERα-deficient cells can be rescued by co-transplanting with wild-type mammary epithelial cells, supporting a role for a paracrine factor (5). We and others have previously reported that Amphiregulin (AREG), a ligand of the Epidermal Growth Factor Receptor (EGFR), is induced during the proliferative phase of mouse pubertal mammary growth, where it is a direct transcriptional target of ERα (6, 7). Mammary glands of Amphiregulin knockout mice have a striking defect in pubertal epithelial outgrowth but retain the ability to undergo differentiation during pregnancy, indicating a stage-specific requirement (8). This phenotype is rescued by co-transplantation of wild-type and Areg−/− mammary epithelial cells (6). Thus, Amphiregulin appears to be a key mediator of estrogen action during normal mammary gland development.

Studies of human breast cancer cell lines indicate that Amphiregulin is induced by estrogen treatment (9), and that its experimental overexpression can confer epidermal growth factor signaling self-sufficiency (10), but whether endogenous Amphiregulin plays an important role in the estrogen-dependent proliferation of human breast cancer cells remains unknown. In this study, we test the hypothesis that co-option of this key stage-specific mammary developmental pathway might be the primary driver of estrogen-dependent proliferation of ERα-positive human breast cancer cells.

Materials and Methods

Cell culture

MCF-7, T47D and ZR751 were obtained from American Type Culture Collection (ATCC) (Manassas, VA), and independently validated by STR profiling at our institution. These cell lines were cultured in Dulbecco’s modified eagle medium (DMEM) (Cellgro, Manassas, VA) with 10% fetal bovine serum (FBS; Hyclone, Logan, UT). Suppression of AREG expression was achieved by lentiviral infection with two independent pLKO.1 constructs with the following sequences: shAREG-1, cactgccaagtcatagccata ; shAREG-2, gaacgaaagaaacttcgacaa; or the empty vector control. For 3D culture and in vivo experiments, FACS sorting was used to enrich for cells from shRNA-transduced pools which lacked cell-surface Amphiregulin.

Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions. 1 μg of RNA was used for cDNA synthesis using the ImProm-II Reverse Transcriptase (Promega, Madison, WI) in a 20 μl total reaction volume. Relative expression levels were determined by qPCR assays performed on a BioRad IQ™ Multicolor Real-Time PCR Detection System using primers for AREG (5′-tgatcctcacagctgttgct-3′ and 5′-tggctatgacttggcagtga-3′), and GAPDH (5′-cccactcctccacctttgac-3′ and 5′-cataccaggaaatgagcttga-3′).

ELISA

The human Amphiregulin DuoSet ELISA Development System (R & D Systems, Minneapolis, MN) was used to analyze Amphiregulin levels according to the manufacturer’s instructions, as previously described (11).

Tumor xenografts

All xenografts were performed in athymic mice and were approved by the Institutional Animal Use and Care Committee of the Albert Einstein College of Medicine. Two series of AREG knockdown experiments were performed. In the first, 14 nulliparous 5 week old athymic mice were implanted with 0.72 mg 17β-estradiol 60-day release pellets, and injected orthotopically with 1 × 106 MCF7 cells in a 1:1 mixture of DMEM and Matrigel in the right (AREG knockdown: shAREG-2) or left (empty vector control) 4th inguinal mammary fat pad of each mouse. Tumor growth was monitored for 51 days. The second series was performed identically, except 12 mice were used and monitored for 44 days.

Immunohistochemistry

Breast tumor tissue microarrays (TMA) were provided by The Ohio State University’s Human Genetics Sample Bank. Slides were dewaxed in histoclear and rehydrated by serial incubations in 100% to 70% ethanol. Slides were rinsed with water and then with TBS. Antigen retrieval was performed by incubation of slides in a steamer for 20 minutes in a preboiled solution of 10mM sodium citrate (pH 6.0). Slides were washed in TBS and incubated for 30 minutes in a solution of 2% hydrogen peroxide in 1:1 Methanol:PBS. Slides were washed in TBS, blocked (5% rabbit serum in PBS) and immunostained with goat anti-AREG antibody (15mg/ml; AF262, R&D Systems) overnight at 4°C. Slides were washed five times in TBS, followed by incubation for 30 min at room temperature in a 1:300 dilution of biotinylated anti-goat IgG antibody (Vector Laboratories, Inc. Burlingame, CA). Samples were incubated for 30 minutes at room temperature in Vectastain Elite ABC-HRP, washed twice in TBS and developed using 3, 3′-diaminobenzidine (Vector Laboratories, Inc). Samples were washed with water and counterstained with Hematoxylin, rinsed with water, dehydrated by serial ethanol washes to 100%, incubated in histoclear for 3 minutes, and mounted in Permount (Fisher Scientific). Amphiregulin staining intensity was assessed semi-quantitatively using a three-point scale by two investigators working independently on blinded samples. Discordant scores were resolved by joint review. Proliferation was assessed using mouse anti-BrdU (Roche) at a 1:400 dilution.

3D culture proliferation assay

Three-dimensional laminin-rich extracellular matrix cultures were prepared by seeding of single cells on top of a thin layer of growth factor-reduced Matrigel (BD Biosciences, San Jose, CA) and the addition of a medium containing 5% Matrigel, as previously described (12, 13). The cell lines were seeded at a density of 1000 cells/cm2 for MCF7 and 625 cells/cm2 for T47D and ZR751. Cells were seeded in DMEM supplemented with 1% charcoal/dextran-stripped FBS (Gemini Bioproducts, West Sacramento, CA), 0.292 mg/ml L-glutamine, 1x non-essential amino acids, 10.11 mg/ml sodium pyruvate, 100 IU/ml Penicillin, 100 μg/ml of Streptomycin (Hyclone, South Logan, UT) and 6 ng/ml of Human Recombinant Insulin (Calbiochem, La Jolla, CA). Digital pictures of each well were taken and colony cross-sectional area was measured using Image J.

Microarray and clinical data

Gene expression profiles of breast cancer cell lines in 3D culture (12) are available from ArrayExpress (#E-TABM-244). Gene expression profiles (NCBI accession number: GSE5462) from a study of paired tumor core biopsies taken before and after 14 days of treatment with letrozole (14, 15) were examined for the expression of Amphiregulin and other ERBB ligands and receptors. Of the 58 patients included in the study, response data were not available for 6 cases, resulting in a total of 52 paired samples included in our analysis.

Results

We examined the distribution of Amphiregulin expression in 295 breast cancer patients (16), which revealed a striking enrichment of AREG mRNA expression in ERα-positive tumors (Fig 1A). We further evaluated the quantitative relationship between AREG and ERα (ESR1) mRNA levels in 13 luminal human breast cancer cell lines grown in 3D culture (12). The highest levels of AREG are found in luminal cell lines with the highest levels of ERα expression (Fig 1B). We confirmed the association between AREG and ERα expression in an independent cohort of 118 breast cancer patients by immunostaining for Amphiregulin on tumor tissue microarrays (Fig 1C). Analysis of AREG levels in 88 ERα-positive and 30 ERα-negative tumors showed that ERα+ tumors most frequently express high levels of the Amphiregulin protein (P = 0.0194). Representative examples of staining intensity are provided and additional sections can be seen in the supplementary material.

Figure 1.

Figure 1

Open in a new tab

Amphiregulin expression is enriched in ERα+ human breast cancer. A, Gene expression microarray analysis of AREG expression in 295 human breast tumors stratified by estrogen receptor status. B, Comparison of AREG and ESR1 mRNA levels in 13 human luminal subtype breast cancer cell lines. C, Semi-quantitative immunohistochemical analysis of AREG protein expression in 118 human breast cancer cases in tumor tissue microarray format (n=88 ER+, n=30 ER−). P-value was determined using Chi-squared test. Representative images of staining intensities are shown.

As previously reported (9), we found that AREG mRNA is regulated by estrogen in MCF7 cells and extended this finding to T47D cells, an additional ERα+ breast cancer cell line. AREG mRNA was induced by estradiol and is suppressed by ERα antagonists with distinct mechanisms of action such as 4-hydroxytamoxifen (OHT) and fulvestrant (ICI182,780) in MCF7 (Fig 2A) and T47D (Fig 2B) cells. Using ELISA, we found that production of soluble Amphiregulin protein was increased upon estradiol treatment, and was suppressed by both ERα antagonists in MCF7 (Fig 2C) and T47D (Fig 2D) cells.

Figure 2.

Figure 2

Open in a new tab

Amphiregulin expression is induced by estrogen and suppressed by ERα antagonists. A, Quantitative RT-PCR analysis of AREG mRNA levels in MCF7 cells treated with estrogen (E2) alone, or supplemented with 4-hydroxytamoxifen (OHT) or fulvestrant (ICI) at the indicated concentrations. B, Quantitative RT-PCR analysis of AREG mRNA levels in T47D cells treated as described in A. C (MCF7) and D (T47D), ELISA analysis of soluble AREG protein production by cell lines treated as indicated in A. Error bars represent standard deviation. *p ≤ 0.05, **p ≤ 0.01 ***p ≤ 0.001,****p ≤ 0.0001.

These data are consistent with AREG being a transcriptional target of ERα in both human breast tumors and breast cancer cell lines, however the extent to which AREG, among hundreds of known ERα target genes (2, 3), is a key effector of ERα function remained unclear. To rigorously test the requirement for AREG in ERα-dependent proliferation, we used two shRNA constructs to establish pools of MCF7 cells with stable suppression of Amphiregulin expression. Efficient knockdown of Amphiregulin in these pools compared to the empty vector control (pLKO.1) was confirmed by both qRT-PCR (Fig 3A) and ELISA (Fig 3B) analysis. To evaluate the impact of Amphiregulin depletion on the proliferative response to estrogen, we performed 3D culture experiments. The vector control (pLKO.1) MCF7 cell line exhibited a robust growth response to estrogen, while neither shRNA-transduced subline responded (Fig 3C). To test if the requirement for Amphiregulin for growth in 3D culture was a general feature of ER+ breast cancer cell lines, we suppressed Amphiregulin expression in two additional lines, ZR751 and T47D (Fig 3D). In both cases, the vector control lines grew well in response to estrogen, while the shAREG-transduced pools responded weakly or not at all (Fig 3E,F).

Figure 3.

Figure 3

Open in a new tab

shRNA-mediated knockdown of Amphiregulin strongly attenuates ERα+ breast cancer cell line growth in vitro. A, qRTPCR analysis of AREG knockdown using two independent shRNA constructs. B, Decreased AREG soluble protein production in shRNA transductants, detected by ELISA. C, Quantification of colony cross-sectional area in 3D Matrigel cultures after 14 days showing that the proliferative response to estradiol observed in the control samples (left) is abrogated upon shRNA-mediated suppression of AREG expression (right). The graph represents quantification of three independent experiments, each normalized to the median colony size in the control cultures at the time of quantification. D, qRTPCR analysis of AREG mRNA levels in ZR751 and T47D cell lines transduced with shAREG constructs. E, Quantification of colony size (diameter) in 3D culture of ZR751 vector control and shAREG cell lines in the presence and absence of estrogen. F, Quantification of colony size (diameter) in 3D culture of T47D vector control and shAREG cell lines in the presence and absence of estrogen.

To ascertain the importance of estrogen-dependent induction of Amphiregulin in vivo, control and knockdown MCF7 cells were injected into mammary fat pads of athymic mice implanted with slow-release estrogen pellets. The two shRNA lines were evaluated on different dates and the contemporaneous vector control is shown in each case (Fig 4A). Tumors in which Amphiregulin was knocked down grew significantly more slowly than control tumors (P<0.05 at d17 and beyond, black curves, and d27 and beyond, grey curves). Sustained suppression of AREG expression was confirmed by ELISA analysis of tumor lysates at the endpoint of the experiment which included the shAREG#2 cell line (Fig 4B). These data indicate that, among ERα target genes, Amphiregulin expression is necessary for the robust growth of MCF7 tumors in vivo.

Figure 4.

Figure 4

Open in a new tab

shRNA-mediated suppression of AREG attenuates estrogen-responsive MCF7 xenograft growth in vivo. A, Comparison of the xenograft growth rates of MCF7-shAREG and vector control tumors (n = 14 tumors per group for black curves, 12 tumors per group for gray curves). B, ELISA analysis of human Amphiregulin from the xenografted tumors harvested 51 days post-injection from one series of in vivo experiments (black curves in 4A).

To determine the extent to which these in vitro and in vivo findings could be generalized to human breast cancer cases, we examined the change in expression of Amphiregulin mRNA following a two-week treatment with the aromatase inhibitor, letrozole, in 52 post-menopausal breast cancer cases previously described by Miller and colleagues (14, 15). Response to treatment was assessed as a reduction in tumor volume of greater than 50%, as measured by ultrasonography, after three months of neoadjuvant letrozole. Fig 5A shows the fold change in Amphiregulin from baseline following two weeks of letrozole treatment. The majority of cases (41/52) had a substantial reduction in Amphiregulin expression levels, a finding observed in both responders and non-responders. These data suggest that Amphiregulin expression is regulated by ERα activity in human breast tumors.

Figure 5.

Figure 5

Open in a new tab

Amphiregulin expression is strongly suppressed following neoadjuvant letrozole treatment of human breast cancer patients. A, Amphiregulin mRNA analysis by gene expression microarray showing suppression of AREG levels following two weeks of letrozole treatment. The data represent the fold-change in AREG mRNA between the pre-treatment and 14-day biopsy specimens. B, mRNA analysis of selected ERBB family receptors and ligands in 14-day biopsy specimens, stratified by ultrasonographically-evaluated response after 90 days of neoadjuvant letrozole treatment. The between-group fold-change in expression is indicated in each case, p ≤ 0.05, **p ≤ 0.01. The following genes were also assessed and were not significantly different between the groups: AREG, BTC, HBEGF, NRG3, NRG4, EGFR, ERBB3 and ERBB4. C, Heatmap of expression of relative expression of each of the genes in Fig 5B in each of the tumors. Levels of each gene was normalized to its average level across the population.

It was interesting to see that some of these tumors had a substantial reduction in Amphiregulin levels yet failed to achieve a 50% reduction in tumor volume. To determine whether the ERBB pathways might remain active in the non-responding tumors even when Amphiregulin mRNA was suppressed, we examined differences in expression levels of all ERBB family receptors and ligands between responders and non-responders in the post-letrozole treatment samples. Non-responding tumors had consistently and significantly higher expression levels of the genes encoding the ERBB2 receptor and the ligands TGFα, Epiregulin, Neuregulin 1 and Neuregulin 2 (Fig 5B). These data suggest that tumors in which the primary estrogen-responsive ERBB family ligand, Amphiregulin, is suppressed by endocrine therapy but which express alternate ligands and/or receptors which can activate these same signaling pathways may escape the growth suppressive effects of endocrine therapies. To determine whether some of these genes might be acting coordinately, we examined their expression in the individual tumors (Fig 5C). Although statistically significant (Fig 5B), the differences in Epiregulin and TGFα expression between responders and non-responders were not very striking. In contrast the non-responders were enriched for tumors with elevated levels of ERBB2, NRG1 and NRG2 suggesting that tumors in which elevated expressions of these ligands (whose receptors heterodimerize with ERBB2) may be less likely to respond to endocrine therapy.

Discussion

In this study, we found that Amphiregulin expression is frequently associated with estrogen receptor positivity in human breast tumors and cell lines, and that estrogen-dependent Amphiregulin expression is necessary for the growth of MCF7 xenografts in vivo, and for the estrogen-responsive growth of several ER+ breast cancer cell lines in 3D culture. These data indicate that the co-option of this stage-specific mammary developmental pathway may be a key feature of ERα+ human breast cancer. The clinical relevance of these experimental findings is supported by the strong suppression of Amphiregulin expression observed in a large cohort of breast cancer patients who received a neoadjuvant endocrine therapy, and by the demonstration that several tumors which did not respond to treatment had alternate, likely estrogen-independent, mechanisms of activating ERBB signaling pathways.

Several mechanisms have been proposed to explain the proliferative response to estrogen in ERα+ breast cancer cells, including the upregulation of c-Myc (17), Cyclin D1 (18), c-Myb (19), GREB1 (20), interaction with RSK (21) and activation of Cyclin E/cdk2 (22). Each of these potential mechanisms relies on cell-autonomous effects of the estrogen receptor, yet in the normal human breast, it is not the ERα+ cells, but the cells immediately adjacent to them which proliferate (4), suggesting that a paracrine effector is also involved. Similarly, in ERα+ breast tumors, significant proportions of the neoplastic cells can lack ERα expression, yet these tumors often respond well to endocrine therapy (23). Together, these findings indicate that estrogen has both cell-autonomous and non-cell autonomous effects during mammary gland development and in breast cancer, and that autocrine and paracrine mechanisms, which likely include Amphiregulin, may play an important role in both settings.

Autocrine Amphiregulin expression has been implicated in the growth of inflammatory and other ER-negative breast cancer cell lines in culture (24, 25) however, despite the reported importance of Amphiregulin as an estrogen effector during mouse mammary gland development (6), and evidence that Amphiregulin is also regulated by estrogen in human breast cancer cell lines (9), the actual contribution of Amphiregulin/EGFR to estrogen-dependent human breast cancer initiation and progression has not received widespread attention. This may reflect, in part, the disappointment that initial trials of EGFR inhibition in breast cancer were not very successful (summarized in 26), although the understanding of the biology of EGFR was less advanced at that time and there was often little attempt at rational patient selection in these studies. The previously conducted clinical trials have typically addressed the combination of an EGFR inhibitor with an endocrine agent, while our data argue that endocrine therapies may act by suppressing the expression of the EGFR ligand, Amphiregulin, and may thus function indirectly as EGFR pathway inhibitors. If these anti-EGFR and anti-estrogen therapies are indeed impinging on the same key pathway, overly simplistic conclusions from combination clinical trial data may merit closer examination.

For example, a phase II trial in the neoadjuvant setting of 206 women with ERα+ tumors, randomized to anastrazole alone or anastrazole plus gefitinib (i.e. aromatase inhibitor ± EGFR inhibitor) showed that gefitinib added no additional benefit to aromatase inhibition (27) which could suggest that either gefitinib has no activity in breast cancer or that it targets the same pathway as aromatase inhibitors. Studies with single agent gefitinib arms indicate that a substantial proportion of ERα+ tumors exhibit either a molecular or clinical response to EGFR inhibition, particularly among patients not heavily pretreated by other agents. For example, Guix and colleagues treated 41 women preoperatively with the EGFR inhibitor, erlotinib, and saw a significant downregulation of Ki67 levels in ERα+ but not HER2+ or Triple-Negative (ERα− PR− HER2−) breast cancer (28). Coombes randomized 54 women with ER+ breast tumors to gefitinib ± anastrazole and clearly showed that gefitinib alone significantly downregulated both tumor cell proliferation and tumor bulk when given for 4–6 weeks preoperatively (29). In ERα+ metastatic breast cancer, adding gefitinib to anastrazole significantly increased progression-free survival (PFS) compared to anastrazole alone (median PFS 22 v 14.7 months) with the benefit being particularly pronounced in women who had not previously received endocrine therapy (median PFS 20.2 v 8.4 months) (30). In patients with ERα+ tumors with acquired resistance to tamoxifen, gefitinib was associated with a 53.6% clinical benefit rate, significantly more than the 11.5% rate observed in ERα-negative tumors in the same trial (31), however a trial in which the ERα+ tumors had already acquired resistance to both tamoxifen and an aromatase inhibitor showed no benefit of gefitinib (32). Similarly, a study by Baselga in advanced breast cancer patients with 1–2 prior chemotherapy regimens did not show benefit for gefitinib (33), however it should be noted that this trial involved a smaller number of patients (n = 31), less than half of whom actually expressed EGFR in their tumor. Taken together, although EGFR inhibitors have not proven to be a panacea for breast cancer, several lines of evidence suggest that EGFR plays a role in ERα+ breast cancer, at least up to the stage of treatment resistance, and is likely functioning downstream of ERα. The ERα target gene and EGFR ligand, Amphiregulin, is an attractive candidate to link these pathways.

If Amphiregulin/EGFR signaling contributes to a significant proportion of ERα+ breast cancer cases, the lack of enduring responses to gefitinib and erlotinib requires some explanation. We speculate that achieving complete and sustained inhibition of wild-type EGFR using these single agents in vivo is difficult, thus many of these tumors may be both dependent on the EGFR pathway, yet insensitive to EGFR inhibitors. A key aspect of this pathway is the extent to which ligand binding by a minor fraction of receptors can yield a robust pathway activation due to the stoichiometry between receptors and the large number of downstream signaling intermediates, and the signaling amplification that takes place at each step of the pathway. Sorger and colleagues have reported an advanced mathematical model (34) describing the relationship between the various ERBB receptors and downstream intermediates and computed the rates of signal propagation via these intermediates at various levels of ERBB activation (using either EGF or Heregulin across a concentration range of several logs). Importantly, the model equations were validated against biological experiments providing a detailed quantitative analysis of all of the key parameters in several cancer cell lines. As one might expect, activation of the EGFR itself by EGF was substantially governed by the concentration of the ligand and by the enzymology of the receptor. However, examining the propagation of signal through the network reveals a substantial departure from linearity. In one example, a 50-fold reduction in the EGF stimulus (5nM to 0.1 nM) resulted in a ~95% reduction in pEGFR while only reducing pMAPK by half and leaving pAkt essentially unchanged. In a gefitinib or erlotinib-treated tumor under steady state conditions, the sub-ten minute half-life of the receptor-inhibitor complex (35), the high local concentrations of ERBB ligands (36, 37) and the capacity of the cellular signal transduction machinery to amplify small transient signals from occasionally uninhibited receptors at the cell surface, may mean that even 95% inhibition of the EGFR might not be sufficient to inhibit this pathway to an extent necessary to elicit a sustained tumor response in vivo. Experimental evidence indicates that the responsiveness of cancer cell lines to many inhibitors is highly regulated by the local concentration of receptor tyrosine kinase ligands (38). Thus, using higher affinity EGFR inhibitors (35) or approaches to reduce ERBB family ligand bioavailability, such as using endocrine therapy to block Amphiregulin induction or ADAM10/17 inhibitors to prevent ERBB ligand shedding (24), may have the potential to increase EGFR inhibitor effectiveness in this patient population.

In the clinic, almost half of patients with advanced ERα+ tumors fail to respond to tamoxifen in the first-line setting and, of the patients who respond initially, all will subsequently progress to endocrine resistance (39). Elevated ERBB signaling activity has been associated with endocrine resistance in the clinic. For example, ERα+ tumors that express high levels of the EGFR ligand, TGFα, tend to be tamoxifen non-responsive (40). Our observations on the downregulation of AREG expression following letrozole treatment (Fig 5A) and on the frequency of expression of ERBB signaling pathway activators in tumors not responding to letrozole (Fig 5B, C) are consistent with a role for ERBB signaling generally in the proliferation of ERα+ breast tumor cells and with our hypothesis that endocrine therapy-induced suppression of Amphiregulin substantially contributes to the efficacy of these drugs. Interestingly, an in vitro MCF7 model selected for spontaneous resistance to aromatase inhibitors was found to have upregulated Amphiregulin expression and to be Amphiregulin-dependent (41). Clearly, from our analysis of Amphiregulin mRNA (Fig 1A) and protein (Fig 1C) levels in ERα-negative tumors, the estrogen receptor is not the sole regulator of Amphiregulin expression. Identifying these alternate routes to Amphiregulin expression may provide insight into the mechanisms driving Amphiregulin expression in endocrine resistant breast tumors.

In conclusion, we have implicated Amphiregulin as a key effector of estrogen receptor activity during breast cancer growth in vivo. In light of our experimental data, we believe that the issue of EGFR signaling in ERα+ breast tumors merits renewed attention.

Supplementary Material

1

Acknowledgments

This study was supported by grants from Susan G. Komen for the Cure (KG100888) and the American Cancer Society (123001-RSG-12-267-01-TBE) to PK. EAP was supported by an NIH NIGMS IRACDA K12 (1K12GM102779-01). We acknowledge the services of the Animal Barrier and the Histopathology core facilities which are supported by the Albert Einstein Cancer Center (NIH 5P30CA013330).

Footnotes

Conflicts of Interest: The authors disclose no potential conflicts of interest.

References

  • 1.Korach KS, Couse JF, Curtis SW, Washburn TF, Lindzey J, Kimbro KS, et al. Estrogen receptor gene disruption: molecular characterization and experimental and clinical phenotypes. Recent Prog Horm Res. 1996;51:159–86. discussion 86–8. [PubMed] [Google Scholar]
  • 2.Carroll JS, Meyer CA, Song J, Li W, Geistlinger TR, Eeckhoute J, et al. Genome-wide analysis of estrogen receptor binding sites. Nat Genet. 2006;38:1289–97. doi: 10.1038/ng1901. [DOI] [PubMed] [Google Scholar]
  • 3.Welboren WJ, Sweep FC, Span PN, Stunnenberg HG. Genomic actions of estrogen receptor alpha: what are the targets and how are they regulated? Endocr Relat Cancer. 2009;16:1073–89. doi: 10.1677/ERC-09-0086. [DOI] [PubMed] [Google Scholar]
  • 4.Clarke RB, Howell A, Potten CS, Anderson E. Dissociation between steroid receptor expression and cell proliferation in the human breast. Cancer Res. 1997;57:4987–91. [PubMed] [Google Scholar]
  • 5.Mallepell S, Krust A, Chambon P, Brisken C. Paracrine signaling through the epithelial estrogen receptor alpha is required for proliferation and morphogenesis in the mammary gland. Proc Natl Acad Sci U S A. 2006;103:2196–201. doi: 10.1073/pnas.0510974103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ciarloni L, Mallepell S, Brisken C. Amphiregulin is an essential mediator of estrogen receptor alpha function in mammary gland development. Proc Natl Acad Sci U S A. 2007;104:5455–60. doi: 10.1073/pnas.0611647104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.McBryan J, Howlin J, Kenny PA, Shioda T, Martin F. ERalpha-CITED1 co-regulated genes expressed during pubertal mammary gland development: implications for breast cancer prognosis. Oncogene. 2007;26:6406–19. doi: 10.1038/sj.onc.1210468. [DOI] [PubMed] [Google Scholar]
  • 8.Luetteke NC, Qiu TH, Fenton SE, Troyer KL, Riedel RF, Chang A, et al. Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development. Development. 1999;126:2739–50. doi: 10.1242/dev.126.12.2739. [DOI] [PubMed] [Google Scholar]
  • 9.Martinez-Lacaci I, Saceda M, Plowman GD, Johnson GR, Normanno N, Salomon DS, et al. Estrogen and phorbol esters regulate amphiregulin expression by two separate mechanisms in human breast cancer cell lines. Endocrinology. 1995;136:3983–92. doi: 10.1210/endo.136.9.7649107. [DOI] [PubMed] [Google Scholar]
  • 10.Berquin IM, Dziubinski ML, Nolan GP, Ethier SP. A functional screen for genes inducing epidermal growth factor autonomy of human mammary epithelial cells confirms the role of amphiregulin. Oncogene. 2001;20:4019–28. doi: 10.1038/sj.onc.1204537. [DOI] [PubMed] [Google Scholar]
  • 11.Peterson EA, Shabbeer S, Kenny PA. Normal range of serum Amphiregulin in healthy adult human females. Clin Biochem. 2012;45:460–3. doi: 10.1016/j.clinbiochem.2011.12.029. [DOI] [PubMed] [Google Scholar]
  • 12.Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT, et al. The morphologies of breast cancer cell lines in three-dimensional assays correlate with their profiles of gene expression. Molecular Oncology. 2007;1:84–96. doi: 10.1016/j.molonc.2007.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lee GY, Kenny PA, Lee EH, Bissell MJ. Three-dimensional culture models of normal and malignant breast epithelial cells. Nat Methods. 2007;4:359–65. doi: 10.1038/nmeth1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Miller WR, Larionov A. Changes in expression of oestrogen regulated and proliferation genes with neoadjuvant treatment highlight heterogeneity of clinical resistance to the aromatase inhibitor, letrozole. Breast Cancer Res. 2010;12:R52. doi: 10.1186/bcr2611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Miller WR, Larionov AA, Renshaw L, Anderson TJ, White S, Murray J, et al. Changes in breast cancer transcriptional profiles after treatment with the aromatase inhibitor, letrozole. Pharmacogenet Genomics. 2007;17:813–26. doi: 10.1097/FPC.0b013e32820b853a. [DOI] [PubMed] [Google Scholar]
  • 16.van de Vijver MJ, He YD, van’t Veer LJ, Dai H, Hart AA, Voskuil DW, et al. A gene-expression signature as a predictor of survival in breast cancer. N Engl J Med. 2002;347:1999–2009. doi: 10.1056/NEJMoa021967. [DOI] [PubMed] [Google Scholar]
  • 17.Dubik D, Shiu RP. Mechanism of estrogen activation of c-myc oncogene expression. Oncogene. 1992;7:1587–94. [PubMed] [Google Scholar]
  • 18.Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, et al. 17beta-Estradiol induces cyclin D1 gene transcription, p36D1-p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene. 1996;12:2315–24. [PubMed] [Google Scholar]
  • 19.Drabsch Y, Hugo H, Zhang R, Dowhan DH, Miao YR, Gewirtz AM, et al. Mechanism of and requirement for estrogen-regulated MYB expression in estrogen-receptor-positive breast cancer cells. Proc Natl Acad Sci U S A. 2007;104:13762–7. doi: 10.1073/pnas.0700104104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rae JM, Johnson MD, Scheys JO, Cordero KE, Larios JM, Lippman ME. GREB 1 is a critical regulator of hormone dependent breast cancer growth. Breast Cancer Res Treat. 2005;92:141–9. doi: 10.1007/s10549-005-1483-4. [DOI] [PubMed] [Google Scholar]
  • 21.Eisinger-Mathason TS, Andrade J, Lannigan DA. RSK in tumorigenesis: connections to steroid signaling. Steroids. 2010;75:191–202. doi: 10.1016/j.steroids.2009.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Planas-Silva MD, Weinberg RA. Estrogen-dependent cyclin E-cdk2 activation through p21 redistribution. Mol Cell Biol. 1997;17:4059–69. doi: 10.1128/mcb.17.7.4059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ellis MJ, Coop A, Singh B, Mauriac L, Llombert-Cussac A, Janicke F, et al. Letrozole is more effective neoadjuvant endocrine therapy than tamoxifen for ErbB-1- and/or ErbB-2-positive, estrogen receptor-positive primary breast cancer: evidence from a phase III randomized trial. J Clin Oncol. 2001;19:3808–16. doi: 10.1200/JCO.2001.19.18.3808. [DOI] [PubMed] [Google Scholar]
  • 24.Kenny PA, Bissell MJ. Targeting TACE-dependent EGFR ligand shedding in breast cancer. J Clin Invest. 2007;117:337–45. doi: 10.1172/JCI29518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Willmarth NE, Ethier SP. Autocrine and juxtacrine effects of amphiregulin on the proliferative, invasive, and migratory properties of normal and neoplastic human mammary epithelial cells. J Biol Chem. 2006;281:37728–37. doi: 10.1074/jbc.M606532200. [DOI] [PubMed] [Google Scholar]
  • 26.Arteaga CL, Truica CI. Challenges in the development of anti-epidermal growth factor receptor therapies in breast cancer. Semin Oncol. 2004;31:3–8. doi: 10.1053/j.seminoncol.2004.01.006. [DOI] [PubMed] [Google Scholar]
  • 27.Smith IE, Walsh G, Skene A, Llombart A, Mayordomo JI, Detre S, et al. A phase II placebo-controlled trial of neoadjuvant anastrozole alone or with gefitinib in early breast cancer. J Clin Oncol. 2007;25:3816–22. doi: 10.1200/JCO.2006.09.6578. [DOI] [PubMed] [Google Scholar]
  • 28.Guix M, de Granja NM, Meszoely I, Adkins TB, Wieman BM, Frierson KE, et al. Short preoperative treatment with erlotinib inhibits tumor cell proliferation in hormone receptor-positive breast cancers. J Clin Oncol. 2008;26:897–906. doi: 10.1200/JCO.2007.13.5939. [DOI] [PubMed] [Google Scholar]
  • 29.Polychronis A, Sinnett HD, Hadjiminas D, Singhal H, Mansi JL, Shivapatham D, et al. Preoperative gefitinib versus gefitinib and anastrozole in postmenopausal patients with oestrogen-receptor positive and epidermal-growth-factor-receptor-positive primary breast cancer: a double-blind placebo-controlled phase II randomised trial. Lancet Oncol. 2005;6:383–91. doi: 10.1016/S1470-2045(05)70176-5. [DOI] [PubMed] [Google Scholar]
  • 30.Cristofanilli M, Valero V, Mangalik A, Royce M, Rabinowitz I, Arena FP, et al. Phase II, randomized trial to compare anastrozole combined with gefitinib or placebo in postmenopausal women with hormone receptor-positive metastatic breast cancer. Clin Cancer Res. 2010;16:1904–14. doi: 10.1158/1078-0432.CCR-09-2282. [DOI] [PubMed] [Google Scholar]
  • 31.Gutteridge E, Agrawal A, Nicholson R, Leung Cheung K, Robertson J, Gee J. The effects of gefitinib in tamoxifen-resistant and hormone-insensitive breast cancer: a phase II study. Int J Cancer. 2010;126:1806–16. doi: 10.1002/ijc.24884. [DOI] [PubMed] [Google Scholar]
  • 32.Green MD, Francis PA, Gebski V, Harvey V, Karapetis C, Chan A, et al. Gefitinib treatment in hormone-resistant and hormone receptor-negative advanced breast cancer. Ann Oncol. 2009;20:1813–7. doi: 10.1093/annonc/mdp202. [DOI] [PubMed] [Google Scholar]
  • 33.Baselga J, Albanell J, Ruiz A, Lluch A, Gascon P, Guillem V, et al. Phase II and tumor pharmacodynamic study of gefitinib in patients with advanced breast cancer. J Clin Oncol. 2005;23:5323–33. doi: 10.1200/JCO.2005.08.326. [DOI] [PubMed] [Google Scholar]
  • 34.Chen WW, Schoeberl B, Jasper PJ, Niepel M, Nielsen UB, Lauffenburger DA, et al. Input-output behavior of ErbB signaling pathways as revealed by a mass action model trained against dynamic data. Mol Syst Biol. 2009;5:239. doi: 10.1038/msb.2008.74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wood ER, Truesdale AT, McDonald OB, Yuan D, Hassell A, Dickerson SH, et al. A unique structure for epidermal growth factor receptor bound to GW572016 (Lapatinib): relationships among protein conformation, inhibitor off-rate, and receptor activity in tumor cells. Cancer Res. 2004;64:6652–9. doi: 10.1158/0008-5472.CAN-04-1168. [DOI] [PubMed] [Google Scholar]
  • 36.Reeka N, Berg FD, Brucker C. Presence of transforming growth factor alpha and epidermal growth factor in human ovarian tissue and follicular fluid. Hum Reprod. 1998;13:2199–205. doi: 10.1093/humrep/13.8.2199. [DOI] [PubMed] [Google Scholar]
  • 37.Sotnikova NY, Antsiferova YS, Shokhina MN. Local Epidermal Growth Factor Production in Women with Endometriosis. Russ J Immunol. 2001;6:55–60. [PubMed] [Google Scholar]
  • 38.Wilson TR, Fridlyand J, Yan Y, Penuel E, Burton L, Chan E, et al. Widespread potential for growth-factor-driven resistance to anticancer kinase inhibitors. Nature. 2012;487:505–9. doi: 10.1038/nature11249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bedard PL, Freedman OC, Howell A, Clemons M. Overcoming endocrine resistance in breast cancer: are signal transduction inhibitors the answer? Breast Cancer Res Treat. 2008;108:307–17. doi: 10.1007/s10549-007-9606-8. [DOI] [PubMed] [Google Scholar]
  • 40.Nicholson RI, McClelland RA, Gee JM, Manning DL, Cannon P, Robertson JF, et al. Transforming growth factor-alpha and endocrine sensitivity in breast cancer. Cancer Res. 1994;54:1684–9. [PubMed] [Google Scholar]
  • 41.Wang X, Masri S, Phung S, Chen S. The role of amphiregulin in exemestane-resistant breast cancer cells: evidence of an autocrine loop. Cancer Res. 2008;68:2259–65. doi: 10.1158/0008-5472.CAN-07-5544. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS728164-supplement-1.tif (7MB, tif)

RESOURCES