Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2015 Nov 18;53(12):3884–3887. doi: 10.1128/JCM.02165-15

Rapid Detection of Subtype H10N8 Influenza Virus by One-Step Reverse Transcription–Loop-Mediated Isothermal Amplification Methods

Hongmei Bao 1, Xiaoxiao Feng 1, Yong Ma 1, Jianzhong Shi 1, Yuhui Zhao 1, Linlin Gu 1, Xiurong Wang 1,✉, Hualan Chen 1,✉
Editor: A M Caliendo
PMCID: PMC4652103  PMID: 26378283

Abstract

We developed hemagglutinin- and neuraminidase-specific one-step reverse transcription–loop-mediated isothermal amplification assays for detecting the H10N8 virus. The detection limit of the assays was 10 copies of H10N8 virus, and the assays did not amplify nonspecific RNA. The assays can detect H10N8 virus from chicken samples with high sensitivity and specificity, and they can serve as an effective tool for detecting and monitoring H10N8 virus in live poultry markets.

TEXT

H10N8 influenza virus was initially isolated from quails in 1965 in Italy (1) and subsequently was found in Australia, Sweden, and North America (Canada and the United States). In China, H10N8 influenza virus was first detected in water samples collected from the Dongting Lake wetland in 2007 (2) and then in a duck at a live poultry market in Guangdong Province in 2012 (3). The first outbreak of human infection with the novel H10N8 influenza virus was confirmed in December 2013: a 73-year-old female with chronic diseases who had visited a local live poultry market succumbed to community-acquired pneumonia (4). Live poultry markets have been shown to be key locations where genome segment reassortment and interspecies transmission occur in avian influenza viruses (5–7). Human infections with influenza A H5N1, H7N9, and H10N8 viruses are all associated with exposure to live poultry markets (5, 8, 9). H10N8 viruses exhibit low pathogenicity in chickens, and the infected birds do not exhibit any symptoms (2). Therefore, a rapid and sensitive method for diagnosing H10N8 infection is urgently required for monitoring the prevalence of the virus and reducing human exposure to infected poultry (10–12). Molecular techniques, particularly loop-mediated isothermal amplification (LAMP), have exhibited high sensitivity and specificity for detecting influenza A viruses, such as H1N1, H5N1, and H7N9 (13–16). In this study, we developed and systematically evaluated a one-step reverse transcription–LAMP (RT-LAMP) assay specific for the hemagglutinin (HA) and neuraminidase (NA) genes of H10N8 influenza virus.

To design specific primers to amplify conserved regions of the HA and NA genes of H10N8 influenza virus, we compared and analyzed the HA and NA gene sequences of 104 strains of H10N8 influenza viruses available in GenBank and the Global Initiative on Sharing Avian Influenza Data (GISAID). Conserved regions exhibiting the highest levels of homology were chosen as the template (GenBank accession no. KP861987 and KP861989) for designing H10 and N8 LAMP primers by using the PrimerExplorer version 4 software (https://primerexplorer.jp). These primers included outer primers (H10-F3 and H10-B3), inner primers (H10-FIP and H10-BIP), and loop primers (H10-LF and H10-LB) (Table 1). The primers were synthesized by Life Technologies (Beijing, China).

TABLE 1.

RT-LAMP and RT-PCR primers designed for detecting HA and NA gene sequences of H10N8 influenza viruses

Primera Length (k-mer) Sequence (5′ to 3′)b
H10-F3 18 CTGGTATGGTTTCAGACA
H10-B3 21 GACGTTACCGATTTGGTGTTC
H10-FIP 42 GATCAATAGCTGCCTGAGTACTTCAAAATGCTCAGGGCACAG
H10-BIP 47 AATCACTGGGAAACTGAATAGACTGATCTCACTGAACTCAGATTCTA
H10-LB 22 AACCAATACTGAGTTCGAGTCA
H10-LF 18 TGTAATCAGCGGCCTGGC
N8-F3 18 GACAATTGGACCGGAACC
N8-B3 20 CTAATGGTCCTTCCCATCC
N8-FIP 45 CTCCTCTTGGGGTGTCACTGTGTTGGTGATTTCTCCAGAT
N8-BIP 40 GGATCATGCACTAGCCCAATGATACATCATTGCCCTGCC
N8-LF 24 GAGACCTGCACACAAATATCCGACT
N8-LB 21 GGGATACGGAGTTAAGGGATTTGG
H10-F 22 CTGCTGATTACAAGAGTACTCA
H10-R 21 CTCTGTATTGTGAATGGTCAT
N8-F 19 CTGCATGTCGTGAGCATCA
N8-R 19 ACCACGCCACAGCTTCAAA
a

The primers of H10-F3, H10-B3, H10-FIP, H10-BIP, H10-LB, and H10-LF were used in the H10-RT-LAMP assay. The primers of N8-F3, N8-B3, N8-FIP, N8-BIP, N8-LB, and N8-LF were used in the N8-RT-LAMP assay. The primers of H10-F and H10-R were used in H10-RT-PCR. The primers of N8-F and N8-R were used in N8-RT-PCR.

b

The underlined regions indicate the F1c region within the FIP primer. The italicized regions indicate the F2 region within the FIP primer. The bolded regions indicate B1c region within the BIP primer. The underlined and italicized regions indicate the B2 region within the BIP primer.

RNA was isolated from H10N8 influenza virus and other highly pathogenic avian influenza viruses in a biosafety level 3 laboratory at Harbin Veterinary Research Institute, Harbin, China. Viral RNA was extracted from 140 μl of virus supernatant or cloacal and tracheal swabs by using an RNeasy minikit (Qiagen, Valencia, CA, USA), according to the manufacturer's protocol. One-step RT-LAMP (H10-RT-LAMP and N8-RT-LAMP) assays were performed in 25-μl mixtures that contained 8 U of Bst DNA polymerase (New England BioLabs, Ipswich, MA, USA), 5 U of avian myeloblastosis virus (AMV) reverse transcriptase (Invitrogen, Carlsbad, CA, USA), 1.4 mM each deoxynucleoside triphosphate (dNTP), 0.8 M betaine, 8 mM MgSO4, 1 μl of fluorescent detection reagent (Eiken Chemical Co., Ltd., Tokyo, Japan), primers (1.6 μM inner primers [FIP and BIP], 0.2 μM outer primers [F3 and B3], 0.6 μM loop primers [LF and LB]) (Table 1), and 2 μl of extracted RNAs. One-step RT-LAMP reactions were performed at 62.5°C for 60 min in either a LA-320C Loopamp real-time turbidimeter (Teramecs, Tokyo, Japan) or a water bath and then terminated by incubation at 90°C for 1 min; reaction mixtures lacking templates were used as negative controls. Reaction turbidity was measured in real time, and the result was indicated by the graph in the monitor of the real-time turbidimeter, which verified initiation of the amplification. LAMP products were detected by visually inspecting the color.

To evaluate the sensitivities of the H10-RT-LAMP and N8-RT-LAMP assays, in vitro RNA transcripts of the HA and NA genes from the H10N8 virus were prepared with T7 Cap Scribe (Roche, Penzberg, Germany), according to the manufacturer's instructions, using H10N8 virus (A/chicken/JiangXi/S3581/13) RNA as a template. RNA was quantified and then 10-fold serially diluted from 1 × 106 copies/μl to 1 × 10−1 copies/μl and used as the template for the RT-LAMP and RT-PCR assays (see the supplemental material). All reactions were performed in triplicate. A kinetic analysis of turbidity revealed that the lower detection limit of the H10-RT-LAMP and N8-RT-LAMP assays was 1.0 × 101 copies per reaction mixture (Fig. 1A and D). Assay sensitivity was also confirmed through visual inspection (Fig. 1B and E); a clear green color was observed at concentrations ranging from 1.0 × 106 to 1.0 × 101 copies/μl. The sensitivity levels measured using real-time turbidity analysis and visual inspection did not differ markedly. When the same RNA template was used in one-step RT-PCR with H10- and N8-specific primers, the detection limit of the system was 1.0 × 102 copies (Fig. 1C and F). This confirmed that the RT-LAMP assay was approximately 10-fold more sensitive than RT-PCR.

FIG 1.

FIG 1

Relative sensitivities of RT-LAMP and RT-PCR methods. H10-RT-LAMP and N8-RT-LAMP assays and RT-PCR were performed using A/chicken/JiangXi/S3581/13 (H10N8) viral RNA at concentrations ranging from 1 × 106 copies/μl to 1 × 10−1 copies/μl. (A and B) Detection limit of H10-RT-LAMP assay. LAMP products were detected through a real-time turbidity measurement in an LA-320C turbidimeter (A) or using a fluorescence assay (B). (C) Detection limit of one-step RT-PCR measured using the same RNA extracts as those used for the H10-RT-LAMP assay. (D and E) Detection limit of N8-RT-LAMP assay. LAMP products were detected through a real-time turbidity measurement in an LA-320C turbidimeter (D) or using a fluorescence assay (E). (F) Detection limit of one-step RT-PCR measured using the same RNA extracts as those used for the N8-RT-LAMP assay. PCR products were visualized on a 1.5% agarose gel stained with ethidium bromide.

The specificities of the one-step RT-LAMP assays were evaluated by using influenza virus reference strains of the H1 to H15 and N1 to N9 subtypes and other avian respiratory pathogens: Newcastle disease virus, avian infectious bronchitis virus, and infectious laryngotracheitis virus (see Table S1 in the supplemental material). All tested samples were negative, except for the H10N8 virus (A/chicken/JiangXi/S3581/13). These results indicated that the one-step RT-LAMP method can be used to specifically amplify H10N8 influenza virus in the absence of cross-reactivity with either other avian influenza subtype viruses or other avian pathogenic viruses.

To examine clinical sensitivity and specificity, a total of 192 samples (44 samples from chickens, 82 samples from ducks, and 66 samples from the environment), including tracheal swabs and cloacal swabs that had been collected from live poultry markets in Jiangxi, Hunan, and Zhejiang Provinces, were tested using the RT-LAMP assays, RT-PCR, and viral isolation. From these 192 samples, 6 positives were obtained using the RT-LAMP assays and virus isolation, whereas 5 positives were obtained using RT-PCR. Thus, the positive rates of the RT-LAMP assays, viral isolation, and RT-PCRs were 3.1% (6/192), 3.1% (6/192), and 2.6% (5/192), respectively. The results of the RT-LAMP assays were consistent with those of the virus isolation. Although 60 min was used for the RT-LAMP assay reactions, most of the amplification reactions for clinical samples were finished within 24 min (data not shown). These results suggested that the RT-LAMP assays were more efficient, practical, and rapid diagnostic methods for the detection of the H10N8 virus from clinical samples.

To further evaluate the ability of the RT-LAMP assays to detect the H10N8 virus, 10 6-week-old specific-pathogen-free (SPF) White Leghorn chickens (group 1) were inoculated intranasally with 106.0 50% embryo infective dose (EID50) of H10N8 virus (A/chicken/JiangXi/S3581/13) in a volume of 0.1 ml. Control chickens (group 2, n = 10) were inoculated with 0.1 ml of sterile allantoic fluid collected from normal SPF embryonated chicken eggs. Tracheal and cloacal swabs collected on days 3, 5, 7, 9, 11, and 13 postinfection from all chickens were detected using the RT-LAMP assays, RT-PCR, and viral isolation. In group 1, 10 out of 60 tracheal samples and 39 out of 60 cloacal samples tested positive when viral isolation was used, 11 tracheal and 39 cloacal samples tested positive when RT-LAMP assays were used, and 9 tracheal and 37 cloacal samples tested positive when RT-PCR was used (Table 2). Thus, the positive rates of tracheal and cloacal samples in the infection group were 16.7% (10/60) and 65.0% (39/60) for viral isolation, 18.3% (11/60) and 65.0% (39/60) for the RT-LAMP assay, and 15.0% (9/60) and 61.7% (37/60) for the RT-PCR assay, respectively. All samples collected from group 2 chickens were negative using all three methods. Four positive samples among the experimentally infected samples that were detected using the RT-LAMP assays were missed when the one-step RT-PCR assays were used. These results further indicated that the H10N8 virus-specific RT-LAMP assay is more sensitive than the RT-PCR assay for detecting H10N8 virus in specimens whose viral titers are extremely low. This agrees with results obtained previously using RT-LAMP assays specific for the H5, H7, and H9 subtypes of influenza virus (14–17).

TABLE 2.

Virus isolation, RT-LAMP, and RT-PCR detection of viruses or viral RNA in tracheal and cloacal swabs collected from chickens that were experimentally infected with H10N8 virus (A/chicken/JiangXi/S3581/13) through inoculation of eggs

Days postinoculation by swab type No. detected/ total no. for:
Virus isolation RT-LAMP RT-PCR
Tracheal swabs
    3 4/10 4/10 4/10
    5 3/10 3/10 2/10
    7 2/10 3/10 2/10
    9 1/10 1/10 1/10
    11 0/10 0/10 0/10
    13 0/10 0/10 0/10
    Total 10/60 11/60 9/60
Cloacal swabs
    3 9/10 9/10 8/10
    5 9/10 9/10 9/10
    7 9/10 9/10 8/10
    9 7/10 7/10 7/10
    11 5/10 5/10 5/10
    13 0/10 0/10 0/10
    Total 39/60 39/60 37/60

In summary, HA- and NA-specific RT-LAMP assays were developed and systematically evaluated for use in the detection of H10N8 influenza virus in experimentally infected and clinical specimens. The one-step RT-LAMP assays were more sensitive than routine RT-PCRs and more rapid than virus isolation for the detection of H10N8 viruses. More importantly, the assays can be used to detect, with high sensitivity and specificity, H10N8 virus from chicken samples; thus, the assays can serve as an extremely effective tool for detecting and monitoring H10N8 virus in live poultry markets or poultry farms and for contributing to the control of H10N8 virus infection.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This study was supported by the 12th 5-Year Plan of National Science and Technology of Rural Areas (grant 2012AA101303), the National Natural Science Foundation of China (grant 31470127), and the International S&T Cooperation Program of China (grant 2014DFR31260).

We declare no conflicts of interest.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.02165-15.

REFERENCES

  • 1.De Marco MA, Campitelli L, Foni E, Raffini E, Barigazzi G, Delogu M, Guberti V, Di Trani L, Tollis M, Donatelli I. 2004. Influenza surveillance in birds in Italian wetlands (1992–1998): is there a host restricted circulation of influenza viruses in sympatric ducks and coots? Vet Microbiol 98:197–208. doi: 10.1016/j.vetmic.2003.10.018. [DOI] [PubMed] [Google Scholar]
  • 2.Zhang H, Xu B, Chen Q, Chen J, Chen Z. 2011. Characterization of an H10N8 influenza virus isolated from Dongting Lake wetland. Virol J 8:42. doi: 10.1186/1743-422X-8-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Su S, Qi W, Zhou P, Xiao C, Yan Z, Cui J, Jia K, Zhang G, Gray GC, Liao M, Li S. 2014. First evidence of H10N8 avian influenza virus infections among feral dogs in live poultry markets in Guangdong Province, China. Clin Infect Dis 59:748–750. doi: 10.1093/cid/ciu345. [DOI] [PubMed] [Google Scholar]
  • 4.Chen H, Yuan H, Gao R, Zhang J, Wang D, Xiong Y, Fan G, Yang F, Li X, Zhou J, Zou S, Yang L, Chen T, Dong L, Bo H, Zhao X, Zhang Y, Lan Y, Bai T, Dong J, Li Q, Wang S, Zhang Y, Li H, Gong T, Shi Y, Ni X, Li J, Zhou J, Fan J, Wu J, Zhou X, Hu M, Wan J, Yang W, Li D, Wu G, Feng Z, Gao GF, Wang Y, Jin Q, Liu M, Shu Y. 2014. Clinical and epidemiological characteristics of a fatal case of avian influenza A H10N8 virus infection: a descriptive study. Lancet 383:714–721. doi: 10.1016/S0140-6736(14)60111-2. [DOI] [PubMed] [Google Scholar]
  • 5.Shi J, Deng G, Liu P, Zhou J, Guan L, Li W, Li X, Guo J, Wang G, Fan J, Wang J, Li Y, Jiang Y, Liu L, Tian G, Li C, Chen H. 2013. Isolation and characterization of H7N9 viruses from live poultry markets—implication of the source of current H7N9 infection in humans. Chin Sci Bull 58:1857–1863. doi: 10.1007/s11434-013-5873-4. [DOI] [Google Scholar]
  • 6.Chen Y, Liang W, Yang S, Wu N, Gao H, Sheng J, Yao H, Wo J, Fang Q, Cui D, Li Y, Yao X, Zhang Y, Wu H, Zheng H, Diao S, Xia S, Zhang Y, Chan KH, Tsoi HW, Teng JL, Song W, Wang P, Lau SY, Zheng M, Chan JF, To KK, Chen H, Li L, Yuen KY. 2013. Human infections with the emerging avian influenza A H7N9 virus from wet market poultry: clinical analysis and characterisation of viral genome. Lancet 381:1916–1925. doi: 10.1016/S0140-6736(13)60903-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yu H, Wu JT, Cowling BJ, Liao Q, Fang VJ, Zhou S, Wu P, Zhou H, Lau EH, Guo D, Ni MY, Peng Z, Feng L, Jiang H, Luo H, Li Q, Feng Z, Wang Y, Yang W, Leung GM. 2014. Effect of closure of live poultry markets on poultry-to-person transmission of avian influenza A H7N9 virus: an ecological study. Lancet 383:541–548. doi: 10.1016/S0140-6736(13)61904-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Deng G, Shi J, Wang J, Kong H, Cui P, Zhang F, Tan D, Suzuki Y, Liu L, Jiang Y, Guan Y, Chen H. 2015. Genetics, receptor binding, and virulence in mice of H10N8 influenza viruses isolated from ducks and chickens in live poultry markets in China. J Virol 89:6506–6510. doi: 10.1128/JVI.00017-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wan XF, Dong L, Lan Y, Long LP, Xu C, Zou S, Li Z, Wen L, Cai Z, Wang W, Li X, Yuan F, Sui H, Zhang Y, Dong J, Sun S, Gao Y, Wang M, Bai T, Yang L, Li D, Yang W, Yu H, Wang S, Feng Z, Wang Y, Guo Y, Webby RJ, Shu Y. 2011. Indications that live poultry markets are a major source of human H5N1 influenza virus infection in China. J Virol 85:13432–13438. doi: 10.1128/JVI.05266-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu M, Li X, Yuan H, Zhou J, Wu J, Bo H, Xia W, Xiong Y, Yang L, Gao R, Guo J, Huang W, Zhang Y, Zhao X, Zou X, Chen T, Wang D, Li Q, Wang S, Chen S, Hu M, Ni X, Gong T, Shi Y, Li J, Zhou J, Cai J, Xiao Z, Zhang W, Sun J, Li D, Wu G, Feng Z, Wang Y, Chen H, Shu Y. 2015. Genetic diversity of avian influenza A (H10N8) virus in live poultry markets and its association with human infections in China. Sci Rep 5:7632. doi: 10.1038/srep07632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang T, Bi Y, Tian H, Li X, Liu D, Wu Y, Jin T, Wang Y, Chen Q, Chen Z, Chang J, Gao GF, Xu B. 2014. Human infection with influenza virus A (H10N8) from live poultry markets, China, 2014. Emerg Infect Dis 20:2076–2079. doi: 10.3201/eid2012.140911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ni X, He F, Hu M, Zhou X, Wang B, Feng C, Wu Y, Li Y, Tu J, Li H, Liu M, Chen H, Chen S. 2015. Investigation of avian influenza virus in poultry and wild birds due to novel avian-origin influenza A (H10N8) in Nanchang City, China. Microbes Infect 17:48–53. doi: 10.1016/j.micinf.2014.09.007. [DOI] [PubMed] [Google Scholar]
  • 13.Kubo T, Agoh M, Mai le Q, Fukushima K, Nishimura H, Yamaguchi A, Hirano M, Yoshikawa A, Hasebe F, Kohno S, Morita K. 2010. Development of a reverse transcription–loop-mediated isothermal amplification assay for detection of pandemic (H1N1) 2009 virus as a novel molecular method for diagnosis of pandemic influenza in resource-limited settings. J Clin Microbiol 48:728–735. doi: 10.1128/JCM.01481-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bao H, Zhao Y, Wang Y, Xu X, Shi J, Zeng X, Wang X, Chen H. 2014. Development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of subtype H7N9 avian influenza virus. Biomed Res Int 2014:525064. doi: 10.1155/2014/525064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhang J, Feng Y, Hu D, Lv H, Zhu J, Cao M, Zheng F, Zhu J, Gong X, Hao L, Srinivas S, Ren H, Qi Z, Li B, Wang C. 2013. Rapid and sensitive detection of H7N9 avian influenza virus by use of reverse transcription–loop-mediated isothermal amplification. J Clin Microbiol 51:3760–3764. doi: 10.1128/JCM.01907-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Imai M, Ninomiya A, Minekawa H, Notomi T, Ishizaki T, Van Tu P, Tien NT, Tashiro M, Odagiri T. 2007. Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop-mediated isothermal amplification method. J Virol Methods 141:173–180. doi: 10.1016/j.jviromet.2006.12.004. [DOI] [PubMed] [Google Scholar]
  • 17.Chen HT, Zhang J, Sun DH, Ma LN, Liu XT, Cai XP, Liu YS. 2008. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of H9 avian influenza virus. J Virol Methods 151:200–203. doi: 10.1016/j.jviromet.2008.05.009. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES