Skip to main content
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2014 Dec 29;12(3):366–372. doi: 10.1038/cmi.2014.122

IL-17 induces radiation resistance of B lymphoma cells by suppressing p53 expression and thereby inhibiting irradiation-triggered apoptosis

Qingshan Li 1,2, Xin Xu 3, Weijie Zhong 3, Qinghua Du 1, Bizhen Yu 1, Huabao Xiong 2
PMCID: PMC4654313  PMID: 25544504

Abstract

p53 is a well-known tumor suppressor. However, the regulatory mechanism(s) for p53 expression in B lymphoma cells, and the possible role of p53 in the development of the radioresistance in tumor cells are largely unknown. A human B lymphoma cell line, Karpas1106 (k1106), was used as a model of radioresistance. Apoptosis of k1106 cells was determined using flow cytometry. Expression of p53 was assessed using real time RT-PCR and western blotting. The results showed that irradiation at 8 Gy induced apoptosis in up to 40% of k1106 cells. At the same time, the irradiation markedly increased IL-6 production of the k1106 cells. When k1106 cells were cocultured with regulatory T cells (Tregs) and irradiated, the rate of apoptotic k1106 cells was significantly reduced, indicating an acquired resistance to irradiation. IL-6 derived from the irradiation-treated k1106 cells induced IL-17 expression in Tregs. The IL-17+Foxp3+ T cells suppressed p53 expression in k1106 cells. Collectively, irradiated k1106 cells induce the expression of IL-17 in Tregs, which interferes with the expression of p53 protein in k1106 cells and thereby represses irradiation-triggered apoptosis in k1106 cells.

Keywords: interleukin-17, irradiation, lymphoma, p53 protein, regulatory T cells

Introduction

Lymphoma is a blood cancer consisting of T cells or B cells. Both T cells and B cells are important immune cells in the body. They function to fight against invading microbes or to prevent autoimmune diseases. For unknown reasons, some lymphocytes outlive their lifespan, resulting in lymphoma. Lymphoma may localize to the lymph nodes, blood, spleen, bone marrow or other lymphoid tissues. To date, the pathogenesis of lymphoma is unclear.1

In lymphoma, the malignant cells usually originate in enlarged lymph nodes. The therapeutic remedies for lymphoma include chemotherapy, radiotherapy and bone marrow transplantation.2,3 If the lymphoma mainly localizes in lymph nodes, radiotherapy may be employed.4 Although resistance to radiotherapy is a well-recognized phenomenon,5 the underlying mechanism is not fully understood.

Radioresistance allows organisms to live in an environment with high levels of ionizing radiation. Radioresistance may be induced by repeated exposures to small doses of ionizing radiation;6 the latter is a common procedure in cancer treatment with ionizing radiation.7 Thus, radioresistance is also a common phenomenon in cancer patients receiving ionizing radiation.8 The mechanism of radioresistance will be further investigated.

Under healthy conditions, the body has a regulatory system to eliminate sporadic cancer cells. One of the mechanisms is the expression of the p53 protein in the cells. The p53 protein is known as a tumor suppressor that operates by inducing tumor cell apoptosis and death. A number of reports have revealed p53 mutation or suppression in tumor cells,9,10 which underscores the importance of the proper function of p53 in immune surveillance in the body. The factors that cause p53 abnormalities are unclear.

Interleukin (IL)-17 is a cytokine secreted by T helper (Th)17 cells. Regulatory T cells (Tregs) may produce IL-17 in a given microenvironment.11 Published data indicate that IL-17 is associated with the pathogenesis of cancer11,12 by playing a role either in tumorigenesis or in the elimination phase of cancer immunoediting13 and by interacting with p53 in tumor cells.14 Based on the above information, we hypothesize that IL-17 inhibits p53 expression in lymphoma cells, which prevents lymphoma cell apoptosis. In this study, we observed that irradiation induced IL-6 expression in B lymphoma cells; the IL-6 induced Treg expression of IL-17, which in turn suppressed p53 expression and prevented apoptosis in lymphoma cells.

Materials and methods

Reagents

The antibodies against IL-6 and p53 were obtained from Santa Cruz Biotech (Santa Cruz, CA, USA). The IL-17 protein, neutralizing antibodies to IL-6 and IL-17, and ELISA kits for IL-6 and IL-17 was obtained from R&D Systems (Minneapolis, MN, USA). The fluorochrome-labeled antibodies of Foxp3 and IL-17 were purchased from BD Bioscience (San Jose, CA, USA). The real time RT-PCR reagents were obtained from Invitrogen (Carlsbad, CA, USA).

Cell culture

The k1106 cell line and the BC-3 cell line were purchased from ATCC (Beijing, China) and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 0.1 mg/ml streptomycin and 100 U/ml penicillin. The medium was changed in every 1–2 days.

Cell viability assay

Cell viability was assessed using the Trypan blue exclusion assay. The cell viability was greater than 98% before use for experiments.

Irradiation

k1106 cells were cultured as described above and treated with irradiation using an 8-MV X-ray linear accelerator (Elekta Synergy Platform; ELEKTA Ltd, Stockholm, Sweden) at a dose rate of 255 cGy/min; the total dosage was 0–8 Gy. The control k1106 cells were cultured with medium alone. Six hours after the irradiation, the cells were used for further experiments.

Quantitative real-time RT-PCR (qRT-PCR)

The k1106 cells were washed with phosphate-buffered saline three times. Using Trizol reagents, the total RNA was extracted from the cells. The cDNA was synthesized with a reverse transcription kit following the manufacturer's instructions. The qRT-PCR was performed with a MiniOpticon Real-Time PCR System (Bio-Rad, Shanghai, China). The primers were: IL-6 (NCBI: AF039224), forward, acttcgtgcatgacttcagc; reverse, tctttgttggagggtgaggg. P53 (NCBI: AB082923), forward, tggccatctacaagcagtca; reverse, ggtacagtcagagccaacct. The results of the gene expression assay were calculated with the 2−ΔΔCt method and presented as the percentage of the internal loading control β-actin.

Western blotting

Total protein was extracted from the cells and quantified with the Bio-Rad protein assay kit. Equal volumes of protein were added to each well and fractioned using SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis). The blots were transferred to a nitrocellulose membrane. After blocking with 5% skim milk for 1 h, the membrane was incubated with the primary antibodies (0.2–0.5 µg/ml) for 1 h at room temperature and then incubated with the secondary antibodies (conjugated with horseradish peroxidase) for 1 h. Washes in Tris-buffered saline-Tween 20 were performed after each incubation. The immune complex was developed with enhanced chemiluminescence. The results were recorded with x ray films. The density of the immune blots was assessed with ImageJ software.

Enzyme-linked immunosorbent assay (ELISA)

The levels of IL-6 and IL-17 in the culture supernatant were determined via ELISA using commercial reagent kits (R&D Systems) following the manufacturer's instructions.

Separation of k1106 cells and CD4+ T cells

The mixture of k1106 cells and CD4+ T cells (Tregs) were separated with a CD4+ T cell isolation reagent kit (Miltenyi Biotech; San Diego, CA, USA) following the manufacturer's instructions. According to flow cytometry, the purity of the isolated cells was 99%.

Generation of Tregs

CD4+CD25− T cells were isolated from peripheral blood mononuclear cells (isolated from healthy subjects; the procedures were approved by the Human Research Ethics Committee at Guangzhou Medical University) with a reagent kit. Cells were stimulated with immobilized anti-CD3 and anti-CD28 (5 µg/ml each) and cultured with 8 ng/ml TGF-β and 100 U/ml IL-2. Three days later, the generated iTregs were isolated with a reagent kit via magnetic cell sorting. The purity of isolated Foxp3+ Tregs was more than 95% according to flow cytometry.

Flow cytometry

The frequency of IL-17+Foxp3+ T cells was determined using flow cytometry. The cells were fixed with 2% paraformaldehyde for 30 min and then incubated with 0.1% saponin for 30 min. After washing, the cells were blocked with 1% bovine serum albumin for 30 min, and then the cells were stained with fluorescence labeled anti-IL-17 and anti-Foxp3 antibodies (1 µg/ml) for 1 h at room temperature. The cells were analyzed with a flow cytometer (FACSCanto II; BD Bioscience). The data were analyzed with FlowJo software.

Assessment of apoptosis

k1106 cells were stained with propidium iodide (PI) and Annexin V reagent (Sigma-Aldrich) following the manufacturer's instructions. The cells were then analyzed using flow cytometry. A gate was set to exclude the dead cells (PI+ cells). The frequency of Annexin V+ cells in the remaining cells was then determined.

Statistical analysis

The data are presented as the means±s.d. The difference between two groups was determined using Student's t-test, and an ANOVA was used for more than two groups. P<0.05 was the level of significance.

Results

Coculture with Tregs confers resistance to irradiation in k1106 cells

The major therapeutic mechanism of irradiation is to induce target cell apoptosis.15 We therefore assessed the frequency of apoptotic k1106 cells after irradiation. The results showed that irradiation induced apoptosis in k1106 cells in an irradiation dose-dependent manner (Figure 1A and B). To test the role of p53 in the radiation-induced k1106 cell apoptosis, an anti-p53 antibody was added to the culture; the apoptotic k1106 cells were 7.17% (irradiation (8 Gy)+anti-p53 antibody) in contrast to those treated with irradiation (8 Gy) alone (Figure 1Af). The results suggest that p53 is involved in the irradiation-induced k1106 cell apoptosis.

Figure 1.

Figure 1

Tregs interfere with irradiation-induced k1106 cell apoptosis. (a) k1106 cells were irradiated at different doses as denoted in each subpanel. The bars in b indicate the frequency of apoptotic k1106 cells in a. (c) k1106 cells (106/ml) were cocultured with Tregs (the number of Tregs is denoted in each subpanel: Treg number/106 k1106 cells; Tregs were not irradiated). The CD4+ Tregs were gated out; the remaining k1106 cells were analyzed for apoptosis. The bars of d indicate the frequency of apoptotic k1106 cells in c. Anti-p53: Anti-p53 antibodies were added to the culture at 500 ng/ml. The data are presented as the means±s.d. from three separate experiments. *P<0.01, compared with group A (b) or BA (d). #CD4+CD25− T cells used as a control. k1106, Karpas1106; Treg, regulatory T cell.

Tregs play a role in facilitating cancer growth.16 To determine whether Tregs interfere with the irradiation-induced cancer cell apoptosis, we cocultured Tregs with k1106 cells; the cells then were irradiated. As expected, the coculture with Tregs markedly reduced the frequency of the apoptotic k1106 cells in a Treg-dependent manner (Figure 1C and D). As a control in a separate experiment, the Tregs were replaced by CD4+CD25− T cells. The results showed that the CD4+CD25− T cells did not suppress the apoptosis of k1106 cells (Figure 1Cf and D). Collectively, the results indicate that irradiation can induce k1106 cell apoptosis, which can be blocked by coculture with Tregs.

Irradiation induces IL-6 expression in lymphoma cells

Published data indicate that IL-6 is involved in the pathogenesis of lymphoma and is associated with radiation resistance.17 The mechanism is unknown. To this end, we treated k1106 cells (a human lymphoma cell line) with irradiation at 0–8 Gy. The cells were collected at the end of culture and processed to determine IL-6 production. The results showed that low levels of IL-6 (5.5% of β-actin mRNA) were detected in k1106 cells treated with medium alone. Irradiation markedly increased the production of IL-6 by k1106 cells in an irradiation dose-dependent manner (from 5.5% (0 Gy) to 33.8% (8 Gy) of β-actin mRNA). We also measured the levels of IL-6 in the culture supernatants using ELISA. The results showed that IL-6 was increased in culture supernatants, also in an irradiation dose-dependent manner, from 7.9 pg/ml (0 Gy) to 87.9 pg/ml (8 Gy). To strengthen the data, the experiments were repeated with another lymphoma cell line, BC-3 cells. Irradiation increased the production of IL-6 by BC-3 cells in an irradiation dose-dependent manner (Figure 2). The results indicate that lymphoma cells, k1106 cells and BC-3 cells, express IL-6 that can be upregulated by irradiation. Additionally, this IL-6 can be released into the extracellular environment.

Figure 2.

Figure 2

Irradiation induces IL-6 expression in k1106 cells. k1106 cells were irradiated in the culture as described in the text; the dosage of irradiation is denoted on the x axis. The cellular extracts and supernatant were analyzed using qRT-PCR, ELISA and western blotting. (a, b) The immune blots indicate the IL-6 protein content of k1106 cells (a) and BC-3 cells (b); the bars indicate the integrated density of the immune blots. (c) The bars indicate the IL-6 mRNA levels. (b) Bars indicate the levels of IL-6 in the supernatant. *P<0.01, compared with dose 0. The data are a representative of three independent experiments. ELISA, enzyme-linked immunosorbent assay; k1106, Karpas1106; qRT-PCR, quantitative real-time RT-PCR.

Coculture of irradiated k1106 cells and Tregs generates IL-17+Foxp3+ T cells

In collaboration with TGF-β, IL-6 has an important role in the generation of Th17 cells.18 Because k1106 cells produce IL-6 after irradiation, we postulated that the irradiated k1106 cells would induce IL-17 in Foxp3+ Tregs. To test this hypothesis, we cocultured irradiated k1106 cells with Tregs in the presence of IL-2 for 3 days. The cells were collected and analyzed using flow cytometry. The results showed that the Tregs did not produce IL-17 in naive states (Figure 3Aa and B); culturing with k1106 cells (Figure 3Ab and B) and treating with irradiation (Figure 3Ac and B) resulted in marked expression of IL-17 in Foxp3+ T cells, which was further increased in a combination of culturing with k1106 cells and irradiation (Figure 3Ad and B). The production of IL-17 was abolished in the presence of anti-IL-6 antibodies (Figure 3Ae, Af and B). The levels of IL-17 and Foxp3 were below detectable limits in k1106 cells cultured with medium alone or in k1106 cells treated by irradiation (Figure 3Ag, Ah and B). IL-17 was also detected in the culture supernatant; the levels of IL-17 were proportionate to the frequency of IL-17+Foxp3+ T cells (Figure 3C). The results indicate that the irradiated k1106 cells induce the expression of IL-17 in Tregs.

Figure 3.

Figure 3

k1106 cells induce IL-17 expression in Tregs. k1106 cells (106 cells/ml) were cultured with Tregs (2×105 cells/ml) under the conditions denoted above each dot plot panel. (a) The dot plots indicate the frequency of IL-17+Foxp3+ T cells. (b) The bars indicate the summarized data (mean±s.d.) of a. (c) The bars indicate the levels of IL-17 in the culture supernatants. aIL-6: neutralizing anti-IL-6 antibody was added to the culture at a dose of 1 µg/ml. The data represent three separate experiments. k1106, Karpas1106; Treg, regulatory T cell.

IL-17+Foxp3+ T cells modulate p53 expression in k1106 cells

IL-17+Foxp3+ T cells are related to cancer growth,11 but the mechanism is not completely understood. Because p53 is a critical protein for inhibiting cancer cell growth,19 we inferred that the irradiated k1106 cell-generated IL-17+Foxp3+ T cells interfere with the expression of p53 in k1106 cells. To this end, we first assessed the expression of p53 in k1106 cells with or without irradiation. The results showed that p53 expression was not changed in the k1106 cells. We then treated the coculture of k1106 cells and IL-17+Foxp3+ T cells with irradiation; the expression of p53 was suppressed in k1106 cells. To understand whether IL-17 is required in the irradiation-induced p53 suppression in k1106 cells, a neutralizing anti-IL-17 antibody was added to the culture, which abolished the irradiation-induced p53 suppression in k1106 cells. In separate experiments, we treated the k1106 cells with IL-17 in culture, which also suppressed the expression of p53 (Figure 4).

Figure 4.

Figure 4

T cell-derived IL-17 suppresses p53 expression in k1106 cells. k1106 cells were cultured with Tregs at a ratio of 106:2×105 cells/ml and treated in the culture as denoted on the x axis. The k1106 cells were negatively selected and analyzed by qRT-PCR and western blotting. (a) The bars indicate the mRNA levels of p53. (b) The immune blots indicate the protein content of p53. (c) The bars indicate the integrated density of the immune blots of b. The doses of IL-17, anti-IL-17 antibody (aIL-17) were 1 µg/ml. cAb: control antibody (an isotype IgG). The data of bars are presented as the mean±s.d. *P<0.05, compared with the medium alone group. The data represent three separate experiments. k1106, Karpas1106; qRT-PCR, quantitative real-time RT-PCR; Treg, regulatory T cell.

IL-17 prevents irradiation-induced k1106 cell apoptosis

The data from Figure 4 imply that IL-17 may induce radioresistance. To test this hypothesis, IL-17 receptor-null and wild-type k1106 cells were treated with irradiation. As analyzed by Annexin V/flow cytometry, the presence of IL-17 markedly suppressed the frequency of apoptotic k1106 cells in an IL-17 dose-dependent manner (Figure 5a–d and f). A high frequency of the apoptotic cells, including PI+/Annexin V+ and PI−/Annexin V+ cells, was observed in the IL-17 receptor-null k1106 cells (Fig. 5G) after irradiation (Figure 5e and f).

Figure 5.

Figure 5

IL-17 prevents irradiation-induced k1106 cell apoptosis. IL-17 receptor-null and wild-type k1106 cells were exposed to radiation at 8 Gy in the presence of recombinant IL-17 at gradient concentrations as denoted above each histogram. (a–e) The flow cytometry dot plots indicate the frequency of Annexin V+ and Annexin V+/PI− k1106 cells. (f) The bars indicate the summarized data of a–e (mean±s.d.; *P<0.01, compared with group A). (g) The immune blots show the gene knockdown results of IL-17 receptor. The data are a representative of three independent experiments. k1106, Karpas1106; PI, propidium iodide.

Discussion

Radiotherapy is commonly used as an efficient treatment for early stage nodular lymphocyte-predominant lymphoma,20 in which the development of radioresistance is a major drawback.21 The present study has revealed that, after irradiation, k1106 lymphoma cells express IL-6; the latter induces IL-17 expression in Tregs. IL-17 suppressed the expression of p53 in k1106 cells which compromised apoptosis, thus attenuating the effect of irradiation on inducing apoptosis in k1106 cells.

IL-6 is produced by a number of cell types including monocytes, fibroblasts, endothelial cells and epithelial cells, such as hematological tumor cell lines.22 Our data are in line with previous data showing that naive k1106 cells produce detectable IL-6, which can be upregulated after irradiation. Other investigators also indicate that a similar phenomenon occurs in the radiotherapy of patients with cancer.23 By contrast, increases in the production of IL-6 correlate with radioresistance in cancer cell line studies and in clinical observations of cancer patients treated with irradiation. Alberti et al.24 indicate that exposure to IL-6 promotes tumor cell survival of radiotherapy. Thus, anti-IL-6 therapy is proposed to treat cancer.25 However, the radioresistance of cancer cells cannot be eliminated by an anti-IL-6 antibody.26 The present data provide an explanation for this dilemma. The k1106 cells do produce IL-6 after irradiation; it eventually compromises the expression of p53 and affects the apoptosis mechanism in cancer cells.

Published data indicate that Tregs play an important role in the pathogenesis of cancer. Wang et al.27 indicate that Tregs suppress tumor-specific CD8+ T cells, thus weakening the anti-cancer mechanism in the body. Our data reveal another aspect of Tregs involving a phenomenon by which cancer cells may escape from immune surveillance. The data show that after contacting irradiated k1106 cells, Tregs express IL-17, which eventually inhibits apoptosis in the cancer cells. Similar data are also reported by others, namely, that an enhanced Th17 response accompanies tumor induction and progression. However, contradictory findings report that tumor growth is negatively correlated with an increased infiltration of Th17 cells into tumor tissue.28 It is also reported that whole body ionizing irradiation induces more Treg survival in mice.29 Our data indicate that there may be another source of IL-17 in the tumor environment, the Tregs, which are involved in tumor survival and growth.30 TGF-β is a critical immune regulatory molecule of CD4+Foxp3+ Tregs. The k1106 cell-derived IL-6 may collaborate with TGF-β to promote the expression of IL-17 in Tregs.

The p53 protein is an important molecule in suppressing tumor growth. An abnormality in p53 expression is involved in the pathogenesis of cancer.9,10 Our data show that radiotherapy can upregulate the expression of p53 in k1106 cells, which is correlated with k1106 cell apoptosis after irradiation. Previous studies indicate that high levels of IL-17 are associated with the low levels of p53 in colorectal cancer.14 Our study provides further evidence that IL-17 can downregulate the expression of p53 in k1106 cells and further compromise the apoptosis mechanism in these cells.

In summary, the data indicate that irradiation induces IL-6 expression in k1106 cells; the IL-6 induces Tregs to produce IL-17 in collaboration with TGF-β in Tregs. The IL-17 suppresses p53 in k1106 cells to compromise apoptosis, thus promoting k1106 cell survival. The data imply that IL-6 and IL-17 are potential targets in the treatment of lymphoma.

References

  1. 1Puvvada S, Kendrick S, Rimsza L. Molecular classification, pathway addiction, and therapeutic targeting in diffuse large B cell lymphoma. Cancer Genet 2013; 206: 257–265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. 2Rivera-Rodriguez N, Cabanillas F. Recent advances in the management of mantle cell lymphoma. Curr Opin Oncol 2013; 25: 716–721. [DOI] [PubMed] [Google Scholar]
  3. 3Domm JA, Thompson M, Kuttesch JF, Acra S, Frangoul H. Allogeneic bone marrow transplantation for chemotherapy-refractory hepatosplenic gamma delta T-cell lymphoma: case report and review of the literature. J Pediatr Hematol Oncol 2005; 27: 607–610. [DOI] [PubMed] [Google Scholar]
  4. 4Isidori A, Piccaluga PP, Loscocco F, Guiducci B, Barulli S, Ricciardi T et al. High-dose therapy followed by stem cell transplantation in Hodgkin lymphoma: past and future. Expert Rev Hematol 2013; 6: 451–464. [DOI] [PubMed] [Google Scholar]
  5. 5Nowarski RW. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair. Blood 2012; 120: 366–375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. 6Sghaier H, Ghedira K, Benkahla A, Barkallah I. Basal DNA repair machinery is subject to positive selection in ionizing-radiation-resistant bacteria. BMC Genomics 2008; 9: 297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. 7Kim D, Chung K, Chung W, Bae S, Shin D, Hong S et al. Risk of secondary cancers from scattered radiation during intensity-modulated radiotherapies for hepatocellular carcinoma. Radiat Oncol 2014; 9: 109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. 8Broustas CG, Lieberman HB. RAD9 enhances radioresistance of human prostate cancer cells through regulation of ITGB1 protein levels. Prostate 2014; 74: 1359–13570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. 9Best G, Thompson P, Tam CS. Diagnostic techniques and therapeutic challenges in patients with TP53 dysfunctional chronic lymphocytic leukemia. Leuk Lymphoma 2012; 53: 2105–2115. [DOI] [PubMed] [Google Scholar]
  10. 10de Viron E, Michaux L, Put N, Bontemps F, van den Neste E. Present status and perspectives in functional analysis of p53 in chronic lymphocytic leukemia. Leuk Lymphoma 2012; 53: 1445–1451. [DOI] [PubMed] [Google Scholar]
  11. 11Li L, Boussiotis VA. The role of IL-17-producing Foxp3+CD4+ T cells in inflammatory bowel disease and colon cancer. Clin Immunol 2013; 148: 246–253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. 12Wu C, Wang S, Wang F, Chen Q, Peng S, Zhang Y et al. Increased frequencies of T helper type 17 cells in the peripheral blood of patients with acute myeloid leukaemia. Clin Exp Immunol 2009; 158: 199–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. 13Teng MW, Vesely MD, Duret H, McLaughlin N, Towne JE, Schreiber RD et al. Opposing roles for IL-23 and IL-12 in maintaining occult cancer in an equilibrium state. Cancer Res 2012; 72: 3987–3996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. 14Radosavljevic G, Ljujic B, Jovanovic I, Srzentic Z, Pavlovic S, Zdravkovic N et al. Interleukin-17 may be a valuable serum tumor marker in patients with colorectal carcinoma. Neoplasma 2010; 57: 135–144. [DOI] [PubMed] [Google Scholar]
  15. 15Sun AM, Li CG, Han YQ, Liu QL, Xia Q, Yuan YW. X-ray irradiation promotes apoptosis of hippocampal neurons through up-regulation of Cdk5 and p25. Cancer Cell Int 2013; 13: 47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. 16Oleinika K, Nibbs RJ, Graham GJ, Fraser AR. Suppression, subversion and escape: the role of regulatory T cells in cancer progression. Clin Exp Immunol 2013; 171: 36–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. 17Chen CC, Chen WC, Lu CH, Wang WH, Lin PY, Lee KD et al. Significance of interleukin-6 signaling in the resistance of pharyngeal cancer to irradiation and the epidermal growth factor receptor inhibitor. Int J Radiat Oncol Biol Phys 2010; 76: 1214–1224. [DOI] [PubMed] [Google Scholar]
  18. 18Kimura A, Kishimoto T. IL-6: regulator of Treg/Th17 balance. Eur J Immunol 2010; 40: 1830–1835. [DOI] [PubMed] [Google Scholar]
  19. 19Kim SH, Dass CR. p53-targeted cancer pharmacotherapy: move towards small molecule compounds. J Pharm Pharmacol 2011; 63: 603–610. [DOI] [PubMed] [Google Scholar]
  20. 20Solanki AA, LeMieux MH, Chiu BC, Mahmood U, Hasan Y, Koshy M. Long-term outcomes in patients with early stage nodular lymphocyte-predominant hodgkin lymphoma treated with radiotherapy. PLoS ONE 2013; 8: e75336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. 21Cheng JC, Bai A, Beckham TH, Marrison ST, Yount CL, Young K et al. Radiation-induced acid ceramidase confers prostate cancer resistance and tumor relapse. J Clin Invest 2013; 123: 4344–4358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. 22Trikha M, Corringham R, Klein B, Rossi JF. Targeted anti-interleukin-6 monoclonal antibody therapy for cancer: a review of the rationale and clinical evidence. Clin Cancer Res 2003; 9: 4653–4665. [PMC free article] [PubMed] [Google Scholar]
  23. 23Wedlake LJ, Khan K, Ahmedi B, Thomas K, Abraham D, Andreyev N. Letter in response to article: a pilot study examining circulating interleukin-6 and transforming growth factor-beta levels during pelvic radiation therapy. Am J Clin Oncol 2013; 36: 102–103. [DOI] [PubMed] [Google Scholar]
  24. 24Alberti L, Thomachot MC, Bachelot T, Menetrier-Caux C, Puisieux I, Blay JY. IL-6 as an intracrine growth factor for renal carcinoma cell lines. Int J Cancer 2004; 111: 653–661. [DOI] [PubMed] [Google Scholar]
  25. 25Chen MF, Hsieh CC, Chen WC, Lai CH. Role of interleukin-6 in the radiation response of liver tumors. Int J Radiat Oncol Biol Phys 2012; 84: e621–e630. [DOI] [PubMed] [Google Scholar]
  26. 26Gougelet A, Mansuy A, Blay JY, Alberti L, Vermot-Desroches C. Lymphoma and myeloma cell resistance to cytotoxic agents and ionizing radiations is not affected by exposure to anti-IL-6 antibody. PLoS ONE 2009; 4: e8026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. 27Wang BQ, Zhang CM, Gao W, Wang XF, Zhang HL, Yang PC. Cancer-derived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol 2011; 137: 1525–1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. 28Hemdan NY. Anti-cancer versus cancer-promoting effects of the interleukin-17-producing T helper cells. Immunol Lett 2013; 149: 123–133. [DOI] [PubMed] [Google Scholar]
  29. 29Qu Y, Zhang B, Liu S, Zhang A, Wu T, Zhao Y. 2-Gy whole-body irradiation significantly alters the balance of CD4+CD25− T effector cells and CD4+CD25+Foxp3+ T regulatory cells in mice. Cell Mol Immunol 2010; 7: 419–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. 30Ganesan AP, Johansson M, Ruffell B, Beltran A, Lau J, Jablons DM et al. Tumor-infiltrating regulatory T cells inhibit endogenous cytotoxic T cell responses to lung adenocarcinoma. J Immunol 2013; 191: 2009–2017. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES