Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Nov 2;112(46):14354–14359. doi: 10.1073/pnas.1510745112

Host target modification as a strategy to counter pathogen hijacking of the jasmonate hormone receptor

Li Zhang a,b, Jian Yao a,c, John Withers a,b, Xiu-Fang Xin a, Rahul Banerjee d, Qazi Fariduddin a,e, Yoko Nakamura f, Kinya Nomura a, Gregg A Howe a,g, Wilhelm Boland f, Honggao Yan g, Sheng Yang He a,b,h,1
PMCID: PMC4655571  PMID: 26578782

Significance

Pathogen infections can cause significant crop losses worldwide and major disturbances in natural ecosystems. Understanding the molecular basis of plant disease susceptibility is important for the development of new strategies to prevent disease outbreaks. Recent studies have identified the plant jasmonate (JA) hormone receptor as one of the common targets of pathogen virulence factors. In this study, we modified the JA receptor and showed that transgenic Arabidopsis plants with the modified JA receptor gained resistance to bacterial pathogens that secrete a potent JA-mimicking toxin to promote infection. Our results suggest that host target modification may be developed as a new strategy to protect the disease-vulnerable components of the susceptible plant against highly evolved pathogens.

Keywords: plant hormone, plant immunity, bacterial virulence, coronatine, jasmonate

Abstract

In the past decade, characterization of the host targets of pathogen virulence factors took a center stage in the study of pathogenesis and disease susceptibility in plants and humans. However, the impressive knowledge of host targets has not been broadly exploited to inhibit pathogen infection. Here, we show that host target modification could be a promising new approach to “protect” the disease-vulnerable components of plants. In particular, recent studies have identified the plant hormone jasmonate (JA) receptor as one of the common targets of virulence factors from highly evolved biotrophic/hemibiotrophic pathogens. Strains of the bacterial pathogen Pseudomonas syringae, for example, produce proteinaceous effectors, as well as a JA-mimicking toxin, coronatine (COR), to activate JA signaling as a mechanism to promote disease susceptibility. Guided by the crystal structure of the JA receptor and evolutionary clues, we succeeded in modifying the JA receptor to allow for sufficient endogenous JA signaling but greatly reduced sensitivity to COR. Transgenic Arabidopsis expressing this modified receptor not only are fertile and maintain a high level of insect defense, but also gain the ability to resist COR-producing pathogens Pseudomonas syringae pv. tomato and P. syringae pv. maculicola. Our results provide a proof-of-concept demonstration that host target modification can be a promising new approach to prevent the virulence action of highly evolved pathogens.


Studies during the past two decades have revealed that plants possess a sophisticated, multilayered immune signaling network that is regulated by several stress hormones (1). Most prominently, jasmonate (JA) plays a central role in regulating plant defense against a variety of chewing insects and necrotrophic pathogens, whereas salicylic acid (SA) is critical for plant defense against biotrophic or hemibiotrophic pathogens (1–3). During host–pathogen coevolution, however, many successful plant pathogens developed mechanisms to attack or hijack components of the plant immune signaling network as part of their pathogenesis strategies (4–6). As a result, the plant immune system, although powerful, is often fallible in the face of highly evolved pathogens.

The JA signaling cascade has been a subject of intense study, and many important players in this hormone signal transduction system have been identified. Higher plants synthesize different forms of JA, including the most bioactive form jasmonoyl-l-isoleucine (JA-Ile) (7–11). Perception of JA-Ile occurs through a coreceptor, composed of CORONATINE INSENSITIVE1 (COI1), the F-box subunit of a Skp/Cullin/F-box–type ubiquitin ligase complex, and JASMONATE ZIM DOMAIN (JAZ) proteins, which are transcriptional repressors (12–16). In the absence of hormone signal, JAZ repressors bind to and repress the transcription factors (e.g., MYC2) both directly and through the recruitment of the NOVEL INTERACTOR OF JAZ (NINJA) adapter and TOPLESS (TPL) corepressor proteins (10, 14, 17–20). In response to developmental or environmental cues, JA-Ile concentration rises, which promotes the interaction between COI1 and JAZs and subsequent degradation of JAZ repressors through the 26S proteasome (10, 21). Activation of MYC and other JAZ-interacting transcription factors leads to transcriptional reprograming and results in a plethora of JA-mediated physiological responses (22–24).

Although activation of the JA signal transduction pathway is essential for plant resistance to chewing insects and necrotrophic pathogens, it also leads to inhibition of SA signaling through hardwired molecular cross-talk between the two pathways (1, 22, 25–27). Because the SA signaling pathway is critical for plant defense against biotrophic and hemibiotrophic pathogens, activation of JA signaling makes plants vulnerable to biotrophic and hemibiotrophic pathogens. In fact, some strains of the hemibiotrophic bacterial pathogen Pseudomonas syringae have evolved an ability to produce a potent JA-mimicking phytotoxin, coronatine (COR), to activate JA signaling as an effective means of inhibiting SA defense and promote plant susceptibility (4, 26, 28, 29). Furthermore, COR-like compounds are produced by pathogens of other taxa (30, 31) and proteinaceous effectors from both bacterial and fungal pathogens have been shown to target the COI1–JAZ coreceptor (32–34). These recent findings suggest that the COI1–JAZ coreceptor is a common target of manipulation by diverse plant pathogens and represents a prominent vulnerable point of the plant immune network.

COR structurally mimics JA-Ile and directly binds to the COI1–JAZ coreceptor to activate the JA signaling pathway (7, 13, 15). The molecular mimicry of COR is remarkable, as illustrated by its high binding affinity (equal to or higher than JA-Ile) to the COI1–JAZ coreceptor, and by the fact that all previously reported COI1 mutations that affect the action of JA-Ile also affect the action of COR (7, 10, 13, 15, 35, 36). Interestingly, coronatine-O-methyloxime (COR-MO), a potent and highly specific JA-Ile antagonist, was found to inhibit both JA signaling and COR action in Arabidopsis and Nicotiana benthamiana (37). To date, no COI1 mutations have been shown to differentially affect the action of JA-Ile vs. COR, illustrating the difficulty in uncoupling the molecular actions of these ligands. Nevertheless, a systematic mutagenesis of the COI1–JAZ coreceptor has not been reported.

Guided by the crystal structure of the COI1–JAZ coreceptor and evolutionary clues, we report here the successful generation of a modified JA receptor with a single amino acid substitution in the JA-Ile-binding pocket of the COI1 protein, which allows for sufficient signal transduction of endogenous JA hormone, fertility, and plant defense against insects, but confers resistance against COR-producing pathogens, P. syringae pv. tomato (Pst) DC3000 and P. syringae pv. maculicola (Psm) ES4326. Our results provide a proof-of-concept demonstration that host target modification could be a promising new approach to prevent hijacking of host targets by highly evolved pathogens.

Results

A Large-Scale, Targeted Alanine Substitution Mutagenesis of the COI1 Protein.

We began our study by conducting an expanded mutagenesis of the COI1 protein to identify amino acid residues that might differentially affect the actions of JA-Ile vs. COR. We selected a total of 42 amino acids in or near the COI1 ligand binding pocket for alanine substitution mutagenesis (a detailed description of the rationale and results can be found in Supplemental Description of Results of Alanine Scanning Mutagenesis of the COI1 Protein). With yeast two-hybrid (Y2H) assay, we were able to identify 21 alanine substitutions that disrupted COR-dependent COI1–JAZ9 interaction, including eight COI1 residues that make direct contact with JA-Ile (36) (Fig. S1 and Table S1). However, none disrupted only COR-dependent interaction but still maintained JA-Ile–dependent COI1–JAZ9 interaction (Fig. S2 A and B). Our results therefore strengthen the notion that COR is a remarkable mimic of JA-Ile and that most, if not all, COI1 residues that are important for the action of JA-Ile are also important for COR action.

Fig. S1.

Fig. S1.

Effect of alanine substitutions on COI1–JAZ9 interactions in Y2H assay in the presence of 10 μM COR. (A) Interactions between JAZ9 and 32 alanine substitution COI1 mutants selected based on TIR1 crystal structure. Blue colonies indicate positive interactions. (B) Interactions between JAZ9 and ten additional alanine substitution COI1 mutants selected based on the COI1 crystal structure.

Table S1.

COI1 amino acids selected for alanine substitution

COI1 amino acids Interaction with JAZ9* Role in the COI1 ligand-binding pocket† Homologous TIR1 amino acid‡ Role in the TIR1 ligand-binding pocket‡
Histidine 54§ +++ PO4 contacting Lysine Not known
Serine 77§ +++ PO4 contacting Serine Not known
Lysine 79§ +++ PO4 contacting Glutamate Not known
Lysine 81 +++ PO4 contacting Lysine IP6 coordination
Arginine 85 +++ JA-Ile and PO4 contacting Histidine Auxin binding, IP6 coordination
Methionine 88 No JAZ1 and PO4 contacting Aspartate Aux/IAA binding
Phenylalanine 89 No JA-Ile and JAZ1 contacting Phenylalanine Auxin and AUX/IAA binding
Leucine 91 No JA-Ile and JAZ1 contacting Leucine Aux/IAA binding
Histidine 118§ +++ PO4 contacting Arginine Not known
Arginine 121 No PO4 contacting Arginine IP6 coordination
Lysine 144§ +++ PO4 contacting Valine Not known
Lysine 147 ++++ PO4 contacting Serine Aux/IAA binding
Glutamate 173 ++ JAZ1 contacting Glutamate Aux/IAA binding
Methionine 201§ +++ JAZ1 contacting Cysteine Not known
Leucine 301§ +++ JAZ1 contacting Serine Not known
Tyrosine 302§ No JAZ1 contacting Tyrosine Not known
Arginine 326§ No JAZ1 contacting Leucine Not known
Arginine 348 No JA-Ile, JAZ1 and PO4 contacting Arginine IP6 coordination
Arginine 351 No JAZ1 contacting Proline AUX/IAA binding
Aspartate 354 No JAZ1 contacting Glutamate AUX/IAA binding
Glutamate 355 +++ JAZ1 contacting Proline AUX/IAA binding
Glutamine 356 +++ Non Phenylalanine AUX/IAA binding
Glycine 357 ++ Non Valine AUX/IAA binding
Tyrosine 386 No JA-Ile and JAZ1 contacting Phenylalanine Auxin and AUX/IAA binding
Aspartate 407 No Non Arginine IP6 coordination
Arginine 409 No JA-Ile and PO4 contacting Arginine Auxin and AUX/IAA binding
Leucine 410 No Non Leucine Auxin binding
Valine 411 No JA-Ile and JAZ1 contacting Cysteine Auxin and AUX/IAA binding
Leucine 412 No Non Isoleucine Aux/IAA binding
Leucine 413 No JAZ1 contacting Isoleucine Aux/IAA binding
Arginine 415 ++ Non Proline AUX/IAA binding
Arginine 440 ++ Non Arginine IP6 coordination
Phenylalanine 443 No Non Leucine Auxin binding
Tyrosine 444§ No JA-Ile and JAZ1 contacting None Not known
Tryptophan 467 +++ Non Methionine IP6 coordination
Leucine 469 No JA-Ile contacting Serine Auxin binding
Leucine 470 No Non Valine Auxin binding
Tyrosine 472 +++ PO4 contacting Phenylalanine AUX/IAA binding
Glutamine 491 +++ Non Arginine IP6 coordination
Lysine 492 +++ PO4 contacting Lysine IP6 coordination
Arginine 496 +++ JA-Ile and JAZ1 contacting Arginine Auxin and AUX/IAA binding
Arginine 516 No Non Arginine IP6 coordination
*

Y2H assays were conducted with 10 µM COR in the medium. The strength of mutant COI1–JAZ9 interactions was scored relative to COI1–JAZ9 (designated as +++).

†

COI1 amino acids and their roles in the JAZ1–COI1-JA-Ile interaction, as reported previously (36).

‡

TIR1 amino acids corresponding to those in COI1 and roles in ligand–receptor interaction as reported (36, 51).

§

Additional COI1 amino acids selected for mutagenesis based on the crystal structure of the COI1–JAZ1 complex with COR or JA-Ile (36).

Fig. S2.

Fig. S2.

Liquid Y2H results of interactions between COI1 substitution mutants and JAZ9. (A) Liquid Y2H results of JAZ9 interaction with COI1 mutants in which each of seven selected JA-Ile–contacting residues was substituted with alanine. (B) Liquid Y2H results of JAZ9 interaction with COI1 mutants in which each of three additional JA-Ile–interacting residues was substituted with alanine. (C) Liquid Y2H results of JAZ9 and seven additional COI1 mutants with substitutions at the A384 position. (D) Western blot for A384 substitutions expression in yeast, showing that A384V and other A384 substitution mutants are expressed and stable in yeast. Anti-LexA antibody was used for detection of COI1 proteins expressed from pGilda vector and anti-HA antibody was used for detection of JAZ9 expression from pB42AD vector. RLU indicates the degree of interaction between COI1 mutants and JAZ9 in the presence of either 1 µM COR, 10 µM JA-Ile (or 30 μM JA-Ile), or 1% DMSO treatment. Different letters above columns indicate significant differences (P < 0.05) between different treatments (i.e., DMSO, JA-Ile, or COR) for the same set of interacting proteins. For those interacting proteins that do not have letter labels above columns, no significant differences were detected between treatments. Two-way ANOVA with Bonferroni posttest was used. Data were presented as mean ± SEM (A: n = 2; B and C: n = 3).

Structure-Guided Modeling of JA-Ile/COR Binding Sites in COI1.

Our initial mutagenesis was based on alanine substitution, which resulted in a reduction of the side-chain size for all of the amino acid residues targeted for mutagenesis, except for G357A. Next, we considered increasing the side-chain sizes of residues that are in contact with JA-Ile/COR. We noted that although COR and JA-Ile are highly similar in structure, the flexibilities of COR and JA-Ile in the binding pocket are different. For example, the cyclohexene ring and the ethyl-cyclopropane group of COR appear more rigid than the equivalent parts (the pentenyl side-chain and the isoleucine side-chain, respectively) of JA-Ile (36). We hypothesized that the higher rigidity of the cyclohexene ring and the ethyl-cyclopropane group of COR may be more prone than the equivalent parts of JA-Ile to physical hindrance from an increased size of the amino acid side-chain with which COR/JA-Ile are in direct contact.

Based on the above hypothesis, residues A86 and A384 attracted our attention for two reasons. First, in silico analysis of the putative JA-Ile binding pockets in diverse plant species for which the COI1 protein sequences are available revealed that, although most residues in the JA binding site are highly conserved across taxa, residues at positions 86 and 384 exhibit a higher degree of polymorphism (Fig. S3A). In the moss species Physcomitrella patens, for example, isoleucine or valine occupy the corresponding position of A384 (Fig. S3A). Positions of A86 and A384 in Selaginella moellendorffii are replaced by isoleucine/valine and serine, respectively (Fig. S3A). Previous studies have shown that, although core JA signaling genes are found in P. patens (38), neither JA nor JA-Ile could be detected in P. patens (39). On the other hand, (9S,13S)-12-oxophytodienoic acid [cis-(+)-OPDA], the precursor of JA biosynthesis, is synthesized in P. patens, suggesting that P. patens may produce an alternative, OPDA-related ligand (39). We speculated that, during plant evolution, the polymorphism at positions 86 and 384 in the putative COI1 binding pocket may provide a basis for accommodating related ligands of distinct structural features. If so, mutations at these amino acid positions may have a higher chance of producing differential effects on different ligands compared with more highly conserved residues, which are expected to affect different ligands similarly.

Fig. S3.

Fig. S3.

Alignments of amino acids of COI1 orthologs involved in ligand–receptor interaction in the ligand binding pocket and position of A86 with respect to JA-Ile and COR bound in COI1 ligand binding pocket. (A) Fourteen amino acids involved in JA-Ile interaction in the Arabidopsis COI1 protein (36) and the corresponding amino acids in six representative plant species. Green dots indicate amino acids contacting with JA-Ile/COR. Blue dots indicate amino acids that also make contact with JAZ1. Red dots indicate amino acids that also make contact with InsP5. Abbreviations: Arabidopsis thaliana (At), Solanum lycopersicum (Sl), Populus trichocarpa (Pt), Brachypodium distachyon (Bd), Picea abies (Pa), Selaginella moellendorffii (Sm), Physcomitrella patens (Pp). (B and C) Binding pose of (B) JA-Ile and (C) COR with respect to A86 in the ligand-binding site of wild-type COI1 (PDB ID codes 3OGL and 3OGK, respectively). C-atoms in COI1 are shown in green and those in JA-Ile and coronatine are shown in yellow and magenta, respectively. Ligand-binding site in COI1 is shown in gray-colored surface representation; ligands and A86 residues are shown in stick representation, whereas all other atoms in the protein are shown in line representation.

Second, we noted that, in the JA-Ile/COR-binding pocket, A86 and A384 make direct contacts with the ligand (Fig. S3A) and are situated close to the cyclohexene ring and the ethyl-cyclopropane group of COR or the equivalent parts of JA-Ile, the pentenyl side-chain, and the isoleucine side-chain, respectively (Fig. 1 A and B and Fig. S3 B and C). The Cβ atom of A86 is 3.6 Å from the nearest C-atom in the pentenyl side-chain of JA-Ile and 3.7 Å from the ethyl group attached to the cyclohexene ring of COR in their respective crystal structures. The Cβ atom of A384 is 4.0 Å from the nearest C-atom of the isoleucine side chain of JA-Ile and 3.6 Å from the ethyl-cyclopropane group of COR. In silico mutagenesis followed by energy minimization revealed that the A384V substitution, in particular, would create steric clash with the isoleucine side-chain of JA-Ile or the ethyl group attached to the cyclopropane moiety of COR (Fig. 1 C and D). However, the flexibility of the isoleucine side-chain of JA-Ile would likely allow for its readjustment to fit the mutated ligand-binding pocket, whereas the rigidity of the ethyl-cyclopropane group of COR would not (Fig. 1 E and F). Taken together, our in silico and structural modeling analyses suggest the possibility that mutating alanine to valine at position 384 may result in a ligand-binding pocket that is more unfavorable to the chemical structure of COR than that of JA-Ile.

Fig. 1.

Fig. 1.

Computer modeling of JA-Ile or COR in the ligand-binding site of COI1 or COI1A384V. (A and B) Binding pose of JA-Ile (A) and COR (B) in the ligand-binding site of COI1 in the crystal structures of the COI1–JAZ1 complex (PDB ID codes 3OGL and 3OGK, respectively). Amino acid contacts in the ligand pocket were described by Sheard et al. (36). (C and D) Computer modeling of the A384V substitution showing expected steric clash with the isoleucine side-chain of JA-Ile or the ethyl group attached to the cyclopropane moiety of COR. However, the isoleucine side-chain of JA-Ile can be adjusted in the mutant ligand binding site by rotation of the side-chain dihedral angle, χ1 of isoleucine (C). In contrast, the steric clash (highlighted in red box) impairs COR binding in the ligand-binding site because the rotatable bond at the equivalent position is absent in COR (D). The ligand-binding site in COI1 is shown in gray-colored surface representation. Ligands and A384/V384 residues are shown in stick representation, whereas all other atoms in the protein are shown in line representation. C-atoms in the wild-type and mutant COI1 proteins are shown in green and cyan, respectively; those in JA-Ile and COR are shown in yellow and magenta, respectively. In protein and ligand molecules N-, O-, and H-atoms are colored in blue, red, and gray, respectively, and, for clarity, nonpolar H-atoms are not shown. (E) Molecular structure of JA-Ile with χ1 torsion angle shown in cyan arrow. (F) Molecular structure of COR in which the cyclopropane moiety restricts the rotational freedom of the terminal ethyl group. The cyclopropane moiety along with the ethyl substitution is highlighted in yellow.

Effects of Amino Acid Substitutions at Positions 86 and 384 on JA-Ile/COR–Dependent Formation of the COI1-JAZ9 Coreceptor.

To test the hypothesis that mutating A384 or A86 may create a ligand-binding pocket that is more unfavorable to COR than to that of JA-Ile, we first substituted these two alanine residues with the corresponding residues found in lower plant species P. patens and S. moellendorffii (Fig. S3A). Specifically, the following COI1 mutants were generated: COI1A86I, COI1A86V, COI1A384I, COI1A384S, and COI1A384V. Quantitative liquid Y2H assays revealed that both COI1A86I and COI1A86V abolished JA-Ile–dependent COI1–JAZ9 interaction, and reduced COR-dependent COI1–JAZ9 interaction (Fig. 2A). This indicated that A86 is critical for the action of both JA-Ile and COR, albeit more critical for JA-Ile than COR.

Fig. 2.

Fig. 2.

Y2H and pull-down assays for physical interactions between COI1 and JAZ9 proteins. (A) Liquid Y2H results of JAZ9 and mutant COI1 proteins containing amino acid substitutions at position 86 or 384 in the presence of 1 μM COR or 30 μM JA-Ile. (B) Liquid Y2H results of COI1–JAZ9 interaction in the presence of different concentrations of JA-Ile and COR. Relative light units (RLU) indicated the degree of interaction between COI1 mutants and JAZ9. One-percent DMSO treatment was used as mock treatment. Different letters of the same type above columns indicated significant differences (P < 0.05) between different treatments (i.e., DMSO, JA-Ile, or COR) for the same set of interacting proteins (n = 3, error bars, SEM). For those interacting proteins that do not have letter labels above columns, no significant differences were detected between treatments. Two-way ANOVA with Bonferroni posttest was used for A. One-way ANOVA with Tukey’s multiple comparison test was used for B. (C) Results of coreceptor pull-down assays. Pull-down assays were performed with protein extracts from pCOI1:COI1WT/A384V-4xc-Myc plants and recombinant E. coli-expressed MBP-JAZ9-8xHis in the presence of COR or JA-Ile at indicated concentrations. Proteins bound to MBP-JAZ9-8xHis were analyzed by immunoblotting. Anti–c-Myc antibody was used for detection of COI1WT/A384V-4xc-Myc protein. The Coomassie blue-stained gel shows the amounts of MBP-JAZ9-8xHis pulled down by the Ni affinity resin.

Substitutions at position 384 exhibited more diverse effects than those at position 86 on JA-Ile/COR–dependent COI1–JAZ9 interaction (Fig. 2A). COI1A384I disrupted both JA-Ile– and COR-dependent interaction, whereas COI1A384S only reduced JA-Ile–dependent interaction. Most interestingly, COI1A384V greatly reduced COR-dependent interaction, but had less effect on JA-Ile–dependent COI1–JAZ9 interaction (Fig. 2A). We also found that 10 μM JA-Ile, which contains a mixture of active and inactive isomers of JA-Ile, was equivalent to 0.1 μM pure COR in promoting the COI1–JAZ9 interaction in yeast (Fig. 2B).

We made seven additional substitutions at A384 to determine whether these substitutions would have an effect similar to that of COI1A384V. Of these seven substitutions (representing different types of side-chains), A384C reduced, and A384D, A384G, A384L, A384N, A384P, and A384T completely disrupted JA-Ile– and COR-dependent interaction (Fig. S2C). In all, no additional substitutions affected COR-dependent COI1–JAZ9 interaction more than JA-Ile–dependent COI1–JAZ9 interaction. Therefore, through extensive mutagenesis efforts we succeeded in identifying a specific amino acid substitution, A384V, in the JA-Ile binding pocket that preferably affects COR-dependent COI1–JAZ9 interaction, compared with JA-Ile–dependent COI1–JAZ9 interaction in yeast.

Transgenic Arabidopsis Plants Expressing COI1A384V Are Fertile but Exhibit Differential Sensitivities to Methyl Jasmonate and COR in Vivo.

To determine the physiological relevance of the results from Y2H assays, we produced transgenic Arabidopsis plants (in coi1-30–null mutant background) that express COI1A384V from the COI1 native promoter (pCOI1:COI1A384V-4xc-Myc; COI1A384V hereafter). As controls, we also generated transgenic lines that express wild-type COI1 in the coi1-30 background (pCOI1:COI1WT-4xc-Myc; COI1WT hereafter). First, we determined whether COI1A384V complements the male sterile phenotype in coi1-30. JA is essential for male fertility and coi1 mutants are male sterile (40). Consistent with Y2H results showing that COI1A384V maintained substantial JA-Ile interaction, 83% of COI1A384V lines (10 of 12 lines analyzed) were fertile (Fig. 3A). Four fertile COI1A384V lines were randomly chosen for protein expression analysis and all were found to produce the c-Myc–tagged COI1A384V protein (Fig. 3B). No fertility penalty was detected in COI1A384V plants, as judged by the number of developed siliques and the number of seeds per silique, which are similar to wild-type plants (Table S2).

Fig. 3.

Fig. 3.

Phenotypes of transgenic COI1WT and COI1A384V plants. (A) A picture showing restoration of male fertility in transgenic coi1/COI1WT and coi1/COI1A384V plants. (B) COI1 protein levels in pCOI1:COI1WT-4xc-Myc and pCOI1:COI1A384V-4xc-Myc transgenic plants. Coomassie blue-stained ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCo) protein was used as loading control. (C) Quantification of root growth assay with 10 μM MeJA or 0.2 μM COR application. Relative root length was compared with mock treatment (0.1% DMSO). Different letters of the same type above columns indicated significant differences (P < 0.05) between different plant genotypes with the same treatment (MeJA or COR) (n = 15, error bars, SEM, except for coi1-30, n = 7), as determined by two-way ANOVA with Bonferroni posttest. ***P < 0.001 indicated significant differences between two ligand treatments of the same plant genotype (ns: not significant). (D) Fold-changes of JAZ9 gene expression in Col-0, transgenic COI1WT, COI1A384V, and coi1-30 plants after 10 μM MeJA or 0.2 μM COR induction, relative to those in coi1-30 plants with 10 μM MeJA. Internal control: the PROTEIN PHOSPHATASE 2A SUBUNIT A3 gene (PP2AA3, AT1G13320). Different letters of the same type above columns indicated significant differences (P < 0.05) of gene expression between different plant genotypes with the same ligand treatment (MeJA or COR) (n = 4, error bars, SEM), by two-way ANOVA with Bonferroni posttest. **P < 0.01 and ***P < 0.001 indicate significant differences between two different ligand treatments of the same plant genotype (ns, not significant).

Table S2.

Fertility of Col-0, COI1WT, COIA384V, and coi1-30 plants

Plant No. of fertile flowers* No. of seeds/silique†
Col-0 50/50 62 ± 4
coi1-30/COI1WT 50/50 57 ± 8
coi1-30/COI1A384V L1 50/50 58 ± 6
coi1-30 0/50 0

No statistically significant differences were found by ANOVA (P = 0.411072) between Col-0, coi1-30/COI1WT, and coi1-30/COI1A384V L1.

*

Number of flowers that produce siliques/number of total flowers examined. Ten flowers of each plant and five plants of each genotype were examined.

†

Five siliques of each plant and a total of five plants were examined.

Next, we performed COI1–JAZ9 pull-down experiments to compare the responsiveness of plant-expressed COI1WT and COI1A384V proteins to serial concentrations of JA-Ile and COR using Escherichia coli-expressed JAZ9 protein, following the procedure reported previously (13). These experiments confirmed that a much higher (∼100-fold) concentration of COR was required for robust formation of the COI1A384V–JAZ9 coreceptor than for the COI1WT–JAZ9 coreceptor, whereas similar concentrations of JA-Ile were needed to promote the formation of the COI1A384V–JAZ9 and COI1WT–JAZ9 coreceptors (Fig. 2C).

Finally, we conducted further analyses with two representative COI1A384V lines, L1 and L2, to determine their responses to JA- or COR-induced root growth inhibition. Dose–response experiments showed that the effect of 10 μM methyl jasmonate (MeJA), which is converted to the active form JA-Ile in planta, was equivalent to that of 0.2 μM COR in wild-type Col-0 plants (Fig. 3C and Fig. S4). Unlike wild-type Col-0 plants, the root growth inhibition of COI1A384V plants was significantly less sensitive to 0.2 μM COR than to 10 μM MeJA (Fig. 3C and Fig. S4). The potency of 0.2 μM COR in inhibiting root growth in COI1A384V plants was comparable to 0.1 μM MeJA, indicating ∼100-fold less effectiveness of 0.2 μM COR in COI1A384V than in Col-0 and COI1WT (Fig. S4). These results were consistent with the differential effects of the A384V substitution on JA-Ile– vs. COR-dependent formation of the COI1–JAZ9 coreceptor observed in both Y2H and COI1–JAZ9 coreceptor pull-down assays, and confirmed that COI1A384V transgenic plants are differentially sensitive to MeJA vs. COR in vivo.

Fig. S4.

Fig. S4.

Root growth inhibition assays with a gradient concentration of MeJA or COR. (A) Pictures showing root growth of Col-0, coi1-30, COI1WT, and COI1A384V seedlings after treatment of a gradient concentration of MeJA or COR. (B) Quantification of root growth assay shown in A. Relative root length was compared with mock treatment (0.1% DMSO). Error bars represented SEM for 15 seedlings (except for coi1-30, 7 seedlings were used) within each treatment. Note that 0.1, 1, or 10 μM MeJA is similar to 0.002, 0.02 or 0.2 μM COR in potency, respectively (i.e., COR is ∼50-fold more potent than MeJA). Different letters of the same type above columns indicated significant differences (P < 0.05) of relative root growth between different treatments (i.e., DMSO, MeJA, or COR) within the same plant genotype. Two-way ANOVA with Bonferroni posttest was used.

Transgenic Arabidopsis Plants Expressing COI1A384V Exhibit Differential Expression of JA Response Marker Genes in Response to MeJA vs. COR.

We next examined JA response gene expression in COI1A384V transgenic plants. For this purpose, the expression of the JA-responsive marker gene JAZ9 was measured by quantitative PCR (qPCR). As expected, JAZ9 gene expression was induced in Col-0 and COI1WT plants after MeJA or COR application (Fig. 3D). In COI1A384V lines, however, JAZ9 gene expression in response to COR treatment was significantly reduced compared with Col-0 or COI1WT plants, whereas JAZ9 expressions in response to MeJA treatment was less affected in this same comparison (Fig. 3D). For example, in COI1A384V L1, MeJA treatment induced the expression of JAZ9 by 38-fold compared with that in coi1-30 plants. However, induction of JAZ9 gene expression in COI1A384V L1 was only eightfold higher than that in coi1-30 plants after COR treatment. These results are consistent with the conclusion that the A384V substitution greatly affects the action of COR, while maintaining JA signaling required for substantial JA response gene expression. We also examined the expression of SA-responsive genes PATHOGENESIS-RELATED GENE 1 (PR1) and SALICYLIC ACID INDUCTION DEFICIENT 2 (SID2) in COI1A384V plants and found that PR1 and SID2 gene expression were similarly low in Col-0, COI1WT and COI1A384V plants (Fig. S5), indicating that the SA signaling pathway remained quiescent in COI1A384V plants, as in Col-0 and COI1WT plants.

Fig. S5.

Fig. S5.

Expression of SA-responsive genes PR1 and SID2 in Col-0, COI1WT, and COI1A384V plants, relative to that in Col-0 plants. (A) Expression of SA-responsive gene PR1 in Col-0, COI1WT and COI1A384V plants. (B) Expression of SA-responsive gene SID2 in Col-0, COI1WT, and COI1A384V plants. PP2AA3 was used as an internal control gene. One-way ANOVA with Dunnett test was used (n = 4, error bars, SEM). No significant difference (P < 0.05) was detected.

COI1A384V Transgenic Plants Gained Resistance to Pst DC3000 and Psm ES4326, While Maintaining High-Level Defense Against Chewing Insects.

Our analyses so far suggested that we might have succeeded in engineering a modified JA receptor that substantially uncouples endogenous hormone signaling from pathogen hijacking via COR. If so, we expected that the COI1A384V transgenic plants would gain resistance to COR-producing bacterial pathogens, while retaining substantial defense against chewing insects. To test this possibility, we conducted bioassays using Pst DC3000 and Psm ES4326, two well-known COR-producing hemibiotrophic pathogens that infect Arabidopsis (41, 42), and Spodoptera exigua, a generalist chewing insect that is susceptible to COI1-dependent defenses in Arabidopsis (43). As expected, Col-0 and COI1WT plants were highly susceptible to Pst DC3000 (Fig. 4 A and B). COI1A384V plants, however, exhibited significantly increased resistance to Pst DC3000, as evidenced by greatly reduced bacterial growth and disease symptoms (Fig. 4 A and B). Quantitatively, Pst DC3000 populations in COI1A384V lines were 254- to 42-fold lower than those in Col-0 plants and 189- to 31-fold lower than those in COI1WT transgenic plants (Fig. 4B). Similarly, COI1A384V plants exhibited significantly increased resistance to Psm ES4326 compared with wild-type Col-0 or COI1WT plants (Fig. 4 C and D). Control experiments showed that coi1-30 plants were highly resistant to both pathogens in these assays (Fig. 4 B and D).

Fig. 4.

Fig. 4.

Results of bacterial infection assays with Pst DC3000, Psm ES4326, and Pst DC3118 and Pst DB29 (two COR-deficient mutants of Pst DC3000). (A and B) Disease symptoms (A) and bacterial populations (B) 3 d after dip-inoculation with 1 × 108 cfu/mL Pst DC3000. ***P < 0.001 indicates significant difference between mutant lines and wild-type Col-0 by one-way ANOVA with Dunnett test (n = 4, error bars, SEM). (C and D) Disease symptoms (C) and bacterial populations (D) 3 d after dip-inoculation with 1 × 108 cfu/mL Psm ES4326. **P < 0.01 and ***P < 0.001 indicate significant difference between mutant lines and Col-0 wild-type by One way ANOVA with Dunnett test (n = 4, error bars, SEM).

Next, we conducted disease assays using Pst DC3118 and DB29, which are mutants of Pst DC3000 defective in COR production (44, 45). Similar levels of bacterial growth were observed in Col-0, COI1WT, and COI1A384V plants, suggesting that the gained resistance in COI1A384V plants to Pst DC3000 was largely COR-dependent (Fig. S6).

Fig. S6.

Fig. S6.

Bacterial populations after infection with COR-deficient P. syringae mutants. (A and B) Bacterial populations 4 d after syringe-infiltration with 1 × 106 cfu/mL Pst DC3118 (A) or 1 × 106 cfu/mL DB29 (B). No significant difference (P < 0.05) was detected between plant genotypes by One-way ANOVA with Dunnett test (n = 4, error bars, SEM).

Finally, we performed insect feeding assays using S. exigua neonate larvae. As expected, S. exigua grew much more slowly on Col-0 plants than on coi1-30 mutant plants (Fig. 5), consistent with previous reports (46, 47). The average weight of larvae feeding on coi1-30 plants was sixfold higher than larvae reared on COI1WT plants and fivefold higher than those grown on COI1A384V plants (Fig. 5A). Thus, COI1A384V plants maintained an almost wild-type level of defense against S. exigua.

Fig. 5.

Fig. 5.

Results of insect feeding assays on COI1WT and COI1A384V. (A) Average weights of 12-d-old S. exigua larvae fed on Col-0, coi1-30, COI1WT or COI1A384V plants. ***P < 0.001 indicates a significant difference in comparisons to Col-0 using One-way ANOVA with Dunnett test (n = 10, error bars, SEM). No significant difference was detected in the weight of larvae reared on Col-0, COI1WT and COI1A384V L1 plants. (B) A picture of representative larvae 12 d after feeding. (C) Pictures of Arabidopsis plants after insect challenge.

Supplemental Description of Results of Alanine Scanning Mutagenesis of the COI1 Protein

We conducted targeted alanine substitution mutagenesis of the COI1 protein to identify amino acid residues that might differentially affect the actions of JA-Ile vs. COR. At the onset of this study, the crystal structure of the COI1–JAZ coreceptor was not available. However, the crystal structure of the TIR1-AUX/IAA [for TRANSPORT INHIBITOR RESPONSE 1 (TIR1)-AUXIN/INDOLE 3-ACETIC ACID (AUX/IAA)] coreceptor involved in the perception of the plant hormone auxin was available (51). Auxin and JA signaling pathways are highly analogous in hormone sensing and response (17, 52). In fact, comparative genomic analysis suggested that auxin and JA signaling pathways may have originated from a common ancestor that duplicated and diverged into TIR1 and COI1 for different hormone signaling pathways (38). We hypothesized at the time that the ligand-binding surfaces in COI1 would be similarly positioned as those in TIR1, and that key differences in these conserved residues might confer specificity to the differential recognition of the respective ligands (i.e., JA-Ile/COR vs. auxin). Based on this initial criterion, 32 amino acids were selected for site-direct mutagenesis to alanine (Table S1). Y2H assays showed that 56% (18 of 32) of the alanine substitution mutants abolished COR-dependent interaction between COI1 and JAZ9 (Fig. S1A and Table S1).

When the 18 residues were mapped to the crystal structure of the COI1–JAZ1 coreceptor, which became available later (36), 12 were found to make contacts with ligand, Ins(1,2,4,5,6)P5 (InsP5) or JAZ1 in the ligand-binding pocket. The crystal structure of COI1–JAZ1 coreceptor also shows several additional amino acids in the ligand-binding pocket, which could contribute to the interactions between COI1-ligand, COI1–JAZ, and COI1 interaction with InsP5 (36). We therefore selected 10 additional amino acids for site-directed mutagenesis to alanine (Table S1). Y2H assays showed that three alanine substitutions, Y302A, R326A, and Y444A, disrupted the COR-dependent COI1–JAZ9 interaction (Fig. S1B). Thus, a total of 21 COI1 residues were identified to be important for COR-induced formation of the COI1–JAZ coreceptor complex in yeast.

To determine whether substitutions that affected COR-dependent COI1–JAZ9 interaction differentially affect JA-Ile–dependent COI1–JAZ9 interaction, we conducted quantitative liquid Y2H assays with 10 alanine substitutions for the amino acids contacting directly with JA-Ile (36) (Fig. S2 A and B). We found that: (i) seven alanine substitutions disrupted both JA-Ile– and COR-dependent COI1–JAZ9 interaction, (ii) R409A substitution exhibited reduced COI1–JAZ9 interaction in the presence of JA-Ile or COR, and (iii) the R85A and R496A substitutions affect JA-Ile–dependent interaction more than COR-dependent interaction. No substitution was found to disrupt only COR-dependent interaction and still maintain JA-Ile–dependent COI1–JAZ9 interaction. Our results therefore strengthen the notion that COR is a remarkable mimic of JA-Ile and that most, if not all, of COI1 residues that are important for the action of JA-Ile are also important for COR action.

Discussion

In the past decade, numerous host targets of bacterial, fungal, oomycete, and nematode virulence factors have been identified, representing major advances in our understanding of plant–microbe interactions. However, this fundamental knowledge has largely not yet been exploited to inhibit disease development. COR was one of the first bacterial virulence factors of which the host target was clearly identified (7, 13, 15) and its molecular action on the host target (the JA receptor) was elucidated at the crystal structural level (36). In this study, guided by the crystal structure of the JA receptor, we identified a single amino acid substitution (A384V) in the JA-binding pocket of the COI1 protein that greatly reduces Arabidopsis sensitivity to COR and confers substantial resistance of Arabidopsis to COR-producing Pst DC3000 and Psm ES4326. Our study provides a proof-of-concept demonstration for the feasibility of making a simple modification to a host target as a promising new approach to counter pathogen virulence, thus expanding the range of pathogens that a plant can defend against.

The COR toxin is produced not only by P. syringae pv. tomato and P. syringae pv. maculicola, but also P. syringae pvs. atropurpurea, glycinea, morsprunorum, and porri, which collectively infect a wide range of plants, including ryegrass, soybean, crucifers, cherry, plum, leeks, and tomato (29, 30). Furthermore, production of COR/COR-like compounds has been reported beyond the P. syringae species, including Pseudomonas cannabina pv. alisalensis, Streptomyces scabies, and Xanthomonas campestris pv. phormiicola (29–31). Finally, gene clusters for COR biosynthesis have been found in Pseudomonas savastanoi pv. glycinea and Pectobacterium atrosepticum (syn. Erwinia carotovora subsp. atroseptica) (48, 49). Importantly, transposon insertion mutants of coronafacic acid-like polyketide phytotoxin gene clusters in P. atrosepticum were shown to have reduced pathogen virulence (49). However, it remains to be determined whether these COR-like toxins target the COI1–JAZ coreceptor for their virulence activity. If so, modification of COI1 at A384 or other residues in the JA binding pocket could represent a broadly applicable approach to improve plant resistance to diverse pathogens. In addition, because of the simplicity of constructing amino acid substitutions, generation of COI1A384V plants seems particularly amenable through CRISPR-mediated genome editing.

Although our study is focused on uncoupling JA signaling from COR toxin action, recent studies have shown that the JA receptor is also a host target of proteinaceous effectors delivered into the host cell by bacterial pathogens and fungal symbionts (32–34). For example, P. syringae pv. syringae, which is not known to produce COR or COR-like toxins, delivers the effector protein HopZ1a to acetylate and induce JAZ protein degradation, thereby activating JA signaling (33). P. syringae pv. tabaci, which also does not produce COR or COR-like toxins, delivers the effector protein HopX1 into the host cell to interact with and degrade JAZ via its cysteine protease activity (34). The Laccaria bicolor fungal effector protein MiSSP7 (mycorrhiza-induced small secreted protein 7) interacts with the host Populus PtJAZ6 protein and inhibits JA-induced degradation of PtJAZ6 to promote symbiosis (32). Hence, the COI1–JAZ coreceptor has emerged as a common host target for diverse effector proteins of pathogens and symbionts. Further study to elucidate how these effector proteins modify JAZ proteins could guide future efforts to develop JAZ-based modifications to counter pathogen virulence and enhance beneficial symbiosis. For example, innovative methods may be developed to disrupt the interaction between JAZs and HopZ1a/HopX1 or to block proteolytic degradation of JAZ proteins by HopZ1a/HopX1 as means of protecting plants from pathogen hijacking of the JA receptor.

Together with a recent demonstration of ABA receptor engineering against abiotic stress (50), our study illustrates that fundamental insights into the plant hormone receptors could indeed lead to innovative methods to manipulate plant hormone receptor signaling with the ultimate goal of improving plant growth and tolerance to abiotic and biotic stresses.

Materials and Methods

All experiments reported in this work were performed three or more times with similar results. For computer modeling, coordinates for JA-Ile or COR were obtained from the crystal structures of COI1–JA-Ile/COR–JAZ degron peptide complex (PDB ID codes 3OGL and 3OGK, respectively). In Y2H and in planta assays, we standardize the relative potencies of different ligands used (COR, MeJA, and JA-Ile) before a new set of experiments. Because of the limited amounts of JA-Ile available for this study, we used other forms of JA if the use of JA-Ile was not absolutely needed. For example, MeJA can be converted to JA-Ile in planta and is commonly used in the study of JA signaling (11). Therefore, we used MeJA, instead of JA-Ile, for in planta assays. However, for Y2H experiments we used JA-Ile, because JA or MeJA are not active in yeast (12, 15). Detailed procedures for gene cloning, site-directed mutagenesis, protein and RNA analyses, production of transgenic Arabidopsis, and assays for root inhibition, protein–protein interaction, disease susceptibility, and insect resistance can be found in SI Materials and Methods. See Table S3 for gene identifiers of the COI1 genes in seven plant species.

Table S3.

Gene identifiers of the COI1 genes in seven plant species

Symbol Gene ID
AtCOI1 At2g39940
BdCOI1A BRADI1G67160
BdCOI1B BRADI2G23730
BdCOI1C BRADI2G55210
SlCOI1 Solyc05g052620
PtCOI1A Potri.010G192900
PtCOI1B Potri.008G064400
PaCOI1A MA_10428988
PaCOI1B MA_108477
SmCOI1A Sm163526
SmCOI1B Sm84100
SmCOI1C Sm75487
SmCOI1D Sm11318
PpCOI1A Phypa_234563
PpCOI1B Phypa_41982
PpCOI1C Phypa_118356
PpCOI1D Phypa_171144
PpCOI1E Phypa_194100
PpCOI1F Phypa_181459

SI Materials and Methods

Computational Modeling.

Coordinates for JA-Ile or COR were obtained from the crystal structures of COI1–JA-Ile/COR–JAZ degron peptide complex (PDB ID codes 3OGL and 3OGK, respectively) and the hydrogen atoms were added using xleap module in the Ambertools. Force field parameters and charges were derived using Antechamber module and GAFF in Ambertools (53). The force field ff99SB was used to represent the molecular mechanical potential. The system consisting of COR or JA-Ile along with COI1 and part of the JAZ degron peptide were minimized in two stages using a combination of steepest descent (15,000 steps) and conjugated gradient (5,000 steps) methods (54). A strong positional restraint (20 kcal/mole) was applied on all protein and ligand heavy atoms during the first stage of minimization. The protein–ligand complex was minimized again in the second stage, without any positional restraint. In silico mutations for A86 and A384 were introduced in COI1 using Pymol (DeLano Scientific).

Gene Cloning, Site-Direct Mutagenesis, and Plasmid Construction.

The coding sequences of AtCOI1 and AtJAZ9 were amplified from total mRNA extract of Arabidopsis Col-0 leaf tissue and cloned into the pCR2.1-TOPO plasmid or pENTR-D TOPO Gateway entry vector (Life Technologies). Specific mutations were introduced into the AtCOI1 coding sequence directly through the QuickChangeII site directed mutagenesis kit (Agilent Technologies). For Y2H assays, we first converted the bait and prey vectors pGILDA and pB42AD (Clontech) Gateway cloning-compatible pGILDAattR and pB42ADattR by inserting an attR cassette (Life Technologies) into their multiple cloning sites, respectively. Next, the wild-type and mutated COI1 coding sequences in the entry vector were recombined into pGILDAattR using LR ClonaseII (Life Technologies) to generate C-terminal fusions to the LexA DNA binding domain. The JAZ9 coding sequences were recombined into pB42ADattR to generate C-terminal fusions to the B42 transcriptional activation domain.

For plant transformation, the AtCOI1 without stop codon was first cloned into pENTR4A to create pENCOI1C. Next, the native promoter of AtCOI1 (pCOI1; a genomic DNA fragment 1,807 bp upstream of the COI1 start codon) was cloned into pENCOI1C to create a pENpCOI1:COI1 entry vector. COI1A384V was introduced into this vector to create pENpCOI1:COI1A384V. Both pCOI1:COI1WT and pCOI1:COI1A384V were recombined into pGWB516 vector (containing a hygromycin resistance gene and a C-terminal 4× c-Myc epitope tag) (55) using LR ClonaseII. Confirmed constructs were introduced into Agrobacterium tumefaciens (GV3101) by electroporation.

Y2H for Protein–Protein Interaction.

Yeast EGY48 strain carrying the p8Op:LacZ reporter plasmid was cotransformed with pGilda:COI1 (or COI1 mutants) and pB42AD:JAZ9 (or other JAZs) (Clontech). Colonies were selected on SD minimal plates (BD Biosciences) supplemented with the -uracil (U)/-tryptophan (W)/-histidine (H) amino acid drop out solution (Clontech). Yeast colonies were cultured overnight in liquid SD-UWH medium, harvested, washed twice in sterile water, and adjusted OD600 to 0.2 in liquid SD galactose/raffinose-UWH medium (BD Biosciences). For Y2H on plates, 10-μL culture was spotted onto SD galactose/raffinose-UWH plates with 80 μg/mL X-gal and 10 μM COR (Sigma-Aldrich). Blue color indicated protein–protein interactions after 5–7 d 30 °C incubation. For liquid Y2H assay, cultures were supplemented with designated concentrations of JA-Ile (10 or 30 μM), COR (1 μM), or DMSO. After 16-h incubation with ligands, the liquid cultures were processed through the Beta-Glo Assay system (Promega) for detecting the β-galactosidase activity. The JA-Ile stock consists of cis- and trans-isomers, the cis-form being more active. Initial chemical analysis showed 6.8% of the cis-form after synthesis. Protein expression in yeast was detected using anti-LexA antibody (1:5,000; Upstate Biotechnology) for detection of COI1 expression from pGilda vector and anti-HA (1:5,000; Roche Life Science) antibody for detection of JAZ9 expression in pB42AD vector.

Arabidopsis Transformation and Screening.

pCOI1:COI1WT/A384V-4xc-Myc constructs were transformed into coi1-30 mutant Arabidopsis plants (56). Because homozygous coi1-30 plants are male-sterile, heterozygous plants were identified through genotyping and used for A. tumefaciens-mediated Arabidopsis transformation (57). Half-strength Murashige and Skoog (MS) medium with 50 μg/mL hygromycin were used to select transgenic T1 seedlings containing pCOI1:COI1WT/A384V-4xc-Myc transgene. Hygromycin-resistant seedlings were transplanted and genotyping was carried out to determine transgenic plants with the homozygous coi1-30 background. Further screening of T2 or T3 plants were performed for homozygous transgene. Primers used were: SALK035548_LP1, CGAATAAATCACACAGCTTATTGG, SALK035548_RP1, GATATGGTTCTTTGTACAACGACG, LBb1.3, ATTTTGCCGATTTCGGAAC, SALK035548_RP, CTGCAGTGTGTAACGATGCTC.

Protein Immunoblot Analysis.

Proteins were extracted from 10- to 12-d-old seedlings by protein extraction buffer (50 mM Tris⋅HCl, pH7.5, 150 mM NaCl, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS). Protein concentrations were measured using the RC/DC protein assay kit (Bio-Rad) with BSA as the standard (Bio-Rad). Protein samples with the same total protein concentration were used for immunoblot with rabbit polyclonal anti–c-Myc primary antibodies (1:5,000; Clontech) and goat anti-rabbit secondary antibody (1:20,000).

Coreceptor Pull-Down Assay.

Pull-down assays were performed with protein extracts from 4-mg pCOI1:COI1WT/A384V-4xc-Myc plants and 25 μg recombinant MBP-JAZ9-8xHis. Assays were performed in the presence of JA-Ile or COR at various concentrations and incubated for 30 min at 4 °C in the binding buffer (13). Eighty microliters of Ni resin (Invitrogen) were added, followed by an additional 15-min incubation period at 4 °C. MBP-JAZ9-8xHis-bound Ni resin was washed three times on microcentrifuge spin columns with 0.25 mL binding buffer at 4 °C. MBP-JAZ9-8xHis was eluted from the resin with 100 μL of 300 mM imidazole. Proteins bound to MBP-JAZ9-8xHis were analyzed by immunoblotting for the presence of COI1WT/A384V-4xc-Myc using anti-c-Myc antibody. MBP-JAZ9-8xHis recovered by the Ni affinity resin was detected by Coomassie blue staining.

RNA Isolation and qPCR Assays.

Col-0 and transgenic seeds were germinated on half-strength MS medium. Five-day-old seedlings were transferred into liquid half-strength MS medium. Segregating coi1-30 seeds were germinated on half-strength MS medium with 10 μM MeJA and MeJA-resistant 5-d-old seedlings were transferred into liquid half-strength MS medium. Next, 10 μM MeJA (Sigma), 0.2 μM COR or 0.1% DMSO were applied to 12-d-old seedlings. Samples were collected after 3 h and total RNA was extracted using Qiagen RNeasy Mini kit (Qiagen). M-MLV Reverse transcriptase (Life Technologies) and SYBR Green master mix (Life Technologies) were used for reverse-transcription and real-time PCR. Primers used were: PP2AA3_qRT_F1, GGTTACAAGACAAGGTTCACTC, PP2AA3_qRT_R1, CATTCAGGACCAAACTCTTCAG, JAZ9_qRT_F1, ATGAGGTTAACGATGATGCTG, JAZ9_qRT_R1, CTTAGCCTCCTGGAAATCTG, PR1_qRT_F1, GGCTAACTACAACTACGCTG, PR1_qRT_R1, TCTCGTTCACATAATTCCCAC, SID2_qRT_F2, ACTTACTAACCAGTCCGAAAGACGA, SID2_qRT_R2, ACAACAACTCTGTCACATATACCGT.

Root Growth Inhibition Assays.

Col-0, segregating coi1-30, transgenic COI1WT, and COI1A384V seeds were surface-sterilized, cold-stratified, and germinated on half-strength MS agar media containing MeJA, COR, or DMSO with indicated concentrations. Seedlings were grown under long-day light conditions (16-h light, 100 µE⋅m2⋅s and 8-h dark) for 10–12 d before scanning images of roots. Root lengths were measured using ImageJ software (rsbweb.nih.gov/ij/).

Bacterial Infection Assays.

The Pseudomonas syringae infection assays in Arabidopsis were performed as described previously (58). In brief, 4- to 5-wk-old (12-h light/12-h dark) Arabidopsis plants were dip-inoculated with bacterial suspension (1 × 108 cfu/mL Pst DC3000 or Psm ES4326 in 0.25 mM MgCl2 solution with 0.025% Silwet-77) or syringe-infiltrated with bacterial suspension (1 × 106 cfu/mL Pst DC3118 or DB29 in 0.25 mM MgCl2 solution). Bacterial growth was determined by serial dilutions of plant extracts 3 or 4 d after inoculation. Homozygous coi1-30 plants were selected by genotyping before bacterial infection.

Insect Feeding Assays.

Insect bioassays were performed as described previously (59). Briefly, four neonate Spodoptera exigua larvae were transferred to the center of each 6-wk-old Arabidopsis host plant, grown under 8-h light (100 μE⋅m2⋅s) and 16-h dark. Eggs of S. exigua were obtained from Benzon Research. Plants were covered with cup cages. Larval weights were determined after 9–12 d of feeding.

Acknowledgments

We thank Bethany Huot for quantitative PCR protocols and primers; Andre Velasquez and Kinya Nomura for suggestions on Pseudomonas syringae infection; and Marcelo Campos for suggestions on Spodoptera exigua feeding assays. This work is supported by the Gordon and Betty Moore Foundation Grant GBMF3037; National Institutes of Health Grant AI060761; Michigan State University AgBioResearch; and the US Department of Energy (the Chemical Sciences, Geosciences, and Biosciences Division, Office of Basic Energy Sciences, Office of Science; DE–FG02–91ER20021 for infrastructural support).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1510745112/-/DCSupplemental.

References

  • 1.Robert-Seilaniantz A, Grant M, Jones JD. Hormone crosstalk in plant disease and defense: More than just jasmonate-salicylate antagonism. Annu Rev Phytopathol. 2011;49:317–343. doi: 10.1146/annurev-phyto-073009-114447. [DOI] [PubMed] [Google Scholar]
  • 2.Thaler JS, Humphrey PT, Whiteman NK. Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci. 2012;17(5):260–270. doi: 10.1016/j.tplants.2012.02.010. [DOI] [PubMed] [Google Scholar]
  • 3.Glazebrook J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol. 2005;43:205–227. doi: 10.1146/annurev.phyto.43.040204.135923. [DOI] [PubMed] [Google Scholar]
  • 4.Xin XF, He SY. Pseudomonas syringae pv. tomato DC3000: A model pathogen for probing disease susceptibility and hormone signaling in plants. Annu Rev Phytopathol. 2013;51:473–498. doi: 10.1146/annurev-phyto-082712-102321. [DOI] [PubMed] [Google Scholar]
  • 5.Dou D, Zhou JM. Phytopathogen effectors subverting host immunity: Different foes, similar battleground. Cell Host Microbe. 2012;12(4):484–495. doi: 10.1016/j.chom.2012.09.003. [DOI] [PubMed] [Google Scholar]
  • 6.Block A, et al. The Pseudomonas syringae type III effector HopD1 suppresses effector-triggered immunity, localizes to the endoplasmic reticulum, and targets the Arabidopsis transcription factor NTL9. New Phytol. 2014;201(4):1358–1370. doi: 10.1111/nph.12626. [DOI] [PubMed] [Google Scholar]
  • 7.Fonseca S, et al. (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat Chem Biol. 2009;5(5):344–350. doi: 10.1038/nchembio.161. [DOI] [PubMed] [Google Scholar]
  • 8.Wasternack C. Jasmonates: An update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann Bot (Lond) 2007;100(4):681–697. doi: 10.1093/aob/mcm079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wasternack C, Hause B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann Bot (Lond) 2013;111(6):1021–1058. doi: 10.1093/aob/mct067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Browse J. Jasmonate passes muster: A receptor and targets for the defense hormone. Annu Rev Plant Biol. 2009;60:183–205. doi: 10.1146/annurev.arplant.043008.092007. [DOI] [PubMed] [Google Scholar]
  • 11.Staswick PE, Tiryaki I. The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell. 2004;16(8):2117–2127. doi: 10.1105/tpc.104.023549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Thines B, et al. JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature. 2007;448(7154):661–665. doi: 10.1038/nature05960. [DOI] [PubMed] [Google Scholar]
  • 13.Katsir L, Schilmiller AL, Staswick PE, He SY, Howe GA. COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc Natl Acad Sci USA. 2008;105(19):7100–7105. doi: 10.1073/pnas.0802332105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chini A, Fonseca S, Chico JM, Fernández-Calvo P, Solano R. The ZIM domain mediates homo- and heteromeric interactions between Arabidopsis JAZ proteins. Plant J. 2009;59(1):77–87. doi: 10.1111/j.1365-313X.2009.03852.x. [DOI] [PubMed] [Google Scholar]
  • 15.Melotto M, et al. A critical role of two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with the COI1 F-box protein. Plant J. 2008;55(6):979–988. doi: 10.1111/j.1365-313X.2008.03566.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yan Y, et al. A downstream mediator in the growth repression limb of the jasmonate pathway. Plant Cell. 2007;19(8):2470–2483. doi: 10.1105/tpc.107.050708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pauwels L, et al. NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature. 2010;464(7289):788–791. doi: 10.1038/nature08854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chung HS, Howe GA. A critical role for the TIFY motif in repression of jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis. Plant Cell. 2009;21(1):131–145. doi: 10.1105/tpc.108.064097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang F, et al. Structural basis of JAZ repression of MYC transcription factors in jasmonate signaling. Nature. 2015;525(7568):269–273. doi: 10.1038/nature14661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Pauwels L, Goossens A. The JAZ proteins: A crucial interface in the jasmonate signaling cascade. Plant Cell. 2011;23(9):3089–3100. doi: 10.1105/tpc.111.089300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Xu L, et al. The SCF(COI1) ubiquitin-ligase complexes are required for jasmonate response in Arabidopsis. Plant Cell. 2002;14(8):1919–1935. doi: 10.1105/tpc.003368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tsuda K, Somssich IE. Transcriptional networks in plant immunity. New Phytol. 2015;206(3):932–947. doi: 10.1111/nph.13286. [DOI] [PubMed] [Google Scholar]
  • 23.Vidhyasekaran P. Signaling and Communication in Plants 2: Plant Hormone Signaling Systems in Plant Innate Immunity. Springer; The Netherlands: 2015. Jasmonate signaling system in plant innate immunity; pp. 123–194. [Google Scholar]
  • 24.Song S, Qi T, Wasternack C, Xie D. Jasmonate signaling and crosstalk with gibberellin and ethylene. Curr Opin Plant Biol. 2014;21:112–119. doi: 10.1016/j.pbi.2014.07.005. [DOI] [PubMed] [Google Scholar]
  • 25.Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC. Hormonal modulation of plant immunity. Annu Rev Cell Dev Biol. 2012;28:489–521. doi: 10.1146/annurev-cellbio-092910-154055. [DOI] [PubMed] [Google Scholar]
  • 26.Zheng XY, et al. Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe. 2012;11(6):587–596. doi: 10.1016/j.chom.2012.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Groen SC, et al. Pathogen-triggered ethylene signaling mediates systemic-induced susceptibility to herbivory in Arabidopsis. Plant Cell. 2013;25(11):4755–4766. doi: 10.1105/tpc.113.113415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cui J, et al. Pseudomonas syringae manipulates systemic plant defenses against pathogens and herbivores. Proc Natl Acad Sci USA. 2005;102(5):1791–1796. doi: 10.1073/pnas.0409450102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Geng X, Jin L, Shimada M, Kim MG, Mackey D. The phytotoxin coronatine is a multifunctional component of the virulence armament of Pseudomonas syringae. Planta. 2014;240(6):1149–1165. doi: 10.1007/s00425-014-2151-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bender CL, Alarcón-Chaidez F, Gross DC. Pseudomonas syringae phytotoxins: Mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol Mol Biol Rev. 1999;63(2):266–292. doi: 10.1128/mmbr.63.2.266-292.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Fyans JK, Altowairish MS, Li Y, Bignell DR. Characterization of the coronatine-like phytotoxins produced by the common scab pathogen Streptomyces scabies. Mol Plant Microbe Interact. 2015;28(4):443–454. doi: 10.1094/MPMI-09-14-0255-R. [DOI] [PubMed] [Google Scholar]
  • 32.Plett JM, et al. Effector MiSSP7 of the mutualistic fungus Laccaria bicolor stabilizes the Populus JAZ6 protein and represses jasmonic acid (JA) responsive genes. Proc Natl Acad Sci USA. 2014;111(22):8299–8304. doi: 10.1073/pnas.1322671111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Jiang S, et al. Bacterial effector activates jasmonate signaling by directly targeting JAZ transcriptional repressors. PLoS Pathog. 2013;9(10):e1003715. doi: 10.1371/journal.ppat.1003715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gimenez-Ibanez S, et al. The bacterial effector HopX1 targets JAZ transcriptional repressors to activate jasmonate signaling and promote infection in Arabidopsis. PLoS Biol. 2014;12(2):e1001792. doi: 10.1371/journal.pbio.1001792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yan J, et al. The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell. 2009;21(8):2220–2236. doi: 10.1105/tpc.109.065730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sheard LB, et al. Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature. 2010;468(7322):400–405. doi: 10.1038/nature09430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Monte I, et al. Rational design of a ligand-based antagonist of jasmonate perception. Nat Chem Biol. 2014;10(8):671–676. doi: 10.1038/nchembio.1575. [DOI] [PubMed] [Google Scholar]
  • 38.Wang C, Liu Y, Li SS, Han GZ. Insights into the origin and evolution of the plant hormone signaling machinery. Plant Physiol. 2015;167(3):872–886. doi: 10.1104/pp.114.247403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stumpe M, et al. The moss Physcomitrella patens contains cyclopentenones but no jasmonates: Mutations in allene oxide cyclase lead to reduced fertility and altered sporophyte morphology. New Phytol. 2010;188(3):740–749. doi: 10.1111/j.1469-8137.2010.03406.x. [DOI] [PubMed] [Google Scholar]
  • 40.Feys B, Benedetti CE, Penfold CN, Turner JG. Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell. 1994;6(5):751–759. doi: 10.1105/tpc.6.5.751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Whalen MC, Innes RW, Bent AF, Staskawicz BJ. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell. 1991;3(1):49–59. doi: 10.1105/tpc.3.1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Dong X, Mindrinos M, Davis KR, Ausubel FM. Induction of Arabidopsis defense genes by virulent and avirulent Pseudomonas syringae strains and by a cloned avirulence gene. Plant Cell. 1991;3(1):61–72. doi: 10.1105/tpc.3.1.61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chung HS, et al. Regulation and function of Arabidopsis JASMONATE ZIM-domain genes in response to wounding and herbivory. Plant Physiol. 2008;146(3):952–964. doi: 10.1104/pp.107.115691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Brooks DM, et al. Identification and characterization of a well-defined series of coronatine biosynthetic mutants of Pseudomonas syringae pv. tomato DC3000. Mol Plant Microbe Interact. 2004;17(2):162–174. doi: 10.1094/MPMI.2004.17.2.162. [DOI] [PubMed] [Google Scholar]
  • 45.Zeng W, et al. A genetic screen reveals Arabidopsis stomatal and/or apoplastic defenses against Pseudomonas syringae pv. tomato DC3000. PLoS Pathog. 2011;7(10):e1002291. doi: 10.1371/journal.ppat.1002291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Cipollini D, Enright S, Traw MB, Bergelson J. Salicylic acid inhibits jasmonic acid-induced resistance of Arabidopsis thaliana to Spodoptera exigua. Mol Ecol. 2004;13(6):1643–1653. doi: 10.1111/j.1365-294X.2004.02161.x. [DOI] [PubMed] [Google Scholar]
  • 47.Mewis I, Appel HM, Hom A, Raina R, Schultz JC. Major signaling pathways modulate Arabidopsis glucosinolate accumulation and response to both phloem-feeding and chewing insects. Plant Physiol. 2005;138(2):1149–1162. doi: 10.1104/pp.104.053389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Qi M, Wang D, Bradley CA, Zhao Y. Genome sequence analyses of Pseudomonas savastanoi pv. glycinea and subtractive hybridization-based comparative genomics with nine pseudomonads. PLoS One. 2011;6(1):e16451. doi: 10.1371/journal.pone.0016451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bell KS, et al. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc Natl Acad Sci USA. 2004;101(30):11105–11110. doi: 10.1073/pnas.0402424101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Park SY, et al. Agrochemical control of plant water use using engineered abscisic acid receptors. Nature. 2015;520(7548):545–548. doi: 10.1038/nature14123. [DOI] [PubMed] [Google Scholar]
  • 51.Tan X, et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 2007;446(7136):640–645. doi: 10.1038/nature05731. [DOI] [PubMed] [Google Scholar]
  • 52.Santner A, Estelle M. Recent advances and emerging trends in plant hormone signalling. Nature. 2009;459(7250):1071–1078. doi: 10.1038/nature08122. [DOI] [PubMed] [Google Scholar]
  • 53.Wang J, Wang W, Kollmann P, Case D. 2001. Antechamber, An Accessory Software PackageFor Molecular Mechanical Calculation. Abstracts of Papers, 222nd National Meeting of the American Chemical Society, Chicago, IL, Aug 26–30, 2001; American Chemical Society: Washington, DC:U403.
  • 54.Case DA, et al. 2012 AMBER 12 (University of California, San Francisco). Available at ambermd.org/doc12/Amber12.pdf. Accessed October 20, 2015. [Google Scholar]
  • 55.Nakagawa S, Cuthill IC. Effect size, confidence interval and statistical significance: A practical guide for biologists. Biol Rev Camb Philos Soc. 2007;82(4):591–605. doi: 10.1111/j.1469-185X.2007.00027.x. [DOI] [PubMed] [Google Scholar]
  • 56.Yang DL, et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc Natl Acad Sci USA. 2012;109(19):E1192–E1200. doi: 10.1073/pnas.1201616109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Clough SJ, Bent AF. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16(6):735–743. doi: 10.1046/j.1365-313x.1998.00343.x. [DOI] [PubMed] [Google Scholar]
  • 58.Yao J, Withers J, He SY. Pseudomonas syringae infection assays in Arabidopsis. Methods Mol Biol. 2013;1011:63–81. doi: 10.1007/978-1-62703-414-2_6. [DOI] [PubMed] [Google Scholar]
  • 59.Herde M, Koo AJ, Howe GA. Elicitation of jasmonate-mediated defense responses by mechanical wounding and insect herbivory. Methods Mol Biol. 2013;1011:51–61. doi: 10.1007/978-1-62703-414-2_5. [DOI] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES