Skip to main content
NCBI home page
American Journal of Cancer Research logoLink to American Journal of Cancer Research
. 2015 Sep 15;5(10):3123–3134.

Highly expressed UNC119 promotes hepatocellular carcinoma cell proliferation through Wnt/β-catenin signaling and predicts a poor prognosis

Bao Lei 1, Wei Chai 1, Zhenyong Wang 1, Ruhai Liu 1
PMCID: PMC4656735  PMID: 26693064

Abstract

UNC119, also known as Retinal Protein 4 (HRG4) is significantly up-regulated in hepatocellular carcinoma (HCC) tissues. However, the clinical significance of UNC119 and its biological roles and associated mechanisms in HCC tumorigenesis remain unknown. In current study, quantitative real-time PCR, western bolt and immunohistochemical analyses were applied to evaluate the expression of UNC119 in HCC tissues and cell lines. The roles of UNC119 in cell proliferation, cell growth and cell cycle were analyzed by both loss- and gain-function assays in vitro and in vivo. Luciferase reporter assays and western blot were employed to investigate the mechanisms. We found that compared with normal liver, UNC119 is highly expressed in HCC tissues both in published GSE datasets and in our fresh or TMA tissues. We further found that highly expressed UNC119 is not only closely correlated with liver cirrhosis, tumor size and TNM stage but also predicts a poor prognosis of patients. Cellular function assays reveal that UNC119 promotes cell proliferation. In addition, it might through enhancing the activity of Wnt/β-catenin signaling to promote the progression of cell cycle and ultimate promotes cell proliferation and growth. Taken together, we found that UNC119 is commonly highly expressed HCC tissues and the expression pattern makes a difference in the prognosis of patients. Furthermore, it promotes cell proliferation and growth through Wnt/β-catenin signaling.

Keywords: Hepatocellular carcinoma, UNC119, proliferation, Wnt/β-catenin signaling

Introduction

Hepatocellular carcinoma (HCC) is the third cause of cancer-related mortality and it ranks sixth in terms of global incidence [1]. Currently, only 30%-40% of HCC patients are diagnosed in the early stage and are eligible for potential curative treatment [2]; furthermore, patients in the intermediate stages and advanced stages also could be manipulated in certain therapies such as chemoembolization and sorafenib treatment [3]. However, despite this promising breakthrough has gained, HCC patients still have dismal prognosis. Therefore, the pathological molecular mechanisms remain to be elucidated.

Recent years, Genome-wide exome sequencing and Genome-wide RNAi screening for identifying molecular alterations which contributes to HCC initiation and progression have revealed many aberrant molecular changes might accelerate HCC tumorigenesis. Schulze K et al. recently reported that they identified 161 putative driver genes which associated with 11 recurrently altered pathways and their findings not only identified risk factors specific mutational signatures but also defined related aberrant pathways, which will be useful to design target therapy for HCC patients [4]. Previously, Lars Z et al. performed an oncogenomics-based in vivo RNAi screen and identified 12 tumor suppressors in liver cancer and those genes including XPO4, DDX20, GJD4, NRSN2 and so on [5] and subsequently, Jianchuan X et al. validated that NRSN2 is down-regulated in HCC tissues and might be a tumor suppressor [6].

Dafang W et al. performed a large-scale cDNA transfection screening for genes related to cancer development and progression in 2004 [7]. They found that 3806 cDNA species possess the ability could affects cancer cell growth. However, large amount of those genes were still lack of reports to date. Among those genes we found that UNC119 could promote cell growth and the fold change was 19 compared with control. While the detailed biological functions, mechanisms and clinical significance in HCC still unknown.

UNC119, also known as HRG4, is specifically expressed in the photoreceptors in the retina and is required for G protein trafficking in sensory neurons [8-10]. It has been reported that as an activator of SRC-type tyrosine kinases is essential for T cell activation and could regulate myofibroblast differentiation [11-13]. In current study, we not only identified the clinical significance of UNC119 but also investigated its biological functions and associated mechanisms in HCC.

Materials and methods

Ethic statement

18 fresh tumor tissues and matched adjacent tissues were collected from patients with pathologically and clinically confirmed HCC. All human tumor tissues were obtained with written informed consent from patients. The Institutional Review Board of Cangzhou Central Hospital approved the use of the tumor sample and animal in this study. Commercial HCC tissue microarray (TMA, HLiv-HCC180Sur-04), which containing 90 malignant tissues and paired adjacent normal tissues was purchased from Shanghai Outdo Biotech CO., LTD, All procedures of animal experiments were performed in accordance with The Animal Care and Use Committee of Cangzhou Central Hospital.

Cell culture

Hep3B, SK-Hep1 and HUH7 cells were purchased from ATCC, SMMC-7721, MHCC-97H and MHCC-LM3 were obtained from Cell Bank of the Chinese Academy of Sciences. All of those cells were maintained under standard culture conditions (37°C, 5% CO2) in culture medium recommended by ATCC or Cell Bank of the Chinese Academy of Sciences. Wnt/β-catenin signaling inhibitor IWR-1-endo was purchased from selleck (Selleck Chemicals, USA) and dissolved with sterile water to indicated concentration.

RNA isolation and quantitative real-time PCR

Total RNA was purified from HCC and adjacent tissues or cells using TRIzol (Invitrogen) following the manufacturer’s protocol. RNA (1 μg) was reverse transcribed using SuperScript Reverse Transcriptase III (Invitrogen). Quantitative real time PCR was performed using SYBR green Supermix (ABI) in ABI 7500 PCR system. Housekeeping gene GAPDH was used as aan internal standard. Primers using in this study were described in Table 1.

Table 1.

Sequence of primers and sh RNAs

Name Sequence (5’-3’)
UNC119 primer F: GAGGACGTGCTGGGGCT
R: CTGAGTCCATGTCCCGAATC
GAPDH primer F: AGCCTCAAGATCATCAGCAATGCC
R: TGTGGTCATGAGTCCTTCCACGAT
CCND1 primer F: TCCTCTCCAAAATGCCAGAG
R: GGCGGATTGGAAATGAACTT
CCNE1 primer F: GAAATGGCCAAAATCGACAG
R: TCTTTGTCAGGTGTGGGGA
Sh-#1 CCGGGATGCACAATAAAGCAGACTACTCGAGTAGTCTGCTTTATTGTGCATCTTTTTTG
Sh-#2 CCGGGATCGACTTTGTCAGGTTTAACTCGAGTTAAACCTGACAAAGTCGATCTTTTTTG
Open in a new tab

Western blots

Cells were lysed in WB/IP lysis buffer (P0013, Beyotime) and nuclear proteins were extracted using lysis buffer (P0028, Beyotime), all the procedures were following the manufacturer’s protocol. Subsequently the cell lysates were boiled in 5X SDS-PAGE loading buffer for 10 min and then resolved by 8% SDS-PAGE and transferred to nitrocellulose membrane. The following antibodies were used in this study: UNC119 (GeneTex), GAPDH (Proteintech), β-catenin (Proteintech). Bound antibodies were visualized with the ECL kit (Thermo Scientific).

Construct stable cell lines

To generate stable silenced UNC119 cell lines, Vectors containing shRNAs were purchased from Sigma-Aldrich. To over-express UNC119, vectors containing the ORF of UNC119 were obtained from Genecopoeia. We transfected those vectors to 293T cells with lipofectamine 2000 (Invitrogen) and all the procedures were following the manufacture’s protocol. The supernatant media containing virus was collected by centrifugation to remove cellular contaminant. The resulting viruses were used to infect indicated cells, and then integrated cells were selected by 2 μg/ml puromycin for 2 weeks. The alterations of UNC119 in those cells were confirmed by western blots before further analysis. The sequence of sh RNAs were described in Table 2.

Table 2.

Correlations between UNC119 and key clinicopathological parameters

Variable UNC119 (n=91)
Low High P value
Age ≤50 years 14 31 0.423
>50 years 18 28
Gender Female 2 4 0.923
Male 30 55
Liver Cirrhosis Yes 25 55 0.035*
no 7 4
Tumor size ≤5 cm 24 30 0.028*
>5 cm 8 29
Local infiltration yes 2 3 0.816
no 30 56
TNM stage T1 6 6 0.042*
T2 14 14
T3-T4 9 43
Open in a new tab
*

P<0.05.

CCK8 cell viability assays

Cells were seeded into a 96-well plate at 3×103 cells per well with 100 ul cultured medium and cultured at 37°C, 5% CO2. The cell viability was quantified by addition 10 μl of cell counting kit (CCK8, Dojindo). After 1.5 hours incubation, the plates were monitored by Power Wave XS microplate reader (BIO-TEK) at an absorbance 450 nm.

Colony formation assays

Colony formation in soft agar was tested to assay anchorage-independent growth. Stable transfected cell lines were suspended in the upper layer which consisting of culture medium with 1% FBS and 0.35% agar, which is above a basal layer of 0.6% agar in 6-well plates in a triplicate manner. The cell density was 2,500 cells per well. Colonies were stained with 0.05% crystal violet, and all the visible colonies were counted by microscopy after 21-28 days.

Flow cytometry cell cycle assays

The indicated cells (20×104/well) were seeded in the 6-well plates. Then these cells were collected at 12 h, 24 h and 36 h. Cells were washed twice with 1× PBS, then re-suspended and fixed in 2 ml 70% ethanol at -20°C. Cells were then stained with PI (BD) and followed as the manufacture’s protocol.

In vivo tumor formation assay

100×104 stable SMMC-7721 and Hep3B cells and control were subcutaneously injected into right flank of 5 BALB/c (nu/nu) mice in each group. Tumor sizes were measured once a week and mice were sacrificed for the analysis of tumor burden after 4 weeks.

Luciferase reporter assays

Indicated cells were seeded in 96-well plates and transfected with TCF/β-catenin reporter plasmid (Wnt/β-catenin signaling) and 10 ng Renilla following the recommended protocol for the Lipofectamine 2000 transfection system. After 48 hours incubation, firefly and Renilla luciferase activities were measured using the dual-luciferase reporter assay system (Promega, Madison, WI) from the cell lysates.

Statistics analysis

Data are expressed as the mean ± standard deviation. The correlation between UNC119 expression and the clinicopathological parameters was evaluated using the χ2 test by SPSS sofe ware. Two tail student’s t-test was used for comparisons between control and test groups and P<0.05 was considered statistically significant difference.

Results

The level of UNC119 was significantly upregulated in HCC

We retrieved the expression of UNC119 Oncomine Database. Surprisingly, we found that UNC119 expression was significantly upregulated in HCC tissues compared with normal liver in different datasets. As illustrated in Figure 1, in Chen liver dataset, the mRNA level was remarkably elevated in 103 HCC tissues compared in 75 normal liver, P=0.03. Convincingly, the similarity results were found in two Roessler liver datasets and Wurmbach liver dataset, and p values were 0.001, 2.20E-8 and 0.013, respectively. This observation highlighted a potential role of UNC119 in the initiation or progression of HCC.

Figure 1.

Figure 1

Open in a new tab

mRNA level of UNC119 is highly expressed in different cohorts of HCC patients. (A) The mRNA level of UNC119 is elevated in the HCC cohort compared with normal liver, and the detailed results were published by Chen in 2002. (B, C) The mRNA level of UNC119 was significantly increased in two cohorts of HCC patients compared with normal liver, and the detailed information was published by Roessler in 2010 and the same result was observed in another cohort of HCC patients, which was published by Wurmbach in 2007 (D).

To confirm the above findings, we performed quantitative real-time PCR assays to analyze the expression of UNC119 in 18 matched HCC tissues and adjacent tissues. As shown in Figure 2A, the mRNA levels of UNC119 were significantly increased in malignant tissues compared with the paired normal tissues.

Figure 2.

Figure 2

Open in a new tab

UNC119 is highly expressed in HCC tissues. A. The mRNA level of UNC119 is significantly elevated in 18 HCC patients. B. The protein level of UNC119 is heightened in HCC tissues. C. Image illustrates the percentage of UNC119 levels in TMA. D. Highly expressed UNC119 predicts poor prognosis of HCC patients. E. The mRNA level of UNC119 in 6 HCC cell lines. The levels were normalized to GAPDH. F. The protein level of UNC119 in 6 HCC cell lines.

To indentify the protein level of UNC119 changed in HCC tissues, we performed IHC assays to analyze the expression of UNC119 in a commercial TMA which containing 91 cases of HCC and paired adjacent tissues. The analysis from two independently experienced pathologists revealed that the protein level of UNC119 was more commonly upregulated in HCC tissues compared with counterparts, as shown in Figure 2B and 2C. UNC119 was elevated in 58 (64.53%) cases. We then analyzed the correlation between the levels of UNC119 and the clinicopathological parameters and found that highly expressed UNC119 was significantly associated with liver cirrhosis (P=0.035), tumor size (P=0.028) and TNM stage (P=0.042) as shown in Table 2. Furthermore, Kaplan-Meier survival analysis revealed that the positive expression of UNC119 indicates a poor prognosis of HCC patients (P=0.036), as show in Figure 2D.

These results suggested that both mRNA and protein levels of UNC119 were elevated in HCC patients and might play a role in HCC initiation or tumor growth. In addition, the highly expressed UNC119 predicts a worse prognosis of patients. We then performed cell function assays to investigate the biological functions of UNC119 in vitro and in vivo.

UNC119 contributes to accelerate proliferation and growth of HCC cells in vitro

To get insight into the biological function roles of UNC119 in tumorigenesis, firstly, we performed in vitro proliferation assays using HCC cell lines. As presented in Figure 2E and 2F, both quantitative real-time PCR and western blot assays revealed that UNC119 was relatively abundant in Hep3B and MHCC-LM3 cell lines, while lowly in SMMC-7721 and SK-Hep1 cells. We then stably silenced UNC119 in Hep3B and MHCC-LM3 cell lines, overexpressed the full-length of UNC119 in SMMC-7721 and SK-Hep1 cells. As illustrated in Figures 3A, 3B, 4A and 4B, the expression of UNC119 was significantly altered when transfected with indicated factors.

Figure 3.

Figure 3

Open in a new tab

Knockdown of UNC119 in HCC cells inhibits cell proliferation. (A, B) The protein level of UNC119 was reduced remarkably in Hep3B (A) and MHCC-LM3 (B) after silencing. (C, D) Silencing UNC119 inhibits cell viability significantly both in Hep3B (C) and MHCC-LM3 (D) cells. (E, F) Knockdown of UNC119 inhibits the formation of cellular clones on the soft agar both in Hep3B and MHCC-LM3 cells (E), and statistics were illustrated in (F). (G, H) Flow cytometry illustrates that silencing UNC119 the cell cycle was arrested in G0/G1 stage both in Hep3B and MHCC-LM3 cells. *P<0.05, **P<0.01. Data presented here are representative of three to five independent experiments.

Figure 4.

Figure 4

Open in a new tab

Elevating the expression of UNC119 promotes cell proliferation. (A, B) The protein level of UNC119 was significantly elevated both in SMMC-7721 (A) and SK-Hep1 cells (B) after over-expressing. (C, D) The cell viability was significantly elevated both in SMMC-7721 (C) and SK-Hep1 (D) cells when UNC119 was over-expressed. (E, F) Over-expressing UNC119 elevates the ability of forming the cellular clones on soft agar both in SMMC-7721 and SK-Hep1 cells (E) and statistics were presented in (F). (G, H) Flow cytometry shows that when over-expressing of UNC119, the cells were more commonly distributed in S and G2/M stage. *P<0.05, **P<0.01. Data are representative of three to five independent experiments.

As shown in Figure 3C, 3D, when silencing UNC119, the cell viability was remarkably decreased in Hep3B and MHCC-LM3 cells. Convincingly, when heightening the level of UNC119 in SMMC-7721 and SK-Hep1 cells, the viability of cells was significantly elevated in these two cell lines, as shown in Figure 4C and 4D.

Furthermore, we also performed Anchorage-independent growth assay in these transfected cell lines, as presented in Figure 3E and 3F, we found that when silenced UNC119 the ability of clone formation in Hep3B and MHCC-LM3 cell lines was significantly inhibited. Moreover, the effect was totally reversed in SMMC-7721 and SK-Hep1 cell lines which were over-expressed UNC119, as shown in Figure 4E and 4F.

To extend these findings, we next examined whether UNC119 through modulating the process of cell cycle to regulate cell proliferation. We performed cell cycle assays by PI staining and detected by flow cytometry. Interestingly, we found that when knockdown UNC119, the cell cycle was arrested in the G0/G1 stage (Figure 3G, 3H), and the arrestation was removed and cells were mainly distributed in S and G2/M stage when heightening the level of UNC119 in SMMC-7721 and SK-Hep1 (Figure 4G, 4H). These results suggested that UNC119 through modulates the G1/S stage transition to regulate cell proliferation.

Stably silencing UNC119 inhibits tumor growth in vivo

Next, we examined the in vivo roles of UNC119 in HCC development. We selected stable transfected SMMC-7721 and Hep3B cells to perform in vivo tumor formation assay. Cells were injected subcutaneously in nude mice and tumor growth was monitored. As illustrated in Figure 5A, tumors formed from SMMC-7721 cells which were over-expressed UNC119, the tumor size was significantly larger than control group. And tumors from Hep3B which were knockdown UNC119, the tumor size was significantly smaller than negative control group. Furthermore, both the tumor growth speed and tumor weight were also positively correlated with the level of UNC119 (Figure 5B, 5C). Convincingly, we found that Proliferating Cell Nuclear Antigen (PCNA), which is a marker of active proliferate cells, was significantly lower expressed in silenced group compared with negative control group in Hep3B (Figure 5D).

Figure 5.

Figure 5

Open in a new tab

UNC119 promotes HCC cell growth in vivo. A. Image show that UNC119-silencing group shows relatively smaller tumors formed compared with control group. B. Tumor growth curve reveals that tumors were grown slower and smaller in UNC119-silencing group compared to control group. C. Image show that tumors formed by UNC119 silencing group, the tumor weight were lighter compared with control group. D. IHC staining of UNC119 and PCNA in these two group tumors suggest that cells were relative lowly active proliferation when UNC119 silencing.

UNC119 influences the distribution of β-catenin

As we known, cyclins, which are dispensable during cell cycle transition [14]. Especially, CCND1 and CCNE1 which are required in G1/S transition were observed highly expressed in many tumors [15-19]. In current study, we examined whether UNC119 affects the expression of these two cyclins. And we found that inhibiting the expression of UNC119, concomitantly, the mRNA level of CCND1 and CCNE1 was attenuated in stable knockdown Hep3B cells (Figure 6A). Confidently, the effects of UNC119 in these two cyclins were totally reversed in SMMC-7721 overexpressed cell (Figure 6B). These results confirmed that UNC119 through modulating the level of CCND1 and CCNE1 to regulate cell proliferation.

Figure 6.

Figure 6

Open in a new tab

UNC119 influences the activity of Wnt/β-catenin signaling. (A, B) The expression of CCND1 and CCNE1 were remarkably reduced (A) or elevated (B), when UNC119 silencing in Hep3B or over-expressing in SMMC-7721 cells. Normalized to GAPDH. (C, D) Luciferase reporter assays reveal that Wnt/β-catenin signaling was inhibited when UNC119 were silenced in Hep3B (C), while it was elevated when UNC119 was heighted in SK-Hep1 (D). (E) The level of nuclear β-catenin was reduced when UNC119 silenced in Hep3B and while it was increased in SK-Hep1 when UNC119 over-expressed, lamin A/C and GAPDH were used as loading control. *P<0.05 **P<0.01. Data are representative of three to five independent experiments. (F) β-catenin inhibitor IWR-1-endo significantly inhibits SK-Hep1 proliferation.

To investigate the mechanism underlying the effects that UNC119 affects the expression of these cyclins. As we known, Wnt canonical signaling plays an essential role in cancer cell growth; in addition, CCND1 is a confirmed target gene of Wnt/β-catenin [20]. Therefore, we next performed Luciferase reporter assays to examine whether UNC119 influence the activity of Wnt/β-catenin signaling. Encouragingly, the results from Hep3B stable cell lines indicate that silencing UNC119 results in reducing the activity of Wnt/β-catenin signaling (Figure 6C). In agreement with results from Hep3B, the reversed effects were observed from stable SK-Hep1 cells, when elevated the expression of UNC119, the activity of Wnt/β-catenin were increased (Figure 6D). Next, we further detected the β-catenin in Hep3B and SK-Hep1 stable cells, and we found that the level of nucleus β-catenin was decreased when UNC119 silenced in Hep3B, while, the level of nucleus β-catenin was increased in SK-Hep1 which UNC119 elevated.

We further used IWR-1-endo, which is an inhibitor of Wnt/β-catenin signaling by stabilizing the Axin destruction complex [21] to promote β-catenin degradation, performed cell viability assays in stable SK-Hep1 cells. As shown in Figure 6F, when treated with IWR-1-endo, the cell viability were significantly decreased in control group compared with over-expressing group.

These results reveal that UNC119 through regulating β-catenin in to the nucleus to regulate the expression of CCND1 to promotes cell proliferation and tumor growth.

Discussion

As we known, HCC is a prevalent and highly aggressive malignancy worldwide and its clinical outcome remains challenging [22], therefore a better understanding of underlying molecular mechanisms is highly desirable. Tumor initiation is resulted in uncontrolled cell proliferation [23], and it is widely accepted that the alterations, including genetic and epigenetic alterations, contribute to this malignant feature [24]. Previously, Dafang W. et al. reported that a large cohort genes could contribute to cell growth [7], among then we found that UNC119 is stand out for its robust effects in promoting cell growth. However, the clinical significance and detailed roles and mechanisms remain to be elucidated in HCC.

In current study, we firstly screened the published GSE datasets, and found that UNC119 is highly expressed in four cohorts of HCC patients’ malignant tissues compared with normal liver tissues. These results remind us that UNC119 is commonly up-regulated in HCC tissues and must play a role in HCC tumorigenesis. Furthermore, we demonstrated that UNC119 is significantly up-regulated in HCC tissues and over-expression is closely correlated with liver Cirrhosis, tumor size and TNM stage. These clinical significances suggested that UNC119 involved in HCC initiation and tumor growth. In addition, Kaplan-Meier analysis reveals that the highly expression of UNC119 is closely associated with poor prognosis; these results indicate that UNC119 is implicated in the progression of HCC.

Both loss- and gain- function cellular function assays revealed that UNC119 could promotes HCC cell proliferation and growth, furthermore, in vivo tumor formation assays validated these findings. As we known, aberrant cell cycle progression contributes to uncontrolled cell proliferation [23]. Cancer cells employed many ways, such as mutation of tumor suppressor p53 and PTEN or aberrant overexpression of cyclins, to over cell cycle checkpoints to promote cell proliferation [25-27]. In current study, we found that the expression of CCND1 and CCNE1 is concomitantly altered with the alteration of UNC119; this finding suggested that UNC119 might partly through modulating cyclins to promote cell proliferation.

As we known, abnormal activation of Wnt/β-catenin signaling was observed in numerous solid tumors, including HCC [28,29]. And CCND1 is a downstream target gene of Wnt/β-catenin signaling [20]. In current study, we found that the activity of Wnt/β-catenin signaling is positively correlated with the level change of UNC119. Additionally, we found that the level of nucleus β-catenin, which functions as a transcription factor to target downstream genes in nucleus [30], was subsequently changed when the level of UNC119 is changed. These findings suggested that elevated UNC119 could in some way to promoteβ-catenin enter nucleus, to regulate the expression of CCND1 and ultimate promotes cell proliferation and growth. While, Wnt/β-catenin signaling obtains a centre role in the Physiological process of cell and it also could target many other oncogenes, like c-myc, TCF-1 and MMP7 [31], all of these genes could contribute to tumor progression.

In conclusion, we first report the clinical significance of UNC119 in HCC patients, furthermore, we found that UNC119 through promoting β-catenin enter nucleus to promote cell proliferation and growth.

Acknowledgements

We are grateful to our lab members for their assistance with the experiments and constructive comments on the manuscript. This manuscript was supported by the research funding of Department of General Surgery, Cangzhou Central Hospital.

Disclosure of conflict of interest

None.

References

  • 1.Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64:9–29. doi: 10.3322/caac.21208. [DOI] [PubMed] [Google Scholar]
  • 2.Llovet JM, Burroughs A, Bruix J. Hepatocellular carcinoma. Lancet. 2003;362:1907–1917. doi: 10.1016/S0140-6736(03)14964-1. [DOI] [PubMed] [Google Scholar]
  • 3.Llovet JM, Bruix J. Molecular targeted therapies in hepatocellular carcinoma. Hepatology. 2008;48:1312–1327. doi: 10.1002/hep.22506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Schulze K, Imbeaud S, Letouze E, Alexandrov LB. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat Genet. 2015;47:505–511. doi: 10.1038/ng.3252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zender L, Xue W, Zuber J, Semighini CP, Krasnitz A, Ma B, Zender P, Kubicka S, Luk JM, Schirmacher P. An oncogenomics-based in vivo RNAi screen identifies tumor suppressors in liver cancer. Cell. 2008;135:852–864. doi: 10.1016/j.cell.2008.09.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ma HQ, Liang XT, Zhao JJ, Wang H, Sun JC, Chen YB, Pan K, Xia JC. Decreased expression of Neurensin-2 correlates with poor prognosis in hepatocellular carcinoma. World J Gastroenterol. 2009;15:4844. doi: 10.3748/wjg.15.4844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wan D, Gong Y, Qin W, Zhang P, Li J, Wei L, Zhou X, Li H, Qiu X, Zhong F. Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci U S A. 2004;101:15724–15729. doi: 10.1073/pnas.0404089101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Higashide T, Inana G. Characterization of the gene for HRG4 (UNC119), a novel photoreceptor synaptic protein homologous to unc-119. Genomics. 1999;57:446–450. doi: 10.1006/geno.1999.5791. [DOI] [PubMed] [Google Scholar]
  • 9.Swanson DA, Chang JT, Campochiaro PA, Zack DJ, Valle D. Mammalian orthologs of C. elegans unc-119 highly expressed in photoreceptors. Invest Ophthalmol Vis Sci. 1998;39:2085–2094. [PubMed] [Google Scholar]
  • 10.Zhang H, Constantine R, Vorobiev S, Chen Y, Seetharaman J, Huang YJ, Xiao R, Montelione GT, Gerstner CD, Davis MW, Inana G, Whitby FG, Jorgensen EM, Hill CP, Tong L, Baehr W. UNC119 is required for G protein trafficking in sensory neurons. Nat Neurosci. 2011;14:874–880. doi: 10.1038/nn.2835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gorska MM, Stafford SJ, Cen O, Sur S, Alam R. Unc119, a novel activator of Lck/Fyn, is essential for T cell activation. J Exp Med. 2004;199:369–379. doi: 10.1084/jem.20030589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Vepachedu R, Gorska MM, Singhania N, Cosgrove GP, Brown KK, Alam R. Unc119 regulates myofibroblast differentiation through the activation of Fyn and the p38 MAPK pathway. J Immunol. 2007;179:682–690. doi: 10.4049/jimmunol.179.1.682. [DOI] [PubMed] [Google Scholar]
  • 13.Cen O, Gorska MM, Stafford SJ, Sur S, Alam R. Identification of UNC119 as a novel activator of SRC-type tyrosine kinases. J Biol Chem. 2003;278:8837–8845. doi: 10.1074/jbc.M208261200. [DOI] [PubMed] [Google Scholar]
  • 14.Sherr CJ. Cancer cell cycles. Science. 1996;274:1672–1677. doi: 10.1126/science.274.5293.1672. [DOI] [PubMed] [Google Scholar]
  • 15.Bellacosa A, Almadori G, Cavallo S, Cadoni G, Galli J, Ferrandina G, Scambia G, Neri G. Cyclin D1 gene amplification in human laryngeal squamous cell carcinomas: prognostic significance and clinical implications. Clin Cancer Res. 1996;2:175–180. [PubMed] [Google Scholar]
  • 16.Mineta H, Miura K, Takebayashi S, Ueda Y, Misawa K, Harada H, Wennerberg J, Dictor M. Cyclin D1 overexpression correlates with poor prognosis in patients with tongue squamous cell carcinoma. Oral Oncol. 2000;36:194–198. doi: 10.1016/s1368-8375(99)00078-0. [DOI] [PubMed] [Google Scholar]
  • 17.Hosokawa Y, Arnold A. Mechanism of cyclin D1 (CCND1, PRAD1) overexpression in human cancer cells: Analysis of allele-specific expression. Genes Chromosomes Cancer. 1998;22:66–71. doi: 10.1002/(sici)1098-2264(199805)22:1<66::aid-gcc9>3.0.co;2-5. [DOI] [PubMed] [Google Scholar]
  • 18.Nakayama N, Nakayama K, Shamima Y, Ishikawa M, Katagiri A, Iida K, Miyazaki K. Gene amplification CCNE1 is related to poor survival and potential therapeutic target in ovarian cancer. Cancer. 2010;116:2621–2634. doi: 10.1002/cncr.24987. [DOI] [PubMed] [Google Scholar]
  • 19.Etemadmoghadam D, Weir BA, Au-Yeung G, Alsop K, Mitchell G, George J Australian Ovarian Cancer Study Group. Davis S, D’Andrea AD, Simpson K, Hahn WC, Bowtell DD. Synthetic lethality between CCNE1 amplification and loss of BRCA1. Proc Natl Acad Sci U S A. 2013;110:19489–94. doi: 10.1073/pnas.1314302110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Katoh M, Katoh M. WNT signaling pathway and stem cell signaling network. Clin Cancer Res. 2007;13:4042–4045. doi: 10.1158/1078-0432.CCR-06-2316. [DOI] [PubMed] [Google Scholar]
  • 21.Lu J, Ma Z, Hsieh JC, Fan CW, Chen B, Longgood JC, Williams NS, Amatruda JF, Lum L, Chen C. Structure/Activity Relationship Studies of Small-Molecule Inhibitors of Wnt Response. Bioorg Med Chem Lett. 2009;19:3825–3827. doi: 10.1016/j.bmcl.2009.04.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Thorgeirsson SS, Grisham JW. Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 2002;31:339–346. doi: 10.1038/ng0802-339. [DOI] [PubMed] [Google Scholar]
  • 23.Evan GI, Vousden KH. Proliferation, cell cycle and apoptosis in cancer. Nature. 2001;411:342–348. doi: 10.1038/35077213. [DOI] [PubMed] [Google Scholar]
  • 24.Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646–674. doi: 10.1016/j.cell.2011.02.013. [DOI] [PubMed] [Google Scholar]
  • 25.Greenblatt M, Bennett W, Hollstein M, Harris C. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res. 1994;54:4855–4878. [PubMed] [Google Scholar]
  • 26.Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 1997;275:1943–7. doi: 10.1126/science.275.5308.1943. [DOI] [PubMed] [Google Scholar]
  • 27.Keyomarsi K, Pardee AB. Redundant cyclin overexpression and gene amplification in breast cancer cells. Proc Natl Acad Sci U S A. 1993;90:1112–6. doi: 10.1073/pnas.90.3.1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Clevers H. Wnt/β-catenin signaling in development and disease. Cell. 2006;127:469–480. doi: 10.1016/j.cell.2006.10.018. [DOI] [PubMed] [Google Scholar]
  • 29.Wands JR, Kim M. WNT/β-catenin signaling and hepatocellular carcinoma. Hepatology. 2014;60:452–454. doi: 10.1002/hep.27081. [DOI] [PubMed] [Google Scholar]
  • 30.Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils of Wnt signaling through β-catenin. Science. 2002;296:1644–1646. doi: 10.1126/science.1071549. [DOI] [PubMed] [Google Scholar]
  • 31.Luo J, Chen J, Deng ZL, Luo X, Song WX, Sharff KA, Tang N, Haydon RC, Luu HH, He TC. Wnt signaling and human diseases: what are the therapeutic implications? Lab Invest. 2007;87:97–103. doi: 10.1038/labinvest.3700509. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Cancer Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES