Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2015 Nov 24;5:17215. doi: 10.1038/srep17215

MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence

Yu Liu 1,2,*, Jiannan Feng 1,2,*, Qiang Lu 1, Xin Zhang 3, Yaping Gao 1,2, Jun Yan 1,2, Chunhua Mu 1, Yan Hei 4, Ming Lv 1,2, Gencheng Han 1,2, Guojiang Chen 1,2, Peng Jin 1, Weiguo Hu 3, Beifen Shen 1,2, Guang Yang 1,2,a
PMCID: PMC4657049  PMID: 26599734

Abstract

Staphylococcus aureus causes a wide range of infectious diseases. Treatment of these infections has become increasingly difficult due to the widespread emergence of antibiotic-resistant strains; therefore, it is essential to explore effective alternatives to antibiotics. A secreted protein of S. aureus, known as eLtaS, is an extracellular protein released from the bacterial membrane protein, LtaS. However, the role of eLtaS in S. aureus pathogenesis remains largely unknown. Here we show eLtaS dramatically aggravates S. aureus infection by binding to C3b and then inhibiting the phagocytosis of C3b-deposited S. aureus. Furthermore, we developed a monoclonal antibody against eLtaS, MAE4, which neutralizes the activity of eLtaS and blocks staphylococcal evasion of phagocytosis. Consequently, MAE4 is capable of protecting mice from lethal S. aureus infection. Our findings reveal that targeting of eLtaS by MAE4 is a potential therapeutic strategy for the treatment of infectious diseases caused by S. aureus.


Staphylococcus aureus is a major human pathogen that causes a wide range of illnesses, ranging from mild skin infections to bacteremia, sepsis, and endocarditis1,2,3,4,5. Treatment of S. aureus infections has become increasingly difficult because of the prevalence of antibiotic-resistant strains such as methicillin-resistant S. aureus (MRSA) strains6,7,8. To combat the rapid emergence of antibiotic-resistant strains, several alternative therapeutic options are being explored, including the development of inhibitors of virulence factors, such as α-hemolysin, Protein A, and AgrA9,10,11. AR-301, the human monoclonal antibody directed against secreted α-hemolysin, has been approved for a clinical trial in Europe to treat intensive care unit patients with severe S. aureus pneumonia infections12.

A membrane-embedded enzyme known as LtaS, which contains five N-terminal transmembrane helices followed by a large extracellular domain (eLtaS), is required for S. aureus growth and synthesis of lipoteichoic acid (LTA)13,14,15,16. Richter et al. previously identified a small molecule inhibitor of LtaS that reduced the severity of infections by inhibiting S. aureus growth16. It has been established that LtaS protein is processed during bacterial growth and that the extracellular domain is released following hydrolysis of residues Ala215-Leu216-Ala217 by the peptidase SpsB15. However, no LTA synthase activity has been identified within the eLtaS domain and its function is still unclear15.

In the present study, we demonstrated that eLtaS mediates phagocytic evasion of S. aureus via binding to the complement component C3b. Furthermore, we have developed a neutralizing monoclonal antibody against eLtaS that blocks eLtaS-mediated evasion of phagocytosis and consequently protects mice from S. aureus infection.

Results

eLtaS aggravates S. aureus infection

Previously, we reported that the supernatant of a S. aureus RNase III mutant strain (Δrnc) contained reduced levels of most proteins17. However, the extracellular proteins of Δrnc were more effective at blocking complement-mediated red blood cell lysis than those of its parent strain, S. aureus 8325-4 (Fig. S1a,b). To identify the proteins involved in blocking sheep red blood cell lysis mediated by complement system, we compared the extracellular protein profiles of Δrnc with those of S. aureus 8325-4. As shown in Fig. S2a,b, two proteins, LytM and eLtaS, were present at higher levels in the supernatants of Δrnc strain than in the supernatants of the S. aureus 8325-4 strain, as determined by mass spectrometry. Similar results were obtained by western blotting (Fig. S2c). We then examined the effect of both LytM and eLtaS on complement-mediated red blood cell lysis and found that eLtaS, but not LytM, was responsible for this effect (Fig. 1a and S2d).

Figure 1. eLtaS aggravates S. aureus infection.

Figure 1

(a) eLtaS inhibits the hemolysis of red blood cells (RBCs) in a concentration-dependent manner. Opsonized sheep erythrocytes (2 × 107) were incubated with 25% pre-cleared normal human serum in the presence of eLtaS at the concentrations indicated for 30 min at 37 °C. The samples were centrifuged, and the absorbance of the supernatants was measured at 405 nm. (b–d) eLtaS inhibits C5b-9 formation via the classic (2% serum; (b)), lectin (10% serum; (c)), and alternative (20% serum; (d)) pathways in a concentration-dependent manner. Serum samples were pre-incubated with eLtaS at the concentrations indicated. The serum and eLtaS mixture was added to plates coated with fibrinogen immune complex (classic pathway), immobilized mannan (lectin pathway), or LPS (alternative pathway). The formation of C5b-9 was detected using an anti-C5b-9 antibody. Data are presented as the mean ± SD. e-g. Survival rate of mice challenged with different S. aureus strains in the acute peritoneal infection model. S. aureus 8325-4 (5 × 108 cfu/mouse), ΔltaS (2 × 109 cfu/mouse) or ΔltaSR (5 × 108 cfu/mouse) was injected into the peritoneal cavity of CD-1 mice (e). CD-1 mice were intraperitoneally injected with ΔltaS (2 × 109 cfu/mouse) in the presence of eLtaS (f). S. aureus 8325-4 (2 × 108 cfu/mouse) was injected in the presence of eLtaS (g). The survival rate was calculated at different time points post challenge. Data are presented as percentages of surviving mice (n = 8). Survival curves were determined using the Kaplan-Meier method and compared using the log-rank test. (h–j) Determination of the role of eLtaS in a sublethal murine pneumonia infection model. CD-1 mice were infected with S. aureus 8325-4 cells (1 × 107 cfu/mouse) intratracheally in the presence of eLtaS protein. Lung sections were obtained at 72 h post challenge and stained with hematoxylin-eosin (h). Weight loss was monitored for 72 h post infection (i). Lung bacterial burdens were determined at 24 h after challenge (j).

The complement system is a family of proteins and proteolytic fragments with multiple roles in both innate and acquired immunity, including direct killing of foreign cells and regulation of other effectors of the immune response18,19. The complement system can be activated by three separate pathways: the classical pathway (CP), alternative pathway (AP), and lectin pathway (LP)20. Formation of the membrane attack complex (MAC; C5b-9) is common to all three complement pathways21. We examined the effect of eLtaS on the formation of C5b-9 according to the methods described by Jongerius et al.22 and demonstrated that eLtaS inhibited C5b-9 formation in all three pathways (Fig. 1b-d).

Given the importance of the complement system in host protection from pathogens, we then considered whether eLtaS could aggravate S. aureus infection. The gene encoding LtaS was deleted from the S. aureus 8325-4 genome to generate an ltaS-null strain (ΔltaS). The effect of the mutant strain was evaluated in a murine model of acute peritoneal infection. S. aureus 8325-4 or ΔltaS cells were injected into the peritoneal cavity of CD-1 mice, and the survival of the mice was recorded over 48 h. Injection of wild-type S. aureus 8325-4 and the ltaS-complemented strain (ΔltaSR) (5 × 108 cfu/mouse) resulted in a significant increase in mortality at 48 h. However, injection of ΔltaS (2 × 109 cfu/mouse) was non-lethal to CD-1 mice at the same time point (Fig. 1e).

The impaired pathogenicity of (ltaSltas may be attributed to retarded S. aureus growth as a result of LtaS deficiency, and not specifically to the deficiency of the extracellular domain14. Hence, we injected ΔltaS (2 × 109 cfu/mouse) into the peritoneal cavity of CD-1 mice in the presence of various amounts of eLtaS protein (20–100 μg/mouse). We found that co-injection of eLtaS significantly decreased the survival rate of the mice (Fig. 1f, P = 0.0089), but injection of eLtaS (100 μg/mouse) alone was harmless (Fig. S3). Furthermore, we demonstrated that injection of S. aureus 8325-4 (2 × 108 cfu/mouse) together with eLtaS significantly decreased the survival rate (Fig. 1g, P = 0.0284). The pathogenic role of eLtaS was also determined in a sub-lethal murine pneumonia infection model. Histopathological examination of the mouse lungs showed that eLtaS increased capillary congestion and thickness of the alveolar wall (Fig. 1h). Meanwhile, eLtaS also led to more weight loss in mice at 72 h (Fig. 1i) and increases lung bacterial burden at 24 h (Fig. 1j). These results suggest that S. aureus–secreted eLtaS is an important virulence factor that dramatically aggravates infection.

eLtaS binds to C3b

Given that eLtaS inhibits MAC formation and that C3 is the central component protein in all three complement pathways, we investigated the interaction between eLtaS and C3. Binding of eLtaS to C3 from both human and mouse serum was detected by capture ELISA (Fig. 2a,b), indicating a species-independent interaction. This interaction was not observed with serum from C3-deficient (C3−/−) C57BL/6 mice (Fig. 2b).

Figure 2. eLtaS binds to C3b.

Figure 2

(a) eLtaS binds to C3 from human serum in a concentration-dependent manner. eLtaS was coated onto a 96-well plate and human serum was added at various concentrations. Bound C3 was detected using an anti-C3 antibody. Data are representative of three independent experiments and shown as the mean ± SD. (b) eLtaS binds to murine C3. Serum (3% and 1.5%) from C3 + /− or C3−/− mice was added to an eLtaS coated 96-well plate. C3 was detected using an anti-C3 antibody. Data are representative of three independent experiments and shown as the mean ± SD. Significant differences between groups were evaluated using a two-tailed Student’s t test. (c) eLtaS binds to C3, C3b, and C3d, but not C3c. Human complement C3 and its fragments, C3b, C3c, and C3d, were coated (1 μg/well) onto a 96-well plate. Bound eLtaS was detected using an anti-eLtaS antibody. Data are presented as the mean ± SD of three independent experiments. (d) eLtaS binds to C3b-deposited S. aureus. S. aureus 8325-4 was incubated with the indicated concentrations of human serum for 15 min. After washing with PBS, S. aureus was incubated with eLtaS for a further 30 min. Deposited C3b and bound eLtaS were detected by FCM with anti-C3b and anti-His antibodies. (e) eLtaS binds to C3b. Serum was isolated from C3+/− and C3−/− C57BL/6 mice and incubated with S. aureus 8325-4 FITC-labeled eLtaS protein was added and specific binding was detected by FCM.

Two forms of C3 convertase (C4b2a and C3bBb) cleave C3 into C3a and C3b. C3b is further cleaved into C3c and C3d by Factor I20,23,24. To identify the fragment responsible for eLtaS binding, a capture ELISA was performed with C3 and its proteolytic fragments, C3b, C3c, and C3d, as coating antigens. eLtaS was found to bind the C3d domain of C3b, but not C3c (Fig. 2c). The relative affinity of eLtaS for human C3 and C3b was determined respectively (Table S1).

C3b binds covalently to bacterial surfaces through a reactive intramolecular thioester in the C3d domain of the α-chain, either to hydroxyl groups via an ester linkage or to primary amino groups via an amide bond25,26. Three strains of S. aureus (8325-4, Newman, and 04018) were incubated with increasing concentrations of human serum for 15 min and the deposition of C3b was detected by flow cytometry (FCM) using an anti-C3b-FITC antibody. The percentage of C3b-deposited S. aureus increased in a serum concentration-dependent manner (Fig. 2d and S4). Using an eLtaS-specific antibody, we further demonstrated that, following incubation, eLtaS bound to C3b deposited on the bacterial surface (Fig. 2d). Sera from C3+/− and C3−/− C57BL/6 mice were incubated with S. aureus 8325-4 prior to addition of FITC-labeled eLtaS. Analysis by FCM showed that eLtaS only bound to S. aureus incubated with serum from C3+/− C57BL/6 mice and not from C3−/− C57BL/6 mice (Fig. 2e), confirming that eLtaS is able to bind C3b deposited on the bacterial surface.

eLtaS attenuates phagocytosis of C3b-deposited S. aureus

Immune effector cells, such as neutrophils, target C3b-deposited S. aureus for destruction27. We considered whether eLtaS blocked the process of C3b deposition in the three complement activation pathways. S. aureus Efb (extracellular fibrinogen binding protein), which is known to inhibit C3b deposition in the AP, was used as a positive control28,29. As expected, Efb inhibited C3b deposition in AP. However, deposition of C3b was not blocked by eLtaS in any of the pathways (Fig. S5a–c), suggesting that the interaction site of eLtaS on C3d was different from that of Efb. We further demonstrated that eLtaS could not inhibit binding between C3d and Efb. Similarly, the interaction between C3d and eLtaS was not interrupted by Efb (Fig. S6a,b). The ability of eLtaS to block C3b deposition was tested by incubating human serum with S. aureus 8325-4 in the presence or absence of eLtaS. As shown in Fig. S7, the level of C3b deposited on the S. aureus surface was unaffected by the presence of eLtaS.

To determine whether eLtaS attenuates phagocytosis of C3b-deposited S. aureus by neutrophils, we incubated SYTO9-labeled S. aureus 8325-4 with fresh human or murine serum and then added human or murine leukocytes. As neutrophils constitute more than 90% of granulocytes, we detected the proportion of SYTO9-positive granulocytes that had engulfed S. aureus by FCM. We found an increased percentage of SYTO9-positive granulocytes in the presence of serum, and this increase was reduced in a concentration-dependent manner in the presence of eLtaS (Fig. 3a,b). Furthermore, human neutrophils were isolated from peripheral blood30 and incubated with C3b-deposited S. aureus 8325-4 in the presence of eLtaS. The number of S. aureus cells engulfed by neutrophils was found to decrease with increasing amounts of eLtaS (Fig. 3c).

Figure 3. eLtaS attenuates C3b-mediated engulfment of S. aureus by phagocytes.

Figure 3

(a,b) Determination of the engulfment of S. aureus by neutrophils through FCM. SYTO9-labeled S. aureus was incubated with human serum (a) or murine serum (b). The complexes were then incubated in the presence of eLtaS prior to addition of human (a) or murine (b) leukocytes. The percentage of human or murine neutrophils that were SYTO9-positive, indicating engulfment of S. aureus, was determined by FCM. (c) Determination of the engulfment of S. aureus by human neutrophils mediated by C3b deposition on the bacterial surface. C3b-deposited S. aureus 8325-4 was incubated with different concentrations of eLtaS prior to incubation with human neutrophils. The engulfed S. aureus 8325-4 cells were counted on a THA plate. Data are representative of three independent experiments and shown as the mean ± SD. (d) Determination of the engulfment of S. aureus by murine peritoneal macrophages and neutrophils in vitro. Murine peritoneal cavity cells were isolated and incubated with SYTO9-labeled S. aureus in the presence of eLtaS. Phagocytosis was determined by FCM using anti-CD11b-APC (Mac-1), anti-F4/80-PE, and Gr-1-PerCP (Ly-6 G). (e,f) Evaluation of the engulfment of S. aureus by murine peritoneal phagocytes in vivo in C3+/− C57BL/6 (e) and C3−/− C57BL/6 (f) mice. Peritoneal cavity cells were isolated 30 min after intraperitoneal injection of SYTO9-labeled S. aureus 8325-4 (5 × 108 cfu/mouse) in the presence of eLtaS. The percentage of neutrophils and macrophages that had engulfed S. aureus was determined by FCM. Data are representative of three independent experiments and shown as the mean ± SD. Significant differences between groups were evaluated using a two-tailed Student’s t test. (g,h) The role of eLtaS in the mortality of C3-deficient mice. C3−/− (g) and C3+/− C57BL/6 (h) mice were injected intraperitoneally with S. aureus 8325-4 cells (5 × 108 cfu/mouse for C3+/− C57BL/6 mice, 1 × 108 cfu/mouse for C3−/− C57BL/6 mice) in the presence of eLtaS. The survival rate was calculated at different time points post challenge. Data are presented as the percentage of mice surviving. Survival curves were determined using the Kaplan-Meier method and compared using the log-rank test (n = 8) (NS, non-significant).

Murine peritoneal cavity cells were isolated and incubated with SYTO9-labeled S. aureus, and the percentage of phagocytes, including neutrophils and macrophages, that engulfed S. aureus was determined by FCM. We found that eLtaS attenuated the engulfment of C3b-deposited S. aureus by peritoneal phagocytes (Fig. 3d).

We then studied the effect of eLtaS on phagocytosis of S. aureus in vivo using C3+/− C57BL/6 mice. Mouse peritoneal cavity cells were isolated after intraperitoneal injection of SYTO9-labeled S. aureus in the presence or absence of eLtaS. We found that the percentage of phagocytes that had engulfed S. aureus was decreased in the presence of eLtaS (Fig. 3e). However, eLtaS had no significant inhibitory effect on the phagocytosis of S. aureus by peritoneal phagocytes of C3−/− C57BL/6 mice (Fig. 3f). These results further demonstrated that eLtaS attenuated the engulfment of S. aureus by phagocytes through interaction with C3.

We then determined the pathogenic effect of eLtaS in an acute peritoneal infection murine model. eLtaS did not aggravate S. aureus infection in C3−/− C57BL/6 mice (Fig. 3g), but injection of eLtaS in heterozygous C3+/− C57BL/6 mice resulted in a decreased survival rate (Fig. 3h).

Monoclonal antibody 4 against eLtaS (MAE4) prevents S. aureus infection

Because eLtaS was found to aggravate S. aureus infection, we considered whether an antibody directed against eLtaS could be protective. Mouse monoclonal antibodies to eLtaS were generated according to standard protocols. Seven monoclonal antibodies (MAE1-7) were obtained (Fig. S8a) and one of these, MAE4, was found to block the interaction between eLtaS and C3b (Fig. S8b). MAE4 had an EC50 of 80.89 ng/ml (Fig. 4a) and was of an IgG2a isotype (Fig. S8c).

Figure 4. The eLtaS-specific monoclonal antibody MAE4 efficiently prevents S. aureus infection.

Figure 4

(a) The binding affinity of MAE4 to eLtaS was determined by ELISA. eLtaS protein was coated onto 96-well plates in the presence of a serial dilution of MAE4. Bound IgG was detected using peroxidase (HRP)-conjugated goat anti-mouse IgG. (b,c) Assessment of the anti-infective effect of MAE4 in a murine model of acute peritoneal infection. MAE4 (100 μg/mouse) was injected into the peritoneal cavity 2 h prior to challenge with S. aureus 8325-4 (5 × 108 cfu/mouse) (b) or ΔltaS (6 × 109 cfu/mouse) (c). The survival rate was measured at different time points post challenge. Data are presented as the percentage of mice surviving. Survival curves were determined using the Kaplan-Meier method and compared using the log-rank test (n = 8). (d) MAE4 protects mice from S. aureus infection in a pneumonia infection model. CD-1 mice were injected intratracheally with S. aureus 8325-4 cells (1 × 107 cfu/mouse). MAE4 IgG (100 μg/mouse) was injected intramuscularly into the left hind leg at 30 min, 24 h, and 48 h post infection. Lung sections were taken 72 h post challenge and stained with hematoxylin-eosin. (e–g) Determination of the effect of MAE4 in a sublethal murine model of intravenous challenge. MAE4 IgG (100 μg/mouse) was injected into the peritoneal cavity of BALB/c mice 2 h prior to intravenous challenge with S. aureus Newman (1 × 107 cfu/mouse). Kidneys were examined by histopathology for internal abscesses 5 days post infection. Staphylococcal abscess (black arrow) with a central concentration of staphylococci (blue arrow) is indicated (e). Bacterial colonies were counted at 5 days post infection (f). Data are representative of three independent experiments and shown as the mean ± SD. Significant differences between groups were evaluated using a two-tailed Student’s t test. For the lethal challenge model, S. aureus Newman cells (1 × 108 cfu/mouse) were administered and survival rates were monitored for 10 days (g). Survival curves were determined using the Kaplan-Meier method and compared using the log-rank test (n = 8) (NS, non-significant).

We assessed the protective effect of MAE4 in the murine acute peritoneal infection model. It was found that MAE4 was able to completely rescue mice from lethal S. aureus 8325-4 infection (Fig. 4b). As expected, MAE4 had no effect when used in combination with a lethal dose of S. aureus ΔltaS (Fig. 4c). These results suggest that MAE4 protected mice from S. aureus infection by directly targeting eLtaS. This effect was further studied in a murine model of staphylococcal pneumonia. MAE4 was injected intramuscularly at 30 min, 24 h and 48 h post challenge with S. aureus 8325-4. Histopathological examination of the lungs of the mice showed that MAE4 decreased S. aureus-induced tissue damage (Fig. 4d). We also assessed the effect of MAE4 in a murine pneumonia infection model with two clinical S. aureus strains (S. aureus Newman and 04018)31,32. MAE4 also inhibited infection caused by these two S. aureus strains (Fig. S9).

In addition, the protective effect of MAE4 was assessed using a mouse intravenous challenge model. MAE4 was injected (100 μg/mouse) into the peritoneal cavity of BALB/c mice 2 h before intravenous challenge with a sublethal dose of S. aureus Newman (1 × 107 cfu/mouse). Five days post infection, the kidneys were examined by histopathology for internal abscesses (Fig. 4e) and the number of bacterial colonies was determined (Fig. 4f). MAE4 was also tested in a lethal challenge model with S. aureus Newman (1 × 108 cfu/mouse). Survival rates were monitored for ten days (Fig. 4g). These results further confirm that MAE4 protects mice from S. aureus infection.

MAE4 blocks evasion of phagocytosis mediated by eLtaS

We further determined whether MAE4 could neutralize the effect of eLtaS. Using a competitive ELISA, we demonstrated that MAE4 blocked the interaction between eLtaS and C3b in a concentration-dependent manner (Fig. 5a). The effect of MAE4 on eLtaS-mediated evasion of phagocytosis was detected in vitro by FCM. We found that eLtaS did not attenuate engulfment of S. aureus by human or murine neutrophils in the presence of MAE4 (Fig. 5b,c). We further tested the neutralization effect of MAE4 in vivo and demonstrated that treatment with MAE4 increased the percentage of neutrophils and macrophages that engulfed S. aureus in the peritoneal cavity (Fig. 5d).

Figure 5. MAE4 blocks eLtaS-mediated evasion of phagocytosis (a).

Figure 5

Determination of the effect of MAE4 on the interaction between eLtaS and C3b. C3b was added to an eLtaS-coated 96-well plate in the presence of different concentrations of MAE4. Bound C3b was determined using an anti-C3b antibody. (b,c) Analysis of phagocytosis of S. aureus by neutrophils in vitro. SYTO9-labeled S. aureus 8325-4 was incubated with human serum (b) or murine serum (c). C3b-deposited S. aureus was further incubated in the presence of eLtaS with or without MAE4 prior to the addition of human (b) or murine (c) leukocytes. The percentage of neutrophils that were SYTO9-positive, indicating engulfment of S. aureus, was determined by FCM. (d) Analysis of the phagocytosis of S. aureus by macrophages and neutrophils in vivo. MAE4 was injected into the peritoneal cavity 2 h prior to challenge with SYTO9-labeled S. aureus 8325-4 (5 × 108 cfu/mouse). Peritoneal cavity cells were isolated, and the percentage of SYTO9-labeled neutrophils and macrophages, indicating engulfment of S. aureus was determined by FCM. Data are representative of three independent experiments and shown as the mean ± SD. Significant differences between groups were evaluated using a two-tailed Student’s t test.

Given that LtaS is located on the cell membrane, we tested whether MAE4 could directly bind bacterial cells and affect the growth of S. aureus in vitro. Analysis by FCM showed that MAE4 did not bind S. aureus cells (Fig. 6a). We further demonstrated that synthesis of LTA and growth of S. aureus were unaffected by MAE4 (10 μg/ml) (Fig. 6b,c). The metal-binding domain and substrate-binding domain of LtaS are considered important for LTA synthesis, and mutation of two amino acids (T300 and H347) in these domains decreases the production of LTA15. These two amino acids were substituted with alanine to generate two mutant proteins (T300A and H347A). As shown in Fig. S10a,b, MAE4 binding to these two mutant proteins was maintained, indicating that MAE4 only targeted secreted eLtaS protein and had no effect on the activity of membrane-bound LtaS.

Figure 6. Administration of MAE4 exerts less evolutionary pressure on S. aureus.

Figure 6

(a) MAE4 did not bind to the surface of S. aureus. S. aureus 8325-4 cells were cultured and collected at different time points (1.5, 6, or 12 h). MAE4 antibody was incubated with S. aureus 8325-4 and binding of MAE4 was detected by FCM. (b) MAE4 had no perceptible effect on the growth of S. aureus. S. aureus (OD600 = 0.1) was cultured with MAE4 or isotype control IgG (50 μg/ml) for 6 h, and the bacterial concentration was determined by measuring the OD600. (c) MAE4 had no perceptible effect on the production of LTA. Cell-associated LTA from S. aureus 8325-4 (2.5 × 109 cfu) cultured with MAE4 or isotype control IgG (50 μg/ml) was extracted, and the level of LTA was analyzed by western blotting using a monoclonal LTA-specific antibody.

Discussion

The spread of multi-drug-resistant S. aureus is an increasingly serious threat to global public health. Global efforts to develop new antibiotics have not been fast enough to combat the evolution of antimicrobial resistance33–35. Targeting of virulence factors is regarded as a promising strategy that would apply less selective pressure for the development of bacterial resistance than traditional strategies36.

In vivo, S. aureus bacteria are mainly cleared by phagocytes (neutrophils and macrophages). Phagocytosis is strongly enhanced by the opsonization of bacteria with antibodies and the deposition of complement activation products on the surface of the bacteria37,38.

In this study, we developed a monoclonal antibody against eLtaS, MAE4, which is capable of blocking eLtaS-mediated evasion of phagocytosis and dramatically reduces S. aureus infection. eLtaS, the C-terminal extracellular domain of LtaS, is released from the cell membrane by peptidase SpsB as a soluble peptide whose function was unknown until now15. Here, we demonstrate that eLtaS aggravates S. aureus infection through binding to C3b.

Complement activation leads to rapid deposition of C3b on the surface of bacteria, promoting phagocytosis of the opsonized bacteria27. We found that eLtaS had no effect on the deposition of C3b, but the interaction between eLtaS and C3b resulted in attenuated engulfment of C3b-deposited S. aureus by phagocytes, demonstrating that eLtaS aggravates infection by mediating evasion of phagocytosis by C3b-deposited S. aureus.

Furthermore, we demonstrated that the mouse monoclonal antibody MAE4 inhibited the interaction between eLtaS and C3b and consequently blocked evasion of phagocytosis of C3b-deposited S. aureus. In vivo studies also showed that administration of MAE4 promoted engulfment of S. aureus by phagocytes and protected mice against challenge with drug-sensitive (8325-4, Newman) and drug-resistant (04018) strains of S. aureus.

Our results in vitro showed that MAE4 did not target LtaS located on the surface of S. aureus; moreover, it had no effect on LTA synthesis and growth of S. aureus, suggesting that MAE4 could not inhibit the activity of membrane-bound LtaS. No observed interaction between MAE4 and LtaS on S. aureus may be because the epitope on LtaS recognized by MAE4 was covered. Whether MAE4 could directly target LtaS and has the inhibitory effect on S. aureus growth and LTA synthesis in vivo will be addressed in the future.

Of note, S. aureus expresses several small secreted proteins (~10–15 kDa) that bind to C3b, such as staphylococcal complement inhibitors (SCINs) and Efb39. These proteins share a similar structure for interaction with C3b39. Compared with these proteins, eLtaS is larger (~50 kDa) and a competitive ELISA also indicated that the C3b-binding site of eLtaS was different.

In conclusion, we have shown that the secreted protein eLtaS is an important virulence factor of S. aureus that mediates immune evasion by interfering with phagocytosis of complement-deposited bacterial cells. Targeting of eLtaS using the neutralizing antibody MAE4 that we have generated is a potential therapeutic strategy for treatment of infectious diseases caused by S. aureus.

Methods

Ethics Statement

All animal experimental protocols of the study are in accordance with the national guidelines for the use of animals in scientific research “Regulations for the Administration of Affairs Concerning Experimental Animals” and were approved by the Animal Care and Use Committee of Beijing Institute of Basic Medical Sciences, with the approval number BMS-111248.

Bacterial strains and growth conditions

S. aureus strains were grown in 5 ml of brain heart infusion (BHI) (BD) at 37 °C for 12 h with shaking at 200 rpm.

Hemolysis assay

For preparation of bacteria-free culture supernatant, a single colony was used to inoculate 5 ml of BHI in a 50-ml conical tube. The cultures were incubated at 37 °C with shaking at 200 rpm for 6 h and 12 h, at which time the samples were placed on ice. The cultures were diluted with BHI to equalize the OD600 to a value at 10, pelleted by centrifugation at 4 °C, and sterile filtered through a 0.2-μm filter. The classical pathway-mediated hemolytic assay was performed as previously described with some modifications40. Briefly, normal human sera were first incubated with sheep erythrocytes to pre-clear serum of antibodies directed against erythrocytes. Concurrently, sheep erythrocytes were opsonized with anti-erythrocyte IgM. The opsonized sheep erythrocytes (2 × 107) were then incubated with 25% precleared normal human serum, in the presence of eLtaS or the supernatants of S. aureus 8325-4 or Δrnc in HBS++ buffer (20 mM HEPES, 140 mM NaCl plus 5 mM CaCl2, 2.5 mM MgCl2 and 0.1% Tween-20, pH 7.4). After 30 min at 37 °C, the samples were centrifuged, and the absorbance of the supernatants at 405 nm was measured.

eLtaS protein expression and purification

The eltaS gene was amplified by PCR from the genomic DNA of S. aureus 8325-4 using the primer sequences (forward-EcoRI) ccggaattctctgaagatgacttaacaaa and (reverse-XhoI) ccgctcgagttattttttagagtttgctt. The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. The fusion protein was purified by Ni-NTA agarose (Qiagen). Purified eLtaS protein was passed through the pierce high-capacity endotoxin removal resin to remove residual E. coli endotoxins (Thermo Scientific). Protein concentrations were determined by use of the bicinchoninic acid (BCA) protein assay, and proteins were stored at −70 °C until use.

Complement Inhibition Assays

Complement inhibition assays were performed as previously described22. Briefly, the lectin pathway and alternative pathway were assessed by using immobilized mannan (10 μg/well, Saccharomyces cerevisiae, M7504, Sigma) and LPS (1 μg/well, Salmonella enteriditis, L6386, Sigma) respectively, as ligands. Human fibrinogen (10 μg/well, human plasma, F3879, Sigma) was used for assessing the classical pathway. Then, antibodies against fibrinogen (Merck, 1:1000) were added to generate Immune complexes. Plates were blocked with 5% skimmed milk/PBS for 1 h at 37 °C. Serum samples were diluted in GVB++ (VBS containing 0.5 mM MgCl2, 2 mM CaCl2, 0.05% Tween-20 and 0.1% gelatin, pH 7.5) to assess the classic and the lectin pathway, while GVB+ (VBS containing 10 mM EGTA, 5 mM MgCl2, 0.05% Tween-20 and 0.1% gelatin, pH 7.5) were used to assess the alternative pathway. To evaluate the effect of eLtaS, serum samples were pre-incubated with eLtaS for 10 min at room temperature before adding them to the plates for 1 h at 37 °C. Deposited C3b and the formation of C5b-9 were detected using anti-C3 (Cedarlane, 1:1000) and anti-C5b-9 (Abcam, 1:1000) antibodies respectively, followed by peroxidase (HRP)-conjugated goat anti-mouse IgG. The absorbance at 450 nm was measured. All incubation volumes were 100 μl and detection antibodies were diluted in PBS containing 5% skimmed milk. After each step, plates were washed three times with PBS containing 0.5% Tween-20.

Enzyme-linked immunosorbent assay

Capture ELISA was performed as previously described with some modifications29. Plates were coated with eLtaS (5 μg/well). The human or mouse sera were diluted in GVB-EDTA buffer (VBS containing 0.1% gelatin and 40 mM EDTA) and then added for 1 h at 37 °C. Detection of C3 was performed using anti-C3 (Cerdalane, 1:1000), followed by HRP-conjugated goat anti-rabbit IgG.

The binding ELISA was performed as previously described with some modifications22. Human complement C3 and its fragments C3b and C3d (Merck Millipore) were coated onto ELISA plates (1 μg/well). eLtaS protein was diluted in PBS and then added for 1 h at 37 °C. Bound eLtaS was detected using anti-eLtaS antibody (1:1000) followed by HRP-conjugated goat anti-rabbit IgG.

In the eLtaS competitive ELISA, CR1 protein (USCN) was coated at 1 μg per well; then 1 μg C3b protein was added to each well with a serial dilution of eLtaS protein. Bound C3b proteins were detected using anti-C3 (Santa Cruz Biotechnology) followed by HRP-conjugated goat anti-rabbit IgG (1:20,000, Jackson ImmunoResearch Laboratories).

In the MAE4 competitive ELISA assay, eLtaS was coated at 1 μg per well; then 2 μg C3b was added to each well with a serial dilution of MAE4. Bound C3b proteins were detected using anti-C3 (Santa Cruz Biotechnology) followed by HRP-conjugated goat anti-rabbit IgG (1:20,000, Jackson ImmunoResearch Laboratories).

Acute peritoneal infection murine model

Male mice (CD-1, C3−/− C57BL/6 and C3+/− C57BL/6; 6- to 8-week-old) were intraperitoneally injected with S. aureus 8325-4 or ΔltaS cells. Each type of mice was randomized into treatment groups of eight mice each. In the eLtaS or MAE4 group, 100 μg protein/per mouse carried in 100 μl PBS was injected into the peritoneal cavity. Mouse survival was recorded at the different time points post challenge.

Sublethal murine pneumonia infection model

Male CD-1 mice, 6- to 8-week-old, were challenged with S. aureus 8325-4 (1 × 107 cfu/mouse) via the tracheal route and were randomized into two groups of eight mice each. eLtaS or MAE4 protein (100 μg per mouse in 300 μl PBS) was intraperitoneally injected. After 72 h of challenge, the animals were sacrificed and the lung tissues were fixed and stained by H&E.

Renal abscess model and lethal challenge via intravenous injection

BALB/c mice (8-week-old, female) were intraperitoneally injected with 100 μg antibody/per mouse in 100 μl PBS. Mice were injected retro-orbitally with clinical S. aureus strain Newman (1 × 107 cfu) under anesthesia. On the 5th day post infection, mice were killed and the right kidneys were examined by histopathology for internal abscesses. Left kidneys were removed and homogenized in 0.1% Triton X-100. Aliquots were diluted and plated on agar medium for triplicate determination of cfu. For the lethal challenge model, all experimental conditions remained the same except that 1 × 108 cfu were administered and animals were monitored for survival for ten days post infection.

SYTO 9 labeling S. aureus

S. aureus 8325-4 was labeled by SYTO9 as previously described with some modifications41. Briefly, S. aureus 8325-4 was grown on BHI for 12 h at 37 °C. The bacterial cells were collected by centrifugation (5,000 g, 5 min), washed with PBS, suspended in PBS to an optical density of 2 × 109 cfu/ml, and incubated at room temperature for 30 min in the dark with 5 μM SYTO 9 (Molecular Probes). The cells were washed twice to remove excess dye and resuspended in PBS. A flow cytometer (BD) with a 530/30 band pass filter was used to detect SYTO 9 fluorescence.

S. aureus with C3b deposition

C3b-deposited S. aureus 8325-4 was prepared as described with some modifications42. Human sera were obtained from normal donors after informed consent, according to human study protocols reviewed and approved by the institutional review boards at Beijing Institute of Basic Medical Sciences. S. aureus cells (1 × 107 cfu) were washed twice in PBS. A mixture of S. aureus cells and human serum was incubated in 100 μl (final volume) of PBS, with or without eLtaS protein, for 10 min at 37 °C. Controls for C3b deposition experiments included S. aureus cells incubated with buffer alone and eLtaS alone.

Deposition of C3b was confirmed by direct immunofluorescence analysis using flow cytometry. For flow cytometric analysis, S. aureus cells (1 × 107 cfu) with C3b deposits were resuspended in PBS, incubated with FITC-conjugated mouse anti-human C3b antibody (1 μg/ml, Cedarlane) for 30 min at room temperature, washed twice in PBS and resuspended in the same buffer at 1 × 106 cells/ml.

Assessment of phagocytosis in vitro

The C3b-deposited S. aureus 8325-4 (5 × 106 cfu) was incubated with different concentrations of eLtaS for 30 min at room temperature. For colony-forming unites assay, human neutrophils were purified on a Ficoll (Amersham)/Histopaque (density 1.119; Sigma) gradient using heparinized whole blood from a single donor30.

Then the C3b-deposited S. aureus 8325-4 with or without eLtaS were incubated with human neutrophils for 10 min at 37 °C. The reaction was stopped by adding gentamicin (0.1 mg/ml) for 10 min at 37 °C. The bacteria were resuspended in 0.02% Triton X-100. Cfu were calculated by serial dilution plated on Todd-Hewitt agar (THA; 1.5% agar in Todd-Hewitt broth) plates.

For flow cytometry assays, leukocytes were isolated from whole blood by red blood cell lysis. The C3b-deposited S. aureus 8325-4 (labeled with SYTO 9) with eLtaS were incubated with leukocytes for 10 min. The cells were washed twice by PBS and the percentage of granulocyte cells that engulfed the SYTO 9-labeled S. aureus was detected by flow cytometry.

Assessment of phagocytosis in vivo

SYTO9-labeled S. aureus 8325-4 (5 × 108 cfu/mouse) were intraperitoneally injected into individual mice together with eLtaS (100 μg/mouse) in 500 μl PBS. Peritoneal cavity cells were isolated 30 min after injection. The reaction between peritoneal cavity cells and S. aureus was stopped by adding gentamicin (0.1 mg/ml) for 10 min at 37 °C. After washing two times with PBS, cell suspensions were then preincubated with anti–CD16/CD32 mAb to block FcγRII/III receptors and stained in 4 °C for 15 min. Cells were then stained with APC-conjugated anti-CD11b (Mac-1) (M1/70), PE-conjugated anti-F4/80 (BM8) and PercP-Cy5.5-conjugated Gr-1(Ly-6 G) (1A8) (Biolegend) in 4 °C for 30 min. For dead cell exclusion, stained cells were resuspended in 5 μg/mL 7-AAD to exclude dead cells. Data were collected from 1 to 5 × 105 cells and analyzed with FlowJo software. To distinguish autofluorescent cells from cells expressing low levels of individual surface markers, we established upper thresholds for autofluorescence by running an unstained sample. Single-stain controls are then analysed to determine the correct voltage and gain settings.

Production and characterization of monoclonal antibodies

Monoclonal antibodies of eLtaS were produced by fusing antibody-secreting spleen cells from eLtaS-immunized mice with immortal myeloma cells to create monoclonal hybridoma cell lines that express the eLtaS specific antibody in cell culture supernatant. Antibody samples from cell culture supernatants were screened to identify eLtaS-binding specificity. The titer and isotype of positive antibody samples were determined. To produce large quantities of antibody MAE4, the MAE4 hybridoma cells were injected into the abdomen of mice where the cells multiplied and produced antibody-filled fluid (ascites). The antibodies were purified using protein G agarose (GE Healthcare) according to the product instructions.

Statistical analysis

All experiments were repeated at least three times and the data were presented as the mean ± SD unless noted other wise. Significant differences between groups were evaluated using a two-tailed Student’s t test. Survival curves were determined using the Kaplan-Meier method and compared using the log-rank test. A P-value of less than 0.05 was considered statistically significant. GraphPad Prism software was used for statistical analyses.

Additional Information

Accession codes: National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov): ltaS, GI:87201381.

How to cite this article: Liu, Y. et al. MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence. Sci. Rep. 5, 17215; doi: 10.1038/srep17215 (2015).

Supplementary Material

Supplementary Information
srep17215-s1.pdf (1.3MB, pdf)

Acknowledgments

We thank Dr. Qiang Zou (Department of Immunology in Chengdu Medical College China) for kindly providing the C3-deficient mice. This work was supported by grants from National Natural Science Foundation of China (http://www.nsfc.gov.cn) [31370170, 31170074 and 31000040] and Natural Science Foundation of Beijing (http://210.76.125.39/zrjjh/zrjj/) [7142119]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Footnotes

Author Contributions G.Y. study concept and design, obtained funding and drafting of the manuscript; Y.L., J.F. and Q.L. acquisition of data, analysis and interpretation of data; X.Z., Y.G., J.Y., C.M., Y.H., M.L., G.H., G.C., P.J. and W.H. administrative, technical, and material support; B.S. study supervision.

References

  1. Day N. P. et al. A link between virulence and ecological abundance in natural populations of Staphylococcus aureus. Science 292, 114–6 (2001). [DOI] [PubMed] [Google Scholar]
  2. Archer G. L. Staphylococcus aureus: a well-armed pathogen. Clin. Infect. Dis. 26, 1179–81 (1998). [DOI] [PubMed] [Google Scholar]
  3. Beceiro A., Tomás M. & Bou G. Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world? Clin. Microbiol. Rev. 26, 185–230 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Thammavongsa V., Missiakas D. M. & Schneewind O. Staphylococcus aureus degrades neutrophil extracellular traps to promote immune cell death. Science 342, 863–6 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Skurnik D. et al. Animal and human antibodies to distinct Staphylococcus aureus antigens mutually neutralize opsonic killing and protection in mice. J. Clin. Invest. 120, 3220–33 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Gordon R. J. & Lowy F. D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin. Infect. Dis. 46, S350–9 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Espadinha D. et al. Extensive dissemination of methicillin-resistant Staphylococcus aureus (MRSA) between the hospital and the community in a country with a high prevalence of nosocomial MRSA. PLoS One 8, e59960 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Harris S. R. et al. Evolution of MRSA during hospital transmission and intercontinental spread. Science 327, 469–74 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Oganesyan V. et al. Mechanisms of neutralization of a human anti-α-toxin antibody. J. Biol. Chem. 289, 29874–80 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Thammavongsa V., Rauch S., Kim H. K., Missiakas D. M. & Schneewind O. Protein A-neutralizing monoclonal antibody protects neonatal mice against Staphylococcus aureus. Vaccine 33, 23–6 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Sully E. K. et al. Selective chemical inhibition of agr quorum sensing in Staphylococcus aureus promotes host defense with minimal impact on resistance. PLoS Pathog. 10, e1004174 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Tkaczyk C. et al. Identification of anti-alpha toxin monoclonal antibodies that reduce the severity of Staphylococcus aureus dermonecrosis and exhibit a correlation between affinity and potency. Clin. Vaccine Immunol. 19, 377–85 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lu D. et al.Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS. Proc. Natl. Acad. Sci. USA 106, 1584–9 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Oku Y. et al. Pleiotropic roles of polyglycerolphosphate synthase of lipoteichoic acid in growth of Staphylococcus aureus cells. J. Bacteriol. 191, 141–51 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Wörmann M. E., Reichmann N. T., Malone C. L., Horswill A. R. & Gründling A. Proteolytic cleavage inactivates the Staphylococcus aureus lipoteichoic acid synthase. J. Bacteriol. 193, 5279–91(2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Richter S. G. et al. Small molecule inhibitor of lipoteichoic acid synthesis is an antibiotic for Gram-positive bacteria. Proc. Natl. Acad. Sci. USA 110, 3531–6 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liu Y. et al. The production of extracellular proteins is regulated by ribonuclease III via two different pathways in Staphylococcus aureus. PLoS One 6, e20554 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dunkelberger J. R. & Song W. C. Complement and its role in innate and adaptive immune responses. Cell Res. 20, 34–50 (2010). [DOI] [PubMed] [Google Scholar]
  19. Foster T. J. Immune evasion by staphylococci. Nat. Rev. Microbiol. 3, 948–58 (2005). [DOI] [PubMed] [Google Scholar]
  20. Ricklin D., Hajishengallis G., Yang K. & Lambris J. D. Complement: a key system for immune surveillance and homeostasis. Nat. Immunol. 11, 785–97 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Onda K. et al. Excretion of complement proteins and its activation marker C5b-9 in IgA nephropathy in relation to renal function. BMC Nephrol. 12, 64 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jongerius I. et al. Staphylococcal complement evasion by various convertase-blocking molecules. J. Exp. Med. 204, 2461–71 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Roumenina L. T. et al. Hyperfunctional C3 convertase leads to complement deposition on endothelial cells and contributes to atypical hemolytic uremic syndrome. Blood 114, 2837–45 (2009). [DOI] [PubMed] [Google Scholar]
  24. Janssen B. J. et al. Structures of complement component C3 provide insights into the function and evolution of immunity. Nature 437, 505–11 (2005). [DOI] [PubMed] [Google Scholar]
  25. Albertí S. et al. Analysis of complement C3 deposition and degradation on Klebsiella pneumoniae. Infect. Immun. 64, 4726–32 (1996). [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hostetter M. K. & Gordon D. L. Biochemistry of C3 and related thiolester proteins in infection and inflammation. Rev. Infect. Dis. 9, 97–109 (1987). [DOI] [PubMed] [Google Scholar]
  27. Hickey M. J. & Kubes P. Intravascular immunity: the host-pathogen encounter in blood vessels. Nat. Rev. Immunol. 9, 364–75 (2009). [DOI] [PubMed] [Google Scholar]
  28. Chen H. et al. Allosteric inhibition of complement function by a staphylococcal immune evasion protein. Proc. Natl. Acad. Sci. USA 107, 17621–6 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hammel M. et al. A structural basis for complement inhibition by Staphylococcus aureus. Nat. Immunol. 8, 430–7 (2007). [DOI] [PubMed] [Google Scholar]
  30. Troelstra A. et al. Dual effects of soluble CD14 on LPS priming of neutrophils. J. Leukoc. Biol. 61, 173–8 (1997). [DOI] [PubMed] [Google Scholar]
  31. Baba T., Bae T., Schneewind O., Takeuchi F. & Hiramatsu K. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J. Bacteriol. 190, 300–10 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Cao X. et al. Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus. Nucleic Acids Res. 37, 4621–8(2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tavares L. S. et al. Strategies and molecular tools to fight antimicrobial resistance: resistome, transcriptome, and antimicrobial peptides. Front Microbiol. 4, 412 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Gwynn M. N., Portnoy A., Rittenhouse S. F. & Payne D. J. Challenges of antibacterial discovery revisited. Ann. NY Acad. Sci. 1213, 5–19 (2010). [DOI] [PubMed] [Google Scholar]
  35. Tenover F. C. Mechanisms of antimicrobial resistance in bacteria. Am. J. Infect. Control 34, S3–10 (2006). [DOI] [PubMed] [Google Scholar]
  36. Rasko D. A. & Sperandio V. Anti-virulence strategies to combat bacteria-mediated disease. Nat. Rev. Drug Discov. 9, 117–28 (2010). [DOI] [PubMed] [Google Scholar]
  37. Ko Y. P. et al. Phagocytosis Escape by a Staphylococcus aureus Protein That Connects Complement and Coagulation Proteins at the Bacterial Surface. PLoS Pathog. 9, e1003816 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Criss A. K. & Seifert H. S. A bacterial siren song: intimate interactions between Neisseria and neutrophils. Nat. Rev. Microbiol. 10, 178–90 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Garcia B. L., Ramyar K. X., Ricklin D., Lambris J. D. & Geisbrecht B. V. Advances in understanding the structure, function, and mechanism of the SCIN and Efb families of Staphylococcal immune evasion proteins. Adv. Exp. Med. Biol. 946, 113–33 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Bestebroer J. et al. Functional basis for complement evasion by staphylococcal superantigen-like 7. Cell Microbiol. 12, 1506–16 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Pitz A. M., Perry G. A., Jensen-Smith H. C. & Gentry-Nielsen M. J. A flow cytometric assay to quantify in vivo bacterial uptake by alveolar macrophages. J. Microbiol. Methods 81, 194–6 (2010). [DOI] [PubMed] [Google Scholar]
  42. Cunnion K. M., Hair P. S. & Buescher E. S. Cleavage of complement C3b to iC3b on the surface of Staphylococcus aureus is mediated by serum complement factor I. Infect. Immun. 72, 2858–63 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep17215-s1.pdf (1.3MB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES