Skip to main content
Springer logoLink to Springer
letter
. 2015 Oct 29;7(4):887–894. doi: 10.1007/s12686-015-0497-4

A multiplex microsatellite set for non-invasive genotyping and sexing of the osprey (Pandion haliaetus)

Deborah A Dawson 1,✉, Oddmund Kleven 2, Natalie dos Remedios 1, Gavin J Horsburgh 1, Rolf T Kroglund 3, Teresa Santos 1,4, Colin R A Hewitt 5
PMCID: PMC4657739  PMID: 26640607

Abstract

During the 1950s and 1970s the osprey (Pandion haliaetus) experienced a dramatic population crash and remains of conservation concern in several parts of the world. We isolated 37 microsatellite loci and assessed these in ospreys sampled in the UK and Norway (using mouth swabs/feathers). From 26 loci variable in four ospreys, we selected 13, combined these into two multiplex-PCR sets and included a sex-typing marker. Additional markers confirmed sexes. In 17 ospreys, feather-sampled in central Norway, we found 3–10 alleles per locus. The 13 loci are autosomal (heterozygotes were present in both sexes) and observed heterozygosities ranged from 0.24 to 0.94. The combined probability of identity for the 13 loci was 8.0 × 10−12. These microsatellite loci will be useful for genetic monitoring, parentage analysis and population genetic studies of the osprey.

Electronic supplementary material

The online version of this article (doi:10.1007/s12686-015-0497-4) contains supplementary material, which is available to authorized users.

Keywords: Birds of prey, Feather, Raptor, Sex-typing, Simple Tandem Repeat (STR), Swabs, Western osprey

Introduction

The osprey (Pandion haliaetus) is a fish-eating raptor with an almost worldwide distribution. It experienced a dramatic decline in population size in the 1950s–1970s primarily due to the use of pesticides and is studied as a sentinel species to detect pollution (Grove et al. 2009). European populations of ospreys are migratory, spending the summer in Europe and winter in Africa, whereas other populations are resident. Although the osprey has recovered to some degree and is no longer threatened globally, it is still of conservation concern in some areas (BirdLife International 2013). To facilitate genetic monitoring through non-invasive sampling of shed feathers, and to enable analyses of genetic diversity, parentage and population structure, we isolated and characterized novel microsatellite loci for the osprey.

Methods

Microsatellite sequences were isolated from a male osprey (02/09). This individual hatched at Rutland Water Nature Reserve, near Oakham, UK in 2009 but died of an infection at 6 weeks old. Genomic DNA was extracted from liver tissue, digested with MboI, enriched for dinucleotide/tetranucleotide sequences, cloned and Sanger-sequenced bidirectionally, identifying 96 unique osprey microsatellites (following Armour et al. 1994). In addition, an Illumina paired-end library was created from the dinucleotide + tetranucleotide-enriched DNA (~1 + 1 µg) and MiSeq-sequenced. This allowed more (tetranucleotide) marker choices for multiplexing. Primer sets were designed from 37 sequences (26 Sanger and 11 MiSeqs) using Primer3 v0.4.0.

Samples were collected from wild ospreys including: (1) 17 feathers from nine nests in central Norway (two plucked from unrelated nestlings and 15 shed from adults); (2) six feathers from two nests in Scotland; and 3) mouth-swabs from 48 osprey chicks at Rutland Water Nature Reserve, England. For genotyping, DNA was extracted from feather calamus (‘Norwegian’ ospreys) using the Maxwell®16 Research System (Promega), and from feathers (‘Scottish’ ospreys) or mouth swabs (‘English’ chicks) using ammonium acetate. We sexed the chick and feather samples using the Z-002A, Z-002D (Dawson 2007) and Z43B markers (DAD et al. unpublished data). Initially, each locus was amplified in ospreys sampled in Norway (n = 4), Scotland (n = 6) and England (n = 48; Table 1). PCR was performed with fluorescently-labeled forward primers using QIAGEN’s Multiplex PCR kit and protocol [annealing temperature = 56/57 °C (Table 1); 2/10-µl reactions]. Multiplex-PCR was used to genotype/sex-type the 17 presumably unrelated ospreys, sampled in Nord-Trondelag county (64°06′N, 12°50′E), central Norway (Table 2). PCR products were separated on an ABI Genetic Analyzer and allele sizes assigned using Genemapper software.

Table 1.

Assessment of 37 osprey (Pandion haliaetus) microsatellite loci in three populations

Locusa Clone name and ENA sequence accession no. Chromosome locationb Primer sequences (5′–3′) Primer Tm (°C)c Repeat motif Country where sampled n A Expected allele size (bp)d Observed allele size range (bp)
Pha01 Osp107_A01WZ Gga and Tgu, F: [HEX]GTCAACAGTGTGCCCTAGCAG 60.90 (TG)10 NOR 4 0 195 No amp.
Unreliable LN829364 Multiple copies R: TACCCGGGAAGCTTGGAC 61.00 SCOT 6 0 Unreliable Poor amp.
NCBI: GgaW & Z ENG 48 0 No amp.
Pha02 Osp107_A08 Gga6, 26441864 F: Set 1 = [PET]TTATCTGCAAGGCCTGGTGG 63.37 (CA)15 NOR 4 5 200 196–208
LN829365 Tgu6, 24709071 R: ACAGGAGTGGAGGAGGTAGT 55.22
F: Set 2 (UK) = [6FAM]ATTATCTGCAAGGCCTGGTG 60.10 SCOT 4 3 256 253–259
R: CTGCTGCTTGGAAATGCTC 59.69 ENG 48 4 253–261
Pha03 Osp107_C03 Gga17, 5182075 F: [6FAM]TCTAGCCCATCTCCAGTGAATC 59.03 (TG)9 NOR 4 2 112 105–111
LN829366 Tgu17, 5717909 R: AATTAGAAAGTTGGTGCAGTCCC 59.17 SCOT 6 1 111
ENG 48 1 111
Pha04 Osp107_C09 Gga3, 45456042 F: [VIC]ATGACCAGTCTGATGCCTTG 58.67 (CA)12 NOR 4 4 160 158–168
LN829367 Tgu3, 39010319 R: ACATTTGGAGGGTTTCTTGC 59.03
F: [HEX] used for UK samples SCOT 6 5 160 143–167
ENG 48 6 143–165
Pha05 Osp107_C10 Gga3, 21714508 F: [HEX]CATTTAACGGTTTAGAAAGTGAAGG 59.54 (GT)12 NOR 4 2 259 259–261
LN829368 Tgu3, 11588718 R: TGTAGTGAAATGAATAACAAATGAAGC 59.87 SCOT 6 2 248–261
ENG 48 2 259–261
Pha06 Osp107_D06 Gga1, 182509839 F: [HEX]CAAGCTTGTAGCAGTCTTGCAG 60.38 (CA)19 NOR 4 0 117 No amp.
LN829369 Tgu1, 4702446 R: TGCCTGTACAGAAGCAGCAG 60.35 SCOT 6 3 108–113
ENG 48 2 108–112
Pha07 Osp107_D07 Gga9, 5205116 F: [6FAM]GATCACCTCGCTCATCTAG 54.30 (AC)9 NOR 4 1 125 122
LN829370 Tgu9, 841456 R: ACGTAACTAAAGAGAGCCTC 54.25 SCOT 6 1 121
ENG 47 1 121
Pha08 Osp107_D08 Gga7, 27710560 F: [HEX]TACAGGGAGGTCAGCCAATC 60.07 (AC)12 NOR 4 0 209 No amp.
Unreliable LN829371 Tgu7, 6096203 R: GGGTTTGCCTACATGGGTATC 60.45 SCOT 4 3 Unreliable (201–211)
ENG 48 0 No amp.
Pha09 Osp107_F09 Gga4, 60184616 F: [6FAM]CTTGCTGCCAGTTGCTAGG 59.75 (TG)11 NOR 4 2 248 258–261
LN829372 Tgu4, 19049909 R: TTAGGGAAGGCAGTTGATGAG 59.32 SCOT 6 2 250–252
ENG 48 2 250–252
Pha10 Osp107_F12 Gga—no hits F: Set 1 = [PET]TGGTGAGAAGCCCAGTGAAA 61.78 (GT)22 NOR 4 4 178 183–211
LN829373 Tgu3, 76487951 R: ACATTACCCTTCACCTTGTTCA 58.49
F: Set 2 (UK) = [6FAM]GAAGCCCAGTGAAAGTAAGATAGG 59.70 SCOT 6 5 299 300–332
R: GTCAGTGAAGGTGGCACAAG 59.31 ENG 47 6 300–330
Pha11 Osp107_G04 Gga26, 3808355 F: [HEX]ATCATTGTCTCCGTTGAAATACTC 58.59 (TG)12 NOR 4 4 369 362–374
LN829374 Tgu—no hits R: TGGCTTAAGGACATGAGCTG 59.02 SCOT 5 3 366–372
ENG 47 4 366–374
Pha12 Osp107_G05Z Gga—no hits F: [HEX]TGCATCCTAATGAACCTTTGC 60.09 (CA)15 NOR 4 3 299 294–302
LN829375 TguZ, 23578707 R: AGGCTGGTGGTTAAACATGG 59.85 SCOT 4 3 (females= 300–304
ENG 48 3 homozyg) 300–304
Pha13 Osp107_G06 Gga12, 12834746 F: [6FAM]AGACAAATTACTTTCTGCCCTGC 59.49 (AC)9 NOR 4 5 193 184–194
LN829376 Tgu12, 13613680 R: CATAGCTGCACATGACTTCCC 59.05 SCOT 6 5 185–195
ENG 48 7 181–195
Pha14 Osp107_G07 Gga6, 7231355 F: [6FAM]CTGAGCCCTACAGGTCAAGG 59.86 (CA)14 NOR 4 3 163 155–163
LN829377 Tgu6random, 1131071 R: GATCAAAGTATAAGCTTCTGGCACT 59.42 SCOT 6 2 155–163
ENG 48 4 155–163
Pha15 Osp107_H11 Gga—no hits F: [6FAM]AGGAGAACTGGGCTTGGTC 59.24 (GT)11 NOR 4 2 148 149–151
LN829378 TguLGE11random, 434714 R: TTTGTCACTCTGAACCCAACTC 59.23 SCOT 6 2 149–151
ENG 48 3 147–151
Pha16 Osp108_C02 Gga4, 60893985 F: [6FAM]TTTAGGACATGAAAGACCATCTAGC 60.04 (GT)11 NOR 4 3 300 296–302
LN829379 Tgu4, 19753992 R: AGGCTCGAATCAAGGAATAGG 59.70 SCOT 6 4 296–302
ENG 48 3 298–302
Pha17 Osp108_D06 Gga3, 6186457 F: [6FAM]GATCATTTGAGTCAGGGTTGTAGA 59.53 (GT)12 NOR 4 2 273 258–261
LN829380 Tgu3, 23071942 R: CCCAGGCAATGTGTGATAGTAG 59.52 SCOT 6 4 258–263
ENG 48 2 257–260
Pha18 Osp108_D09 Gga14, 7369333 F: [6FAM]TTGGTCACTTCTGTGGAACC 58.54 (CT)13 NOR 4 6 204 205–257
LN829381 Tgu14, 16292216 R: GGACGCATGGTGTAAACTTC 58.08 SCOT 6 5 205–261
ENG 47 7 205–285
Pha19 Osp108_E06 Gga2, 137582088 F: [6FAM]ATGGTGTCGTGGTGACTGC 60.62 (GT)11 NOR 4 3 94 90–94
LN829382 Tgu2, 138654459 R: AAGCGATTCACTCCATGCTC 60.37 SCOT 6 2 90–92
ENG 48 2 92–94
Pha20 Osp108_F01 Gga7, 32493856 F: [HEX]CTTTGTGAGCCTGCAAGTACG 59.80 (TG)9 NOR 4 2 110 111–113
LN829383 Tgu7, 35798065 R: CCACCTGAGGACTAAGCCTG 59.46 SCOT 6 3 110–113
ENG 38 2 110–112
Pha21 Osp108_F04 Gga2, 138399255 F: [6FAM]CACAGCCTTAAAGTTCCAGCTG 59.77 (AC)9 NOR 4 1 146 149
LN829384 Tgu2, 145579947 R: TTGAGAAGCCTTCCACGACC 59.97 SCOT 6 2 147–149
ENG 47 3 143–149
Pha22 Osp108_F05 Gga8, 19109998 F: [HEX]CTGCAGGGAGCCGATG 60.02 [GA(CA)4]5 NOR 4 8 285 (266–452)
Unreliable LN829385 Tgu—no hits R: ATTCGCCTGACCTATGTTGC 60.10 SCOT 6 3 Unreliable (266–300)
ENG 25 9 Poor amp. (236–336)
Pha23 Osp108_F09 Gga2, 64794670 F: [6FAM]GCTCAGGACAGCGAACAAAC 59.76 (CA)9 NOR 4 2 180 179, 183
LN829386 Tgu—no hits R: CATGTAGAACTGCAGCACTCG 59.34 SCOT 6 2 179, 183
ENG 46 2 179, 183
Pha24 Osp108_G03 Gga—no hits F: [6FAM]GATCTTGTTCTAACCCTCTCACAATAC 59.87 (TG)15 NOR 4 1 217 (220)
Unreliable LN829387 Tgu1, 38622635 R: TGTCATTAAACAATTCAGAAAGATTACC 60.07 SCOT 6 3 Unreliable (214–224)
ENG 11 3 Poor amp. (220–224)
Pha25 Osp108_H01 Gga—no hits F: [HEX]CTGGGTTAAAGTCAGTGGGATTG 59.24 (GT)9 NOR 4 3 174 177–181
LN829388 Tgu24, 2050527 R: TGTCCATGCACCTATCCATCC 59.58 SCOT 6 1 179
ENG 48 2 175–178
Pha26 Osp108_H08Z GgaZ, 55975474 F: [HEX]TTGAGTTGTTTTAGACTTTGACA 54.64 (TG)9 NOR 4 1 144 (144)
Unreliable LN829389 TguZ, 68820524 R: TCCTTATTTTCATCCTCACTGA 54.53 SCOT 6 2 Unreliable (142–143)
ENG 33 6 Poor amp. 117–141
Pha27 Osp34 Gga13, 10093338 F: [6FAM]TTTAACAGCTCCCACTCTGATG 59.38 (GATA)11 NOR 4 5 173 164–196
LN829390 Tgu13 4122045 R: AGCATGCTTGTGGTGCAG 59.55 SCOT 6 6 164–192
ENG 48 6 164–196
Pha28 Osp222 Gga, no hit F: [6FAM]GGTGGAAAACTCCCTGAGC 59.65 (CTAA)11 NOR 4 5 130 117–133
LN829391 Tgu, no hit R: TGCTTTTGGGGTGAAAAGTC 60.09 SCOT 6 5 116–129
ENG 48 5 117–137
Pha29 Osp354 Gga6, 22515994 F: [NED]AAAGTCCAGGGCAGTTTGTC 59.19 (TATC)12 NOR 4 5 144 135–151
LN829392 Tgu6, 22351865 R: GAACGCTGTGGGACCTTC 59.18
Plus Unknown chr 110289344 F: [HEX] used for UK samples SCOT 6 3 138–148
ENG 48 4 135–147
Pha30 Osp428 Gga3, 31915082 F: [6FAM]CTCAACACAATTTCTATTGGAACAC 59.03 (TATC)13 NOR 4 3 247 247–255
LN829393 Tgu3, 35243746 R: TGGTACTAAGGCTCCATATAGGATAAC 59.35 SCOT 6 3 239–251
ENG 48 5 231–255
Pha31 Osp537 Gga, no hit F: [HEX]AATTATGAGCCATTCTGCAACAG 60.50 (GA)13 NOR 4 1 197 197
LN829394 Tgu9, 15738938 R: CATCCTGTGTTGCCAGTGAG 60.31 SCOT 6 2 197–220
And Un 58947724 ENG 48 2 197–219
Pha32 Osp742 Gga, no hit F: [6FAM]CTTGAGCGCCTGCCATAG 60.66 (CA)22 NOR 4 0 189 No amp.
Unreliable LN829395 Tgu, no hit R: CACAAGCTAACAGGACCATTCTC 60.18 SCOT 6 4 Unreliable (183–191)
ENG 48 0 No amp.
Pha33 Osp1639 Gga, no hit F: [VIC]AGGTCAATAGGCTACGTGAACAG 59.72 GATA GATG (GATA)12 NOR 4 3 130 129–137
LN829396 Tgu2, 95818547 R: CACAGGCTACCTTAGACAACACC 60.10
F: [HEX] used for UK samples SCOT 5 3 129–137
ENG 48 5 124–140
Pha34 Osp2311 Gga and Tgu, F: [6FAM]CTGGGCTTGTCCATCCAG 60.20 (CA)11 NOR 4 1 148 145
LN829397 Multiple copies R: AGGTACGAATATACCCTGAAGCAC 59.83 SCOT 6 1 145
in genome ENG 48 2 145–147
Pha35 Osp2323 Gga, no hits F: [PET]GAATCCACCCTCAGCAAGTC 59.66 (G)7 (GT)12 NOR 4 2 110 103–115
LN829398 Tgu, no hit R: ATAGCAGGATGCTGGAGGAG 59.41
F: [HEX] used for UK samples SCOT 6 2 109–111
ENG 46 4 109–115
Pha36 Osp3963 Gga, no hits F: [NED]TTTCAGGTGGGCTTCATCTC 60.20 (GATA)13 GATG (GATA)2 NOR 4 5 174 166–186
LN829399 Tgu, no hit R: GAATCATCCTGAAATGCTTATTTTTC 60.51
F: [HEX] used for UK samples SCOT 6 3 174–182
ENG 48 5 166–182
Pha37 Osp4029 Gga, no hits F: [6FAM]GCTAAGTGCATCCCTTCTGC 59.98 (GT)10 NOR 4 3 94 86–92
LN829400 Tgu, no hit R: GTGCAGCAGCCTTAGCATC 59.72 SCOT 4 2 86–88
ENG 48 3 86–92
Summary Total numbers of loci polymorphic, monomorphic L. Poly. Mono. No amp./
or failing to amplify per region samples were taken Unreliable
NOR 37 26 4 7
SCOT 37 28 3 6
ENG 37 29 2 6

aLoci in bold and underlined were selected for multiplexing; ENA European Nucleotide Archive: http://www.ebi.ac.uk/ena/data/view/LN829364-LN829400

bChromosome location in the chicken (Gga) and zebra finch (Tgu) genomes (see Supplementary File)

cTm, melting temperature, the PCR program used was Norwegian samples: 95 °C for 15 min, 30 cycles of [95 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s] and a final extension step of 60 °C for 30 min. UK samples: 95 °C for 15 min, 35 cycles of [94 °C for 30 s, 56 °C for 90 s, 72 °C for 60 s], and a final extension of 60 °C for 30 min. Six loci were found to be unreliable in all populations, alternative primer sets could be designed if required. Pha07 was monomorphic in the three populations tested but may be variable in other populations/subspecies. Pha12 was homozygous in all 21 females genotyped supporting its suggested Z-linked status, n number of individuals tested, Country location where individuals were sampled, NOR Norway, SCOT Scotland, ENG England (see text), A number of alleles observed, No amp. no PCR amplification, L. number of loci tested, Poly. Polymorphic, Mono. monomorphic

dThe expected allele size was based on the sequence of the male osprey Pandion haliaetus individual (02/09; that hatched at the Rutland Water Nature Reserve, Oakham, England, UK) from which the primer sets were designed (see text)

Table 2.

Multiplex microsatellite genotyping and sexing of the osprey (Pandion haliaetus)

Locus and primer set Clone name/reference Chr. Fluoro–label MP set Final primer concentration (µM)a Repeat type Pop. n Allele size range (bp) A H O H E P HWE (GENEPOP) F NULL (CERVUS)
Pha04 Osp107_C09 3 VIC A 0.04 Di NOR 17 152–168 6 0.71 0.69 0.3845 −0.0350
Pha10 set 1 Osp107_F12 3 PET A 0.2 Di NOR 17 165–195 10 0.88 0.87 0.6130 −0.0280
Pha27 Osp0034 13 6FAM A 0.2 Tetra NOR 17 164–192 7 0.53 0.63 0.0783 +0.0929
Pha28 Osp0222 Unk. 6FAM A 0.2 Tetra NOR 17 117–133 5 0.82 0.76 0.6762 −0.0508
Pha29 Osp0354 6 NED A 0.04 Tetra NOR 17 135–151 5 0.76 0.73 0.1537 −0.0427
Pha35 Osp2323 Unk. PET A 0.2 Di NOR 17 115–119 3 0.24 0.36 0.0170 +0.2290
Pha37 Osp4029 Unk. 6FAM A 0.2 Di NOR 17 86–92 3 0.59 0.63 0.3211 +0.0294
Pha02 set 1 Osp107_A08 6 PET B 0.2 Di NOR 17 188–212 7 0.59 0.50 1.0000 −0.1483
Pha13 Osp107_G06 12 6FAM B 0.2 Di NOR 17 182–196 8 0.94 0.88 0.6118 −0.0494
Pha16 Osp108_C02 4 6FAM B 0.2 Di NOR 17 296–302 4 0.53 0.57 0.7551 +0.0367
Pha30 Osp0428 3 6FAM B 0.2 Tetra NOR 17 235–255 6 0.65 0.78 0.0323 +0.0568
Pha33 Osp1639 2 VIC B 0.04 Tetra NOR 17 125–137 4 0.71 0.70 0.9226 −0.0080
Pha36 Osp3963 Unk. NED B 0.04 Tetra NOR 17 166–186 6 0.71 0.77 0.3684 +0.0365
Z-002Db Dawson (2007) ZW 6FAM B 0.2 n/a NOR 5M 127 1 0 0 n/a
NOR 12F 118 and 127 2 1 1 n/a
Z-002Db Dawson (2007) ZW 6FAM S-plex 0.2 n/a UK 28M 127 1 0 0 n/a
UK 26F 118 and 127 2 1 1 n/a
Z-002A Dawson (2007) ZW 6FAM S-plex 0.2 n/a ENG 27M 210 1 0 0 n/a
ENG 21F 210 and 218 2 1 1 n/a
Z43B DAD et al. ZW 6FAM S-plex 0.2 n/a UK 28M 272 1 0 0 n/a
unpublished Taa= 50 °C UK 26F 268 and 272 2 1 1 n/a

aThe full PCR programs used are provided in the footnotes of Table 1. Chr. chromosome location (see Table 1 and Supplementary Figure), Unk. unknown, MP multiplex set, S-plex marker amplified separately in a single-plex, Pop population genotyped: NOR Norway, ENG England, UK individuals sampled in England and Scotland combined, n number of unrelated individuals genotyped, M Male, F Female, A number of different alleles observed, H O observed heterozygosity, H E expected heterozygosity, P HWE probability of deviation from Hardy–Weinberg equilibrium (data in bold indicates p > 0.05), F NULL estimated frequency of null alleles (data in bold indicates F NULL > 0.2)

bThe Z-002A and Z-002D (Dawson 2007) and Z43B (DAD et al. unpublished data) were used for identifying the sex of the individuals. Ta, PCR annealing temperature (50 °C for Z43B and 56/57 °C for all other markers, see Table 1 footnotes); M Male, F Female, n/a not applicable

Results

Genotyping revealed that all feathers were from different individuals. The genetic sexing revealed that ~10 % of osprey chicks were incorrectly sexed in the field (5/52 errors when based only on size/morphology). Microsatellite sequences were submitted to the EMBL-EBI European Nucleotide Archive (LN829364–LN829400; Table 1; S1). Of the 37 loci tested, 31 could be assigned a location in the chicken (Gallus gallus) and/or zebra finch (Taeniopygia guttata) genome based on sequence similarity (following Dawson et al. 2006) and 2–3 were Z-linked (Table 1, Supplementary Figure). From the 26 loci polymorphic in four individuals sampled in Norway, we selected 13 for multiplex-PCR that were placed into two sets based on fragment size, genetic variation and peak interpretation in the Norwegian samples. Multiplex genotyping of 17 ospreys sampled in Norway revealed a mean of 5.7 alleles per polymorphic locus (range 3–10; genotyping was performed in duplicate; Table 2). Heterozygotes were present in both sexes for these 13 loci indicating they are autosomal. Observed heterozygosity ranged from 0.24 to 0.94 per locus (Table 2). Two loci deviated from Hardy–Weinberg equilibrium in the Norwegian population (p < 0.05, Genepop v4.2; Table 2); possibly due to a Wahlund effect (Pha30) and/or allelic dropout/null alleles (Pha35, estimated null allele frequency >0.2, Cervus v3.0). Despite the source of DNA being feathers there was no evidence of dropout at any other loci (Cervus). No pairwise locus combinations displayed significant linkage disequilibrium (p < 0.01, Genepop). The combined probability of identity for the 13 loci was 8.0 × 10−12 (GenAlEx v6.501).

In conclusion, this multiplex set of novel microsatellite loci combined with the sex markers will be useful for genetic analyses of osprey, including typing non-invasive samples, such as shed feathers.

Electronic supplementary material

Acknowledgments

Roy Dennis (Highland Foundation for Wildlife) and Fiona Strachan kindly supplied the six feathers from Scotland and these were genotyped by Sarah Buckland and Filipa Martins. Rutland Water Nature Reserve is supported by The Leicestershire and Rutland Wildlife Trust in partnership with Anglian Water. We thank Tim Mackrill (Senior Reserve Officer at Rutland) for sampling permission and, along with Lloyd Park, for tree climbing, sampling assistance and providing morphometric sexing data. Børge Cato Moen, Pål Mølnvik, Torstein Myhre, Terje Gifstad and Ola Vedal kindly assisted with feather collection in Norway. Collection and genotyping of the samples from Central Norway was financially supported by the County administration in Nord-Trøndelag. MiSeq sequencing was performed by Jennifer Dawe and Darren Grafham of the Sheffield Diagnostics Genetics Service at The Children’s Hospital Sheffield supported by the Sheffield Children’s NHS Trust, UK. Marker isolation and genotyping was performed at the NERC Biomolecular Analysis Facility at the University of Sheffield (supported by the Natural Environment Research Council, UK) and multiplex development/typing was performed at the Norwegian Institute for Nature Research. TS was supported by an Erasmus Internship whilst at the University of Sheffield and CRAH is grateful to the University of Leicester for allowing a period of study leave to contribute to this work. We thank Douglas Ross for comments on the manuscript.

Funding

This study was funded by the Natural Environment Research Council, UK, coauthors institutions, an Erasmus Internship (TS) and the County administration in Nord-Trøndelag, Norway.

Compliance with ethical standards

Sampling

Visiting and observing osprey nests at Rutland Water Nature Reserve was performed under an English Schedule 1 Licence, issued by the British Trust for Ornithology on behalf of Natural England. Sampling permission was provided by Tim Mackrill, Senior Reserve Officer at Rutland Water Nature Reserve.

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. Armour JAL, Neumann R, Gobert S, Jeffreys AJ. Isolation of human simple repeat loci by hybridization selection. Hum Mol Genet. 1994;3(4):599–605. doi: 10.1093/hmg/3.4.599. [DOI] [PubMed] [Google Scholar]
  2. BirdLife International (2013) Pandion haliaetus. The IUCN Red List of Threatened Species. Version 2014.2. www.iucnredlist.org. Downloaded 30 Sept 2014
  3. Dawson DA. Genomic analysis of passerine birds using conserved microsatellite loci. UK: University of Sheffield; 2007. [Google Scholar]
  4. Dawson DA, Burke T, Hansson B, Pandhal J, Hale MC, Hinten GN, Slate J. A predicted microsatellite map of the passerine genome based on chicken-passerine sequence similarity. Mol Ecol. 2006;15(5):1299–1320. doi: 10.1111/j.1365-294X.2006.02803.x. [DOI] [PubMed] [Google Scholar]
  5. Grove RA, Henny CJ, Kaiser JL. Osprey: worldwide sentinel species for assessing and monitoring environmental contamination in rivers, lakes, reservoirs, and estuaries. J Toxicol Environ Health B Crit Rev. 2009;12(1):25–44. doi: 10.1080/10937400802545078. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Conservation Genetics Resources are provided here courtesy of Springer

RESOURCES