Abstract
Anaplasma phagocytophilum is an obligate intracellular bacterium that causes the emerging infection, granulocytic anaplasmosis. While electroporation can transform A. phagocytophilum isolated from host cells, no method has been developed to transform it while growing inside the ApV (A. phagocytophilum-occupied vacuole). Polyamidoamine (PAMAM) dendrimers, well-defined tree-branched macromolecules used for gene therapy and nucleic acid delivery into mammalian cells, were recently shown to be effective in transforming Chlamydia spp. actively growing in host cells. We determined if we could adapt a similar system to transform A. phagocytophilum. Incubating fluorescently labeled PAMAM dendrimers with infected host cells resulted in fluorescein-positive ApVs. Incubating infected host cells or host cell-free A. phagocytophilum organisms with dendrimers complexed with pCis GFPuv-SS Himar A7 plasmid, which carries a Himar1 transposon cassette encoding GFPuv and spectinomycin/streptomycin resistance plus the Himar1 transposase itself, resulted in GFP-positive, antibiotic resistant bacteria. Yet, transformation efficiencies were low. The transformed bacterial populations could only be maintained for a few passages, likely due to random Himar1 cassette-mediated disruption of A. phagocytophilum genes required for fitness. Nonetheless, these results provide proof of principle that dendrimers can deliver exogenous DNA into A. phagocytophilum, both inside and outside of host cells.
Keywords: Anaplasmataceae, Rickettsiales, dendrimers, intracellular bacteria, pathogen-occupied vacuole
1. Introduction
A conundrum to studying obligate intracellular bacterial pathogens is that inactivating a gene that is critical for invasion or intracellular survival prevents recovery of the mutant. With the exception of Coxiella burnetii, for which axenic cultivation and knock out-complementation are possible [1, 20], approaches developed to genetically manipulate these bacteria are largely inefficient [25]. Most involve isolating the organisms from their host cells, transforming them, and then reincubating them with naïve host cells to recover the transformants or chemically mutagenizing them.
Anaplasma phagocytophilum is an obligate intracellular bacterium of the Family Anaplasmataceae that causes granulocytic anaplasmosis in animals and humans, the latter of which is an emerging and potentially fatal infection in Europe, Asia, and the United States [24]. The A. phagocytophilum infection cycle initiates when an infectious dense-cored form (DC) binds to a host cell and induces its uptake into a host cell-derived vacuole, the ApV (A. phagocytophilum-occupied vacuole). Within the ApV, the DC transitions to the replicative reticulate cell form (RC). After the replication phase, RCs covert back to DCs, which are released as infectious progeny [23]. Munderloh and colleagues developed a method for transforming Anaplasmataceae species that is based on electroporation of constructs that facilitate Himar1 random transposition of cassettes expressing fluorescent reporter and antibiotic resistance genes into the bacterial chromosome [9, 10]. This pioneering work paved the way for gene functional studies of multiple Anaplasma species as well as gene-specific disruption in Ehrlichia chaffeensis [5-8]. While an important step forward, this method must be performed on host cell-free bacteria. A system that circumvents the need to purify bacteria from host cells would potentially foster development of improved transformation protocols and gene functional studies in A. phagocytophilum and other obligate intracellular bacteria.
Polyamidoamine (PAMAM) dendrimers (dendrimers) are highly branched macromolecules that are used for gene therapy and drug delivery into mammalian cells [2, 16, 12, 19, 26]. Dendrimers are endocytosed and can be modified to improve transfection efficiency and targeting of specific cell types [22, 29]. Dendrimer-DNA complexes were used to transform Chlamydia spp. growing inside host cells [11, 15, 18], highlighting their potential to target vacuole-adapted bacteria. Herein, we evaluated the hypothesis that dendrimers can be used to transform intracellular and host cell-free A. phagocytophilum.
2. Materials and methods
2.1. Cultivation of uninfected and A. phagocytophilum infected host cell lines
Uninfected and A. phagocytophilum (strain NCH-1) infected human promyelocytic leukemic HL-60 cells and RF/6A (rhesus monkey choroidal endothelial cells) were cultured as described [3, 13].
2.2. Preparation of fluorescein isothiocyanate (FITC)-labeled dendrimers
PAMAM dendrimer generation 4.0 (1,4-diaminobutane core, amine terminated) (NanoSynthons, Mt. Pleasant, MI) was FITC labeled at a dendrimer:FITC molar ratio of 1:5. Conjugation was confirmed by proton nuclear magnetic resonance spectroscopy and light absorbance (λ=490 nm) [26]. FITC-dendrimer conjugates were lyophilized followed by reconstitution in methanol and storage at −20 °C.
2.3. Monitoring uptake of FITC-labeled dendrimers into the ApV
RF/6A cells grown on coverslips in 24-well plates were infected with A. phagocytophilum as described [13]. Twenty-four h later, the cells were washed with PBS followed by a two-h incubation with 1 μg of FITC-conjugated dendrimers in Iscove's modified Dulbecco's medium (IMDM; Sigma-Alrich, St. Louis, MO) lacking FBS or glutamine at 37 °C in a CO2 incubator. The medium was removed, the monolayers were washed with PBS, Dulbecco's modified Eagle's medium containing 10% FBS, 15 mM HEPES, MEM non-essential amino acids (Gibco, Grand Island, NY), and 4 mM glutamine (DMEM-10) (Gibco) was added, and the cells were incubated for up to 6 h at 37 °C in a CO2 incubator. The cells were subjected to indirect immunofluorescence analysis using rabbit polyclonal antibody against the A. phagocytophilum major surface protein, P44 [24], and 4’,6-diamidino-2-phenylindole (DAPI) as described [3]. Images were obtained using an Olympus BX-51 fluorescence microscope affixed with a disk-spinning unit or a Zeiss 700 laser-scanning confocal microscope.
2.4. Preparation of dendrimer-plasmid complexes
pCis GFPuv-SS Himar A7 [6] was kindly provided by Ulrike Munderloh (University of Minnesota). G4 dendrimers were complexed with plasmid DNA by vortexing both components in sterile water followed by incubation at room temperature for 30 min. Zeta potential and particle size were determined as described [18]. G4 dendrimers have 64 primary amine (N) groups that can form complexes through electrostatic interactions with DNA phosphate (P) groups [11]. Similar to results reported for Chlamydia spp. [11, 15, 18], dendrimer-DNA complexes with an N/P ratio of 8 provided superior results to those with an N/P ratio of 4. Data reported were obtained using complexes having an N/P ratio of 8.
2.5. Dendrimer-mediated transformation of A. phagocytophilum and analyses of transformants
For transformation of A. phagocytophilum growing in host cells, dendrimer-pCis GFPuv-SS Himar A7 complexes (0.5 μg of DNA per well) or dendrimers alone were resuspended in medium lacking FBS or glutamine and incubated with either A. phagocytophilum infected RF/6A or HL-60 cells in 24-well plates. Infected cells incubated with media alone were a mock transformation control. After 2 h, the cells were washed and DMEM-10 or IMDM-10 was added to RF/6A or HL-60 cell cultures, respectively. Also, host cell-free A. phagocytophilum DC organisms were isolated [14], washed with PBS, incubated with dendrimer-DNA complexes or controls for 2 h, resuspended in IMDM-10, and used to infect naïve HL-60 cells [23]. Beginning at 24 h post transformation, the infected cultures were maintained in the presence of spectinomycin or spectinomycin plus streptomycin (100 mg/ml each). Media that contained antibiotic was replaced three times per week and the cultures were split as needed to prevent host cell overgrowth. Cultures were monitored daily for GFP-positive A. phagocytophilum organisms via live cell imaging or indirect immunofluorescence analysis of fixed cells. For immunofluorescence analyses, RF/6A cells grown on coverslips or HL-60 cells cytocentrifuged onto glass slides were fixed in 4% (vol/vol) paraformaldehyde in PBS followed by permeabilization with 0.5% (vol/vol) Triton X-100 in PBS. To determine the percentage of ApVs that contained GFP-positive bacteria, the cells were screened with antibodies against GFP (Life Technologies, Eugene, OR) and P44 (the latter of which would label all A. phagocytophilum organisms), appropriate secondary antibodies, and stained with DAPI [4]. The number of ApVs containing GFP- and P44-positive bacteria was divided by the number of all (P44-positive) ApVs, and the quotient was multiplied by 100. For gene expression analyses, total RNA was extracted from dendrimer:DNA complex treated infected RF/6A cells and subjected to RT-PCR [4] or RT-qPCR [21] using primers listed in Table 1.
Table 1.
Primers used in this study
| Designation1 | Sequence (5’ to 3’) |
|---|---|
| aadA-Fwd | GAGGCGCTAAATGAAACCTTAAC |
| aadA-Rev | GATAAGCCTGCCTAGCTTCAA |
| gfpuv-Fwd | ACATCACGGCAGACAAACA |
| gfpuv-Rev | GTAATCCCAGCAGTTACA |
| Ap 16S-527F | TGTAGGCGGTTCGGTAAGTTAAAG |
| Ap 16S-753R | GCACTCATCGTTTACAGCGTG |
F and R refer to primers that bind to the sense and antisense strand, respectively.
3. Results
3.1. FITC-labeled dendrimers are delivered into the ApV
To determine if dendrimers traffic into the ApV, FITC-labeled dendrimers were incubated with A. phagocytophilum infected RF/6A cells. Approximately 4.4 ± 1.9% of ApVs contained FITC at 0 h and 18.2 ± 5.9 % 6 h post incubation. The percentage of FITC-positive ApVs did not increase beyond that observed at 6 h (data not shown). Thus, exogenously added dendrimers traverse the ApV membrane into the ApV lumen.
3.2. Dendrimer-enabled transformation of A. phagocytophilum growing in host cells
It was next determined if dendrimers could be used to transform A. phagocytophilum growing in host cells. The Himar1 transposase mediates random insertion into AT-rich sites [17, 32]. The plasmid, pCis GFPuv-SS Himar A7, carries a Himar1 transposon cassette encoding GFPuv and spectinomycin/streptomycin resistance (conferred by the aminoglycoside adenylyltransferase [aadA] gene) plus the Himar1 transposase itself, both of which are under control of the A. marginale transcriptional regulator (Am-Tr) promoter [6, 8]. This construct was complexed with dendrimers and subsequently incubated with A. phagocytophilum infected RF/6A or HL-60 cells. The earliest post transformation time point at which GFP-positive A. phagocytophilum organisms were detected within either host cell type was 72 h (Fig. 2). Less than 1% of host cells contained GFP-positive bacteria. Also starting at 72 h, the cultures were maintained under antibiotic selection. RT-PCR and RT-qPCR analyses conducted on total RNA isolated from RF/6A cells that had been incubated with dendrimer-plasmid conjugates detected abundant levels of transcripts encoding GFP and spectinomycin/streptomycin resistance at 72 and 144 h, but barely detected transcript for either target at 240 h (Fig. 3). Continued monitoring of both cultures by immunofluorescence microscopy infrequently detected GFP-positive ApVs for up to 4 weeks in RF/6A cells and 3 weeks in HL-60 cells.
Figure 2.
Dendrimers enable transformation of A. phagocytophilum inside host cells. Infected RF/6A or HL-60 cells were incubated with dendrimer-pCis GFPuv-SS Himar A7 plasmid complexes. At 72 h, the cells were fixed and analyzed by immunofluorescent microscopy to screen for GFP-expressing A. phagocytophilum organisms. Host cell and bacterial DNA was labeled with DAPI. Arrows indicate representative ApVs harboring GFP-positive bacteria. Results are representative of two to six experiments with similar results. DIC, differential interference contrast.
Figure 3.
Transformed A. phagocytophilum organisms express genes encoding GFP and spectinomycin/streptomycin resistance. (A) RT-PCR and (B and C) RT-qPCR analyses of A. phagocytophilum infected RF/6A cells that had been mock transformed, transformed with dendrimers only (G4), or transformed with dendrimer-pCis GFPuv-SS Himar A7 plasmid complexes (G4-GFP) were performed using gfp and aadA (aminoglycoside adenylyltransferase, which confers spectinomycin/streptomycin resistance) gene specific primers at 72, 144, and 240 h. (B and C) Relative transcript levels of each target were normalized to A. phagocytophilum 16s rRNA transcript levels. Each RT-qPCR reaction was performed in triplicate. Results are representative of two independent experiments.
3.3. Dendrimer-enabled transformation of host cell-free A. phagocytophilum organisms
Considering that the dendrimer-DNA complexes would have to cross the plasma membrane, ApV membrane, and bacterial cell wall to transform A. phagocytophilum, we assessed the ability of the complexes to transform extracellular bacteria. DC organisms isolated from infected HL-60 cells were incubated with the complexes and added to naïve HL-60 cells. ApVs harboring GFP-positive A. phagocytophilum organisms were detected beginning at 72 h (Fig. 4). Results regarding the transformation efficiency and period during which GFP-positive A. phagocytophilum organisms were detectable in culture were highly similar to those obtained by transforming the bacteria in host cells.
Figure 4.
Dendrimer-enabled transformation of host cell-free A. phagocytophilum organisms. A. phagocytophilum DCs were isolated from infected HL-60 cultures and treated with dendrimerpCis GFPuv-SS Himar A7 plasmid complexes, followed by incubation of the bacteria with naïve HL-60 cells. ApVs harboring GFP-positive A. phagocytophilum organisms were detected by immunofluorescence microscopy starting at 72 h post infection. P44 antibody was used to detect A. phagocytophilum bacteria. DAPI was used to stain host and bacterial DNA. The representative image was acquired on day 7.
4. Discussion
The limited options of genetic tools available for obligate intracellular bacteria have restricted investigation of these organisms’ molecular pathogenesis. Electroporation is the only method reported to transform Anaplasma spp [9, 10]. This method requires the isolation of bacteria from host cells, which likely contributes to its inefficiency, as only DCs are infectious [23] and the relative amenability of DCs versus RCs to electroporation is unknown. We demonstrated the applicability of PAMAM dendrimers for transforming A. phagocytophilum growing inside the ApV, an achievement similar to that for Chlamydia spp [11, 15, 18]. PAMAM dendrimers are worth considering as a tool for transforming other obligate intracellular bacteria that reside inside pathogen-occupied vacuoles. Given that gene-specific disruption methods for obligate intracellular bacteria are sub-optimal [25], dendrimers could be used to deliver asDNA oligos, as already explored for Chlamydia trachomatis [18], or constructs that encode asDNA against a pathogen gene of interest. Dendrimers can transform not only actively growing, intracellular non-infectious RCs but also metabolically less active, extracellular infectious DCs, making them worth considering as a means for transforming other intracellular bacteria that undergo biphasic development, such as Ehrlichia spp.
While dendrimers traverse into approximately 18% of ApVs, recovery of transformants was less than 1%, and recovered transformants could not be maintained beyond several passages. These results were consistent regardless of whether spectinomycin or spectinomycinstreptomycin selection was used for selection and are likely due to random Himar1 cassette disruption of A. phagocytophilum genes that are critical for intracellular fitness or infectivity. One way that the recovery process could be improved is by increasing the numbers of ApVs that dendrimers reach, which would potentially lead to more bacteria being transformed. Given that dendrimers have been functionally modified to improve their targeting of specific mammalian cell types and to enter via specific uptake pathways [26-31], it is reasonable to envision modification of dendrimers to enhance their specific targeting of the ApV. The work presented herein represents an essential first step in the path of developing dendrimers as a tool for effectively transforming A. phagocytophilum.
Figure 1.
FITC-conjugated dendrimers traffic into the ApV. A. phagocytophilum infected RF/6A cells that had been incubated with FITC-conjugated dendrimers were screened with P44 antibody and examined by immunofluorescence microscopy (A). Host cell and bacterial DNA were stained with DAPI. An arrow denotes a representative FITC-positive ApV. (B) Percentages of FITC positive ApVs at 0 and 6 h post incubation. Results are representative of two experiments with similar results. DIC, differential interference contrast.
Acknowledgements
We thank Ulrike Munderloh for providing pCis GFPuv-SS Himar A7 and Alan Hudson and Hérve C. Gérard for invaluable discussions. This study was supported by the National Institutes of Health (NIH) grant 2R01 AI072683. Laser-scanning confocal microscopy was performed at the VCU Department of Anatomy and Neurobiology Microscopy Facility, which is supported in part by funding from NIH-NINDS Center core grant 5P30NS047463 and NIH-NCI Cancer Center Support Grant (P30 CA016059).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of interest
None declared.
References
- 1.Beare PA, Sandoz KM, Omsland A, Rockey DD, Heinzen RA. Advances in genetic manipulation of obligate intracellular bacterial pathogens. Frontiers in microbiology. 2011;2:97. doi: 10.3389/fmicb.2011.00097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bielinska A, Kukowska-Latallo JF, Johnson J, Tomalia DA, Baker JR. Regulation of in vitro Gene Expression Using Antisense Oligonucleotides or Antisense Expression Plasmids Transfected Using Starburst PAMAM Dendrimers. Nucleic Acids Research. 1996;24:2176–82. doi: 10.1093/nar/24.11.2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Carlyon JA. Laboratory Maintenance of Anaplasma phagocytophilum. Curr Protoc Microbiol. 2005 doi: 10.1002/9780471729259.mc03a02s00. Chapter 3:Unit 3A 2. [DOI] [PubMed] [Google Scholar]
- 4.Carlyon JA, Ryan D, Archer K, Fikrig E. Effects of Anaplasma phagocytophilum on host cell ferritin mRNA and protein levels. Infection and immunity. 2005;73:7629–36. doi: 10.1128/IAI.73.11.7629-7636.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chen G, Severo MS, Sakhon OS, Choy A, Herron MJ, Felsheim RF, et al. Anaplasma phagocytophilum dihydrolipoamide dehydrogenase 1 affects host-derived immunopathology during microbial colonization. Infect Immun. 2012;80:3194–205. doi: 10.1128/IAI.00532-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Cheng C, Nair ADS, Indukuri VV, Gong S, Felsheim RF, Jaworski D, et al. Targeted and random mutagenesis of Ehrlichia chaffeensis for the identification of genes required for in vivo infection. PLoS pathogens. 2013;9:e1003171. doi: 10.1371/journal.ppat.1003171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Crosby FL, Brayton KA, Magunda F, Munderloh UG, Kelley KL, Barbet AF. Reduced Infectivity in cattle for an outer membrane protein mutant of Anaplasma marginale. Applied and environmental microbiology. 2015;81:2206–14. doi: 10.1128/AEM.03241-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Crosby FL, Wamsley HL, Pate MG, Lundgren AM, Noh SM, Munderloh UG, et al. Knockout of an outer membrane protein operon of Anaplasma marginale by transposon mutagenesis. BMC genomics. 2014;15:278. doi: 10.1186/1471-2164-15-278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Felsheim RF, Chavez AS, Palmer GH, Crosby L, Barbet AF, Kurtti TJ, et al. Transformation of Anaplasma marginale. Vet Parasitol. 2010;167:167–74. doi: 10.1016/j.vetpar.2009.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Felsheim RF, Herron MJ, Nelson CM, Burkhardt NY, Barbet AF, Kurtti TJ, et al. Transformation of Anaplasma phagocytophilum. BMC biotechnology. 2006;6:42. doi: 10.1186/1472-6750-6-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gérard HC, Mishra MK, Mao G, Wang S, Hali M, Whittum-Hudson JA, et al. Dendrimer-enabled DNA delivery and transformation of Chlamydia pneumoniae. Nanomedicine: Nanotechnology, Biology and Medicine. 2013;9:996–1008. doi: 10.1016/j.nano.2013.04.004. [DOI] [PubMed] [Google Scholar]
- 12.Haensler J, Szoka FC. Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjugate Chemistry. 1993;4:372–9. doi: 10.1021/bc00023a012. [DOI] [PubMed] [Google Scholar]
- 13.Huang B, Ojogun N, Ragland SA, Carlyon JA. Monoubiquitinated proteins decorate the Anaplasma phagocytophilum-occupied vacuolar membrane. FEMS Immunology & Medical Microbiology. 2012;64:32–41. doi: 10.1111/j.1574-695X.2011.00873.x. [DOI] [PubMed] [Google Scholar]
- 14.Huang B, Troese MJ, Howe D, Ye S, Sims JT, Heinzen RA, et al. Anaplasma phagocytophilum APH_0032 is expressed late during infection and localizes to the pathogen-occupied vacuolar membrane. Microbial pathogenesis. 2010;49:273–84. doi: 10.1016/j.micpath.2010.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kannan RM, Gerard HC, Mishra MK, Mao G, Wang S, Hali M, et al. Dendrimer-enabled transformation of Chlamydia trachomatis. Microb Pathog. 2013;65:29–35. doi: 10.1016/j.micpath.2013.08.003. [DOI] [PubMed] [Google Scholar]
- 16.Kukowska-Latallo JF, Bielinska AU, Johnson J, Spindler R, Tomalia DA, Baker JR., Jr. Efficient transfer of genetic material into mammalian cells using Starburst polyamidoamine dendrimers. Proceedings of the National Academy of Sciences of the United States of America. 1996;93:4897–902. doi: 10.1073/pnas.93.10.4897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lampe DJ, Churchill ME, Robertson HM. A purified mariner transposase is sufficient to mediate transposition in vitro. The EMBO journal. 1996;15:5470–9. [PMC free article] [PubMed] [Google Scholar]
- 18.Mishra MK, Gérard HC, Whittum-Hudson JA, Hudson AP, Kannan RM. Dendrimer-Enabled Modulation of Gene Expression in Chlamydia trachomatis. Molecular Pharmaceutics. 2012;9:413–21. doi: 10.1021/mp200512f. [DOI] [PubMed] [Google Scholar]
- 19.Najlah M, D'Emanuele A. Crossing cellular barriers using dendrimer nanotechnologies. Current opinion in pharmacology. 2006;6:522–7. doi: 10.1016/j.coph.2006.05.004. [DOI] [PubMed] [Google Scholar]
- 20.Omsland A, Cockrell DC, Howe D, Fischer ER, Virtaneva K, Sturdevant DE, et al. Host cell-free growth of the Q fever bacterium Coxiella burnetii. Proc Natl Acad Sci U S A. 2009;106:4430–4. doi: 10.1073/pnas.0812074106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Seidman D, Ojogun N, Walker NJ, Mastronunzio J, Kahlon A, Hebert KS, et al. Anaplasma phagocytophilum surface protein AipA mediates invasion of mammalian host cells. Cell Microbiol. 2014;16:1133–45. doi: 10.1111/cmi.12286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Shcharbin D, Shakhbazau A, Bryszewska M. Poly (amidoamine) dendrimer complexes as a platform for gene delivery. Expert opinion on drug delivery. 2013;10:1687–98. doi: 10.1517/17425247.2013.853661. [DOI] [PubMed] [Google Scholar]
- 23.Troese MJ, Carlyon JA. Anaplasma phagocytophilum dense-cored organisms mediate cellular adherence through recognition of human P-selectin glycoprotein ligand 1. Infect Immun. 2009;77:4018–27. doi: 10.1128/IAI.00527-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Truchan HK, Seidman D, Carlyon JA. Breaking in and grabbing a meal: Anaplasma phagocytophilum cellular invasion, nutrient acquisition, and promising tools for their study. Microbes Infect. 2013;15:1017–25. doi: 10.1016/j.micinf.2013.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wood DO, Wood RR, Tucker AM. Genetic systems for studying obligate intracellular pathogens: an update. Current opinion in microbiology. 2014;17:11–6. doi: 10.1016/j.mib.2013.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yang H, Kao WJ. Synthesis and characterization of nanoscale dendritic RGD clusters for potential applications in tissue engineering and drug delivery. International journal of nanomedicine. 2007;2:89–99. doi: 10.2147/nano.2007.2.1.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yang H, Lopina ST. Penicillin V-conjugated PEG-PAMAM star polymers. Journal of biomaterials science. Polymer edition. 2003;14:1043–56. doi: 10.1163/156856203769231556. [DOI] [PubMed] [Google Scholar]
- 28.Yang H, Lopina ST. Stealth dendrimers for antiarrhythmic quinidine delivery. Journal of materials science. Materials in medicine. 2007;18:2061–5. doi: 10.1007/s10856-007-3144-0. [DOI] [PubMed] [Google Scholar]
- 29.Yellepeddi VK, Kumar A, Palakurthi S. Surface modified poly (amido) amine dendrimers as diverse nanomolecules for biomedical applications. 2009 doi: 10.1517/17425240903061251. [DOI] [PubMed] [Google Scholar]
- 30.Yuan Q, Lee E, Yeudall WA, Yang H. Dendrimer-triglycine-EGF nanoparticles for tumor imaging and targeted nucleic acid and drug delivery. Oral oncology. 2010;46:698–704. doi: 10.1016/j.oraloncology.2010.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yuan Q, Yeudall WA, Yang H. PEGylated polyamidoamine dendrimers with bis-aryl hydrazone linkages for enhanced gene delivery. Biomacromolecules. 2010;11:1940–7. doi: 10.1021/bm100589g. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang L, Sankar U, Lampe DJ, Robertson HM, Graham FL. The Himar1 mariner transposase cloned in a recombinant adenovirus vector is functional in mammalian cells. Nucleic Acids Res. 1998;26:3687–93. doi: 10.1093/nar/26.16.3687. [DOI] [PMC free article] [PubMed] [Google Scholar]




