Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2015 Dec 2;5:17321. doi: 10.1038/srep17321

Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli

Li-Wen Zhu 1,*, Lei Zhang 1,*, Li-Na Wei 1, Hong-Mei Li 1, Zhan-Peng Yuan 1, Tao Chen 2, Ya-Ling Tang 3, Xin-Hua Liang 3, Ya-Jie Tang 1,a
PMCID: PMC4667291  PMID: 26626308

Abstract

In Escherichia coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. A two-step process is involved in CO2 integration: CO2 uptake into the cell and CO2 fixation by carboxylation enzymes. The phosphoenolpyruvate (PEP) carboxylase (PPC) and carboxykinase (PCK) are two important carboxylation enzymes within the succinate synthetic pathway, while SbtA and BicA are two important bicarbonate transporters. In this study, we employed a dual expression system, in which genes regulating both CO2 uptake and fixation were co-overexpressed, or overexpressed individually to improve succinate biosynthesis. Active CO2 uptake was observed by the expression of SbtA or/and BicA, but the succinate biosynthesis was decreased. The succinate production was significantly increased only when a CO2 fixation gene (ppc or pck) and a CO2 transport gene (sbtA or bicA) were co-expressed. Co-expression of pck and sbtA provided the best succinate production among all the strains. The highest succinate production of 73.4 g L−1 was 13.3%, 66.4% or 15.0% higher than that obtained with the expression of PCK, SbtA alone, or with empty plasmids, respectively. We believe that combined regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression may disturb the cellular metabolism and succinate production.


Succinic acid is a dicarboxylic acid produced as an intermediate of the tricarboxylic acid (TCA) cycle, and also as one of the fermentation products of anaerobic metabolism. It has also numerous applications in agricultural, food, and pharmaceutical industries1. It is classified as the most promising chemical among the 12 bio-based chemicals, by the US Department of Energy2.

Succinic acid is produced chemically via hydrogenation of maleic acid, or through fermentation of glucose from renewable feedstock. Recent studies have shown that Escherichia coli is another promising mean for succinic acid production, because the bacterium can be genetically engineered with relative ease, and has the advantage of fast growth3,4,5,6.

In E. coli, succinic acid is synthesized by CO2 fixation-based carboxylation of C3 metabolites. One of the most important C3 metabolites is phosphoenolpyruvate (PEP). PEP can be converted to oxaloacetic acid (OAA) by either PEP carboxylase (PPC) or PEP carboxykinase (PCK)7. And then OAA is further converted to succinate through malate dehydrogenase, fumarase, and fumarate reductase. Previous studies have demonstrated that overexpression of genes related to CO2 fixation, such as PPC8, PCK9 and pyruvate carboxylase (PYC)10, increases succinate production efficiently in E. coli. Because the PCK activity is subject to glucose catabolite repression in E. coli11, PPC is recognized as the primary enzyme for fermentative production of succinate12. Overexpression of ppc gene from Sorghum vulgare in E. coli strain SB2020 increased succinate production by 1.5 folds13.

Another critical step in succinic acid production is the CO2 uptake by cells. In E. coli, the active substrate of PPC is the bicarbonate anion HCO3− 14. CO2 crosses the cell membrane into the cytoplasm by passive diffusion, and is converted into HCO3− 14. The slow and passive diffusion of CO2 into cells is a limiting step for enhancing succinic acid production. Recently, several strategies were developed through increasing the concentration of CO2 in the fermentation broth14,15 or accelerating the intracellular conversion of dissolved CO2 into bicarbonate to improve the supply of HCO3, in order to enhance succinate production16. However, no literature has been found to improve succinate biosynthesis by directly enhancing HCO3 transmembrane transport in E. coli.

Several HCO3 active transporters have been discovered in cyanobacteria17,18. These HCO3 transporters actively transport HCO3 into cells, resulting in accumulation of HCO3 inside the cell. Two of the efficient transporters are represented by SbtA and BicA19. The Na+-dependent SbtA transporter was originally identified in the cyanobacterium, Synechocystis PCC6803. It is a single gene transporter with relatively high affinity for HCO3, requiring Na+ for maximal HCO3 uptake activity18. The BicA transporter is also Na+-dependent and unrelated to SbtA. It has a relatively low transport affinity but high flux rate19.

In an attempt to further enhance succinic acid production, we employed a dual expression system, in which genes regulating both PEP carboxylation and CO2 uptake were overexpressed individually or co-overexpressed. Our results showed that the best succinate production was attained only when one CO2 transport and one CO2 fixation gene were co-expressed. This work provides useful information for metabolic regulation of CO2 to improve succinate production.

Materials and Methods

Strains and plasmids

Strains and plasmids used in this study were summarized in Table 1. Primers were summarized in Table 2. E. coli strain DH5α was used for plasmid construction. Strain AFP111 was kindly provided by Prof. Clark, Southern Illinois University20. Synechocystis PCC6803 was provided by Prof. Xu, Institute of Hydrobiology, Chinese Academy of Sciences21 and used as the sbtA, bicA and ppc gene donor. Bacillus thuringiensis BMB171 was provided by Prof. Sun, Huazhong Agricultural University22 and used as the pck gene donor. Plasmids pTrc99A and pACYC184 were used as the foundation plasmids for construction and overexpression.

Table 1. Strains and plasmids used in this study.

Strains Relevant characteristics Sources or reference
AFP111 F + λ- rpoS396(Am) rph-1 ΔpflAB::Cam ldhA::Kan ptsG 20
Synechocystis PCC6803 Providing sbtA, bicA and ppc gene 21
Bacillus thuringiensis BMB171 A crystalliferous B. thuringiensis mutant, providing pck gene 22
DH5α F-φ80 lacZΔM15Δ(lacZYA-argF)U169 end A1 recA1 hsdR17(rk-,mk-) sup E44 λ-thi-1 gyrA96 relA1 phoA TransGen Biotech
Tang1501 AFP111/pACYC184 This study
Tang1502 AFP111/pTrc-ppc This study
Tang1503 AFP111/pACYC-pck This study
Tang1504 AFP111/pTrc-ppc + pACYC-pck This study
Tang1505 AFP111/pTrc99A This study
Tang1506 AFP111/pTrc-sbtA This study
Tang1507 AFP111/pTrc-bicA This study
Tang1508 AFP111/pTrc-bicA-sbtA This study
Tang1509 AFP111/pTrc99A + pACYC184 This study
Tang1510 AFP111/pTrc-ppc-bicA-sbtA This study
Tang1511 AFP111/pTrc-bicA-sbtA + pACYC-pck This study
Tang1512 AFP111/pTrc-ppc-sbtA + pACYC-pck This study
Tang1513 AFP111/pTrc-ppc-bicA + pACYC-pck This study
Tang1514 AFP111/pTrc-ppc-bicA-sbtA + pACYC-pck This study
Tang1515 AFP111/pTrc-ppc-sbtA This study
Tang1516 AFP111/pTrc-ppc-bicA This study
Tang1517 AFP111/pTrc-sbtA + pACYC-pck This study
Tang1518 AFP111/pTrc-bicA + pACYC-pck This study
Plasmids
pTrc99A ApR, pBR322 ori, trc promoter, lacIq Invitrogen
pTrc-sbtA pTrc99A with sbtA gene This study
pTrc-bicA pTrc99A with bicA gene This study
pTrc-bicA-sbtA pTrc99A with sbtA and bicA gene This study
pTrc-ppc pTrc99A with ppc gene This study
pTrc-ppc-sbtA pTrc99A with ppc and sbtA gene This study
pTrc-ppc-bicA pTrc99A with ppc and bicA gene This study
pTrc-ppc-bicA-sbtA pTrc99A with ppc, sbtA and bicA gene This study
pACYC184 catR, tetR, p15A ori NEB
pACYC-pck pACYC184 with trc promoter and pck gene This study

Table 2. Primers used in this studya.

Primer sets Relevant characteristics Sources
SbtA-SacI-H GACCGAGCTCATGGATTTTTTGTCCAATTTCTTGACGGACTTCGTGGG This study
SbtA-B-His GAAGGATCCTTAGTGATGGTGATGGTGATGACCTGCACCAAGGGTCTGGGC This study
BicA-EcoRI-H: GACGGAATTCATGCAAATAACTAACAAAATTCATTTTAGGAACCTGCAGGGGGA This study
BicA-B-His GAAAGGATCCTTAATGGTGATGGTGATGGTGGTATGTGGTCTGGACGGAAG This study
P-trc-XbaI GCCTCTAGATGACAATTAATCATCCGGCTCGTATAATGTGTGG This study
SbtA-SalI-His GACGTCGACTTAGTGATGGTGATGGTGATGACCTGCACCAAGGG This study
ppc-EcoRI CCGGAATTCGATATGAACTTGGCAGTTCCTGCATTCGG This study
ppc-BamHI ACCGGATCCTCAACCAGTATTACGCATTCCGGCCGC This study
BicA-salI GGTCGACTTAATGGTGATGGTGATGGTGGTATGTGGTCTGG This study
BamHI-SD-BicA GACGGGATCCAGGAGGATGCAAATAACTAACAAAATTCATTTTAGGAACC This study
BicA-XbaI GATTTCTAGATTAATGGTGATGGTGATGGTGGTATGTGGTCTGGACGGAAG This study
pck-SacI CGAGCTCATGCGAAATGAAGGGAAATT This study
pck-HindIII CCCAAGCTTTTAAGCGATTGGACCGCCTA This study
trc-pck-DrdI CGCGACATCGAAGTCGCAGGTCGTAAATCACTGC This study
trc-pck-BclI CGCTGATCATTAAGCGATTGGACCGCCTAAG This study
SbtA-F(RT) GCATGGCAATTCGGAACTCCAAC This study
SbtA-R(RT) CAGCCATTGTAGAGCCACTGACTG This study
BicA-F(RT) CAGGGCATCGGCAATGTAATGTC This study
BicA-R(RT) GAATGGTAGCCGCCAATTTAGCTG This study
PCK-F(RT) TTTGCAGGCGCTGACCGCAATTAC This study
PCK-R(RT) CAGCTGGATCAGCTTTGAAGTTCG This study
PPC-F(RT) AACCATTGCCAGTGGGCATTGAC This study
PPC-R(RT) CCGGATGGTGTGACGGACAATTTC This study
16S rRNA-F GCTAATACCGCATAACGTCGCAAG This study
16S rRNA-R GGACCGTGTCTCAGTTCCAGTGTG This study

aItalic and bold bases encode restriction site and underlined bases encode 6 * His tag.

Plasmid construction procedure

The sbtA was amplified from Synechocystis PCC6803 genome by polymerase chain reaction (PCR). All PCRs were carried out based on the manufacturer’s recommended conditions (Bio-Rad, USA). The forward and reverse primers is SbtA-SacI-H and SbtA-B-His, respectively (Table 2). The PCR product was digested with SacI and BamHI and ligated into the plasmid pTrc99A. The ligated, ampicillin (Amp) resistant vector was designated as pTrc-sbtA. The bicA was amplified from Synechocystis PCC6803 genome by PCR with primer BicA- EcoRI-H and BicA-B-His (Table 2) and was digested with EcoRI and BamHI, and then ligated into the plasmid pTrc99A (designated as pTrc-bicA). The trc-sbtA was amplified from pTrc-sbtA by PCR with primers P-trc-XbaI and SbtA-SalI-His and digested with XbaI and SalI and then ligated into the plasmid pTrc-bicA (designated as pTrc-bicA-sbtA). The ppc gene was amplified from Synechocystis PCC6803 genome by PCR with primers ppc-EcoRI and ppc-BamHI, digested with EcoRI and BamHI and then ligated into the plasmid pTrc99A (designated as pTrc-ppc). The trc-sbtA was digested with XbaI and SalI and then ligated into the plasmid pTrc-ppc (designated as pTrc-ppc-sbtA). The bicA was amplified by PCR with primers BamHI-SD-BicA and BicA-XbaI, digested with XbaI and BamHI and then ligated into the plasmid pTrc-ppc (designated as pTrc-ppc-bicA). The trc-sbtA was digested with XbaI and SalI and then ligated into the plasmid pTrc-ppc-sbtA (designated as pTrc-ppc-bicA-sbtA). The pck was amplified from Bacillus thuringiensis BMB171 genome by PCR with primers pck-SacI and pck-HindIII. The PCR product was digested with SacI and HindIII and then inserted into the plasmid pTrc99a yielding the recombinant plasmid pTrc-pck. To construct plasmid pACYC-trc-pck, the pck expression cassette with promoter trc from plasmids pTrc-pck was digested with DrdI and BclI, and then ligated into the plasmid pACYC184 yielding the plasmid pACYC-trc-pck. All plasmids were introduced into E. coli AFP111 strain by chemical transformation. The colonies were screened by PCR amplification and confirmed for cloning accuracy by DNA sequence analysis. The transformants were designated as Tang1501 to Tang1518 (Table 1).

Expression and detection of membrane protein

Cells of E. coli AFP111 transformed with various plasmids were grown in LB medium (10 g L−1 tryptone, 5 g L−1 yeast extract, and 5 g L−1 NaCl) at 37 °C to OD600 = 1.0. Gene overexpression was induced by addition of 10 μM isopropyl-β-D- thiogalactopyranoside (IPTG) (Biosharp) and grew overnight. Cells were centrifuged at 4,600 × g for 15 min and pellets were resuspended in phosphate-buffered saline (PBS) (pH 7.4). Cells were sonicated on ice for 15 min (a working period of 5 s in a 7-s interval for each cycle) at a power output of 200 W by an ultrasonic disruptor (J92-II, Xinzhi, Ningbo, China). Unbroken cells were removed by centrifugation at 10,000 × g for 15 min. Supernatant was further centrifuged at 100,000 × g for 60 min. Finally, pellets (membranes) were resuspended in 100 mM Tris buffer (pH 6.8) (ANGUS), 10% β-mercaptoethanol (AMRESCO), 4% Sodium dodecyl sulfate (SDS) (Biosharp) and stored at −80 °C.

The membrane proteins (SbtA and BicA) isolated from cells were fractionated through 10% SDS-polyacrylamide gel and electrotransferred to a polyvinylidene fluoride membrane for Western blot analysis. The membrane was incubated at room temperature for 2 h with a mouse His-tag monoclonal antibody (Jackson, USA) at a dilution of 1:2000, rinsed, and then incubated with alkaline phosphatase (AP) labeled goat anti-mouse IgG secondary antibody (Jackson, USA) at room temperature for 2 h at a dilution of 1:2000.

HCO3 transport activity

HCO3 transport was determined by radioactive NaH14CO323. Gene overexpression was induced by addition of 10 μM IPTG and cultured overnight. Cells were centrifuged at 4,600 × g for 15 min and pellets were resuspended in fresh fermentation medium (pH 7.0) (Composition of medium was listed in section 2.6) to OD600 = 10.0. A stock solution of radioactive NaH14CO3 (China Isotope and Radiation Corporation) in NaHCO3 (5 mM, 1.0 μCi μL−1) was added to cells at a final concentration of 0.185 mM. Cells were mixed and 50 μL aliquots were transferred to centrifuge tubes and incubated at 37 °C. Bicarbonate uptake was stopped by adding 1 mL non-radioactive NaH12CO3 (0.5 M). The cells were collected through filter membrane (0.45-μm, Jinteng, China) and the radioactivity was determined in a scintillation counter (Perkin Elmer, USA).

RT-qPCR

Cells of E. coli AFP111 transformed with plasmids were collected at 14 h during the dual-phase fed-batch fermentation. The total RNA was extracted with Bacterial RNA Kit (Omega). The total RNA fragments were reverse-transcribed into cDNA by using PrimeScriptTM RT reagent Kit (Takara). 16 S rRNA was selected as the endogenous control. All cDNA samples were diluted to a final concentration of 10 ng/μL. Two-Step RT-PCR Kit with SYBR green was used with a thermal cycler (iCycler, Bio-Rad) for RT-qPCR. Primers were used at a final concentration of 0.2 μM, and 10 ng of cDNA was used as template in each 20 μL reaction. The threshold cycles for each sample were calculated from the fluorescence data with proprietary software (Bio-Rad). The fold changes for comparing the relative gene expression levels to those of the controls in the different tissues and at the different developmental stages were determined using the 2−ΔΔCt method. We defined a threshold value, i.e. increases greater than 2-fold in the amount of transcripts relative to empty plasmids control samples were considered significant.

Measurements of enzyme activity

Crude extracts for all enzyme assays were prepared by harvesting 10 mL of the cell culture from the reactor by centrifugation at 4,600 × g and 4 °C for 10 min. After resuspending the cell pellets with 100 mM Tris-HCl, (pH 7.4), cells were sonicated on ice for 8 min (a working period of 8 s in a 3-s interval for each cycle) at a power output of 200 W by an ultrasonic disruptor (J92-II, Xinzhi, Ningbo, China). Cell debris was removed by centrifugation at 10,000 × g for 20 min at 4 °C. The supernatant was further centrifuged at 10,000 × g for 10 min and the resulting supernatant was used to assay enzyme activity. The PEP carboxylase (PPC) and PEP carboxykinase (PCK) activities were assayed by measuring the changes of NADH using absorbance at 340 nm24. PPC was monitored in a 100 μL reaction mixture containing: 66 mM Tris-HCl (pH 9.0), 10 mM MgCl2, 10 mM NaHCO3, 0.15 mM NADH (Biosharp), 0.4 U malate dehydrogenase (Amresco), and 10 μL cell extract. The PCK activity was determined in a 100 μL mixture containing: 100 mM Tris-HCl (pH 7.8), 75 mM NaHCO3, 16 mM MgCl2, 10 mM ADP (Biosharp), 0.2 mM NADH, 0.4 U malate dehydrogenase, and 10 μl cell extract24. The mixture was incubated for 15 min at 37 °C to activate PPC or PCK, after which the reaction was started by the addition of 5 mM PEP. 1 U of PPC or PCK activity was defined as the amount of enzyme needed to oxidize 1 μM NADH per min at room temperature. The total protein concentration in crude cell extract was measured by Bradford’s method25 with bovine serum albumin as a standard. Enzyme assays were performed in triplicate, and if the discrepancy was greater than 10%, another pair of assays was performed.

Fed-batch culture

During strain construction, cells of E. coli AFP111 were grown aerobically at 37 °C in LB medium. Preculture and fermentation medium consisted of the following components (g L−1): glucose, 35; yeast extract, 10; tryptone, 20; K2 HPO4·3 H2O, 0.90; KH2PO4, 1.14; (NH4)2SO4, 3.0; MgSO4·7 H2O, 0.30 and CaCl2·2 H2O, 0.25. Antibiotics were included as necessary at the following concentrations: 100 μg mL−1 ampicillin, 50 μg mL−1 kanamycin, and 10 μg mL−1 chloroamphenicol. Protein expression was induced by the addition of IPTG to a final concentration of 10 μM.

The first pre-culture medium (50 mL) was prepared in a 250-mL flask, and a colony from a plate culture was inoculated and incubated for 12 h at 37 °C on a rotary shaker at 250 rpm. For the second pre-culture, 50 mL of pre-culture medium was prepared in a 250-mL flask, inoculated with 100 μL of the first pre-culture broth and incubated for 12 h at 37 °C on a rotary shaker at 250 rpm.

Dual-phase fed-batch fermentation was conducted with 5 L of initial fermentation medium in a 7.5 L Bioflo 115 fermenter (New Brunswick Scientific). A 5% (v v−1) inoculum was used from the second preculture. At the beginning of the aerobic growth phase, 35 g L−1 glucose was added. During growth, oxygen-enriched air (DA-5001, Dynamic, China) was sparged at 0.1–0.4 vvm under agitation of 300–800 rpm to maintain the dissolved oxygen (DO) above 40%. When its concentration dropped below 1 g L−1, the aerobic growth phase was terminated by switching the inlet gas composition to oxygen-free CO2 at 0.2 mL min−1. The pH was controlled at 7.0 with 20 g L−1 MgCO3 and 5 M NaOH. Agitation was reduced to 400 rpm and initial glucose was maintained at 40 g L−1. When the residual sugar concentration dropped below 10 g L−1, a concentrated sterile glucose solution (800 g L−1) was fed into the media to maintain the residual glucose concentration around 40 g L−1.

Determination of cell mass and measurements of residual sugar and succinate concentration were performed as previously reported26.

Six cultures were carried out simultaneously in stirred-tank bioreactors with different engineered strains under identical experimental conditions, which ensured accurate head-to-head comparisons. The results presented here were reproducible in another experiment (data not shown).

Succinate determination

For succinate determination, 1 mL of methanol and 1 mL of acetonitrile were added to 1 mL of fermentation broth to remove proteins, and the sample was incubated at 4 °C overnight. After centrifugation at 10,800 × g for 30 min, the supernatants were filtered through a 0.22-μm filter and analyzed by high-performance Dionex Ultimate 3000 liquid chromatographer (Thermo Scientific) using a Reprosil-Pur Basic C18 column. The optimized mobile phase was 5 mM KH2PO4 water solution, with pH adjusted to 2.8 by H3PO4. The column oven temperature was maintained at 40 °C, and the flow rate was maintained at 1 mL min−1. The detection wave was 210 nm.

Data analyses

All experiments were performed in triplicate. Data were expressed as means ± standard deviations, and they were analyzed using SPSS 19.0 for Windows software. One-way analysis of variance was performed. Scheffe multiple comparison procedure (alpha ≤ 0.05) was used for individual variables to compare means and to assess significant differences.

Results and Discussion

Individual regulation of CO2 fixation or transport

Effect of PPC and PCK on succinate production

PEP carboxylation is one of the rate-limiting reactions in succinate production27. To improve succinate production, ppc from Synechocystis PCC6803 and pck from B. thuringiensis BMB171 were overexpressed individually or in combination.

As shown in Fig. 1a–c, overexpression of ppc or/and pck apparently failed to affect cell growth, pattern of glucose consumption and succinate biosynthesis significantly. The succinate production obtained with Tang1501 (pACYC184), Tang1502 (ppc), Tang1503 (pck), and Tang1504 (ppc and pck) was between 62.6 and 67.3 g L−1. The concentrations of succinate were decreased after 70 or 80 h. Although carbon source feeding was performed, nitrogen sources, inorganic salts and vitamins may be insufficient at the end of the fermentation. Lack of nutrients may limit cellular activity and metabolic efficiency. There was a similar phenomenon could be observed in the previous report28.

Figure 1.

Figure 1

Effect of CO2 fixation genes expression on the cell growth (a), glucose consumption (b), the succinate production (c), relative expression levels of ppc and pck (d), and the enzyme activities of the PCK and PPC (e) in fed-batch fermentation. Symbols for E. coli strains: Tang1501 (pACYC184) (open triangle, Inline graphic), Tang1502 (ppc) (black triangle, Inline graphic), Tang1503 (pck) (open circle, ○), Tang1504 (ppc and pck) (black circle, Inline graphic). Error bars show standard deviation (n = 3). Different letters (e.g., a–c) were assigned to significantly different groups, and for the results between two groups, a combination of the two corresponding letters was used (e.g., a,b).

The RT-qPCR analysis indicated that ppc and pck was overexpressed. Although the expression of ppc and pck exhibited 43.7- to 90.9-fold higher levels compared with that of empty plasmid control (Fig. 1d), and the activity of PPC and PCK was significantly improved by individual or combined expression of ppc and pck genes (Fig. 1e). The overexpression of PPC and/or PCK showed insignificantly improved effect on the succinate biosynthesis (Fig. 1c). It was probably due to low substrate supply. As the substrate for carboxylation enzyme, the diffusion of HCO3 through the cell membrane was the key limiting process for succinate formation14. Permeation of HCO3 through the lipid membrane is insignificant. Therefore, the speed and flux of substrate supply might be limited by the passive diffusion transportation mode of HCO3. Although the activity of carboxylation enzyme was increased, it was difficult to improve the carboxylation reaction flux due to insufficient HCO3.

Overexpression of BicA or SbtA significantly increases HCO3 uptake but decreases succinate production

In order to increase the HCO3 uptake, two heterogeneous HCO3 transport genes of Synechocystis PCC6803, bicA and sbtA were overexpressed in E. coli AFP111 cells. The BicA and SbtA were chosen for their highly conserved adaptability for CO2 assimilation, and for the relative ease of genetic manipulation compared with other transporters.

In this work, a trc promoter was used to control the BicA and SbtA expression, so their expression levels were not affected by environmental factors, such as inorganic carbon species19,29, or light30,31. As shown in Fig. 2a, no BicA or SbtA expression was detected in Tang1505 (pTrc99A), while both BicA and SbtA were detected in Tang1508 (sbtA and bicA), indicating the feasibility of overexpression of these genes in E. coli. Overall, the expression of BicA was higher than that of SbtA. It was probably due to a wider codon adaptation and more stable mRNA of bicA (data not shown). From the transcription level, the expression of bicA was higher, correspondingly more BicA was synthetized. On the other hand, BicA is distinguishable as an extant member of the SulP family of anion transporters in eukaryotes and prokaryotes32,33. Some close homologs of BicA had been proved existing in several bacteria with high identity19. The reason why BicA could be better expressed in E. coli than SbtA, was probably because there is BicA homolog in E. coli.

Figure 2.

Figure 2

BicA and SbtA expression via His tag (a) and the uptake of HCO3 in E. coli AFP111 (b). Overexpressed proteins were detected by western-blots. Lane 1: Tang1505 (pTrc99A), lane 2: Tang1506 (sbtA), lane 3: Tang1507 (bicA), lane 4: Tang1508 (sbtA and bicA). M corresponds to the molecular weight marker lanes. Symbols for E. coli strains: Tang1505 (pTrc99A) (open triangle, Inline graphic), Tang1506 (sbtA) (black triangle, Inline graphic), Tang1507 (bicA) (open circle, ○), Tang1508 (sbtA and bicA) (black circle, Inline graphic).

As shown in Fig. 2b, HCO3 transport activity was significantly improved in overexpression of sbtA (Tang1506), bicA (Tang1507) or both (Tang1508). After the expression of SbtA or BicA, the active transport system of HCO3 was introduced into E. coli and the E. coli cells acquired the ability for active HCO3 transportation. The highest transport flux of 71.08 μmol HCO3 g−1 cell was obtained with Tang1506 (sbtA). It was 1.4-times higher than that of Tang1505 (pTrc99A). The HCO3 uptake in cells overexpressing BicA was lower than that of SbtA expressing cells. It were different from previous reports. In cyanobacteria, BicA has a moderate photosynthetic uptake affinity for HCO3 (K0.5 of ≈38 μM). It was able to support a high photosynthetic flux rate, while the SbtA transporter supported a low flux rate but with a high uptake affinity (K0.5 < 2 µM)19.

As shown in Fig. 3a, overexpression of bicA and/or sbtA hinders cell growth, and the inhibitory effect of SbtA on cell growth was less than that caused by BicA. It probably due to the highly detrimental effect on the host cells caused by the overexpression of the membrane protein34. The expression of BicA was higher than that of SbtA. The increased expression of heterologous membrane proteins interferenced the cellular morphology and function. As a result, cell growth was negatively affected. The time profiles of glucose obtained by mutants were similar, except for Tang1507 (bicA) (Fig. 3b).

Figure 3.

Figure 3

Time courses of dry cell weight (a), residual sugar concentration (b), the production of succinate (c), relative expression levels of sbtA, bicA, ppc and pck (a), and the specific activities of the PCK and PPC (e) under the expression of the HCO3 transporters in fed-batch fermentation. T The symbols for E. coli strains are the same as those in Fig. 2. Error bars show standard deviation (n = 3). Different letters (e.g., (a,b)) were assigned to significantly different groups, and for the results between two groups.

The effect of the expression of BicA and SbtA on succinate production was shown in Fig. 3c. It showed that overexpression of BicA or SbtA, or both had a negative effect on the succinate biosynthesis. One possible reason for this decrease was attributed to the negative effect associated with the high concentration of HCO3 on the overall cell metabolism. BicA and SbtA are both Na+-dependent HCO3 transporters18,19. Adequate Na+ levels were provided by the NaOH, which was used to control pH, to ensure steady expression of the transporters. HCO3 accumulated in the cell, while CO2 fixation was not enhanced to effectively fix the intracellular HCO3. Thus the original intracellular metabolic environment was disordered by the increased intracellular pH, which was caused by the increased intracellular HCO3. This observation was supported by the slower cell growth (Fig. 3a).

As shown in Fig. 3d, when the two genes were expressed, the sbtA and bicA was up-regulated by 8- to 618-fold, respectively. And when sbtA was expressed, pck was up-regulated by 2.1-fold and 2.4-fold. Correspondingly, the enzyme activity of PCK in Tang1506 (sbtA) (0.16 U mg−1) or Tang1508 (sbtA and bicA) (0.16 U mg−1) was higher than that in Tang1505 (pTrc99A) (0.12 U mg−1) (Fig. 3e). This suggested that the PCK was activated by the expression of SbtA, but not BicA. No significant difference of PPC enzyme activity was found among the different strains (P > 0.05).

Collaborative metabolic regulation of CO2 transport and fixation

Co-expression of CO2 transport and CO2 fixation genes

Succinate production involves two major steps: CO2 uptake and CO2 fixation. To achieve higher production of succinate, the two steps should be in succession, linked closely and complementing each other. To investigate whether the activation of CO2 transport and CO2 fixation had a synergistic effect in improving succinate production, co-expression of both genes was carried out by the combined expression of 1) two transport genes coupled with one fixation gene; 2) two fixation genes coupled with one transportation gene; and 3) two transport genes coupled with two fixation genes.

As shown in Fig. 4a, all strains showed similar rates of dry cell weight increase. The glucose consumption rates of Tang1512 (sbtA, ppc and pck) and Tang1513 (bicA, ppc and pck) were lower than that of Tang1509 (pTrc99A and pACYC184), Tang1510 (sbtA, bicA and ppc) or Tang1511 (sbtA, bicA and pck) (Fig. 4b). As shown in Fig. 4c, the highest succinate production (57.9 g L−1) among the strains that expressed any combination of genes was obtained from Tang1511 (sbtA, bicA and pck), which was still lower than that of Tang1509 (pTrc99A and pACYC184). Correspondingly, lower succinate productivity and succinate yield on dry cell weight (DCW) was also observed when multiple CO2 transport and fixation genes were overexpressed (Table 3). Compared with the succinate production obtained by CO2 transport overexpression (34.8–44.1 g L−1), when the CO2 transport and CO2 fixation genes were co-expressed, succinate production was improved (49.9–57.9 g L−1). It probably because HCO3 transported into cells under the overexpression of transport proteins was promptly fixed. The metabolic disturbance caused by high concentration of intracellular HCO3 was partially eliminated. However, the negative effect caused by membrane protein expression still exists. It suggested that the flux of transportation or fixation was still uncoordinated and unstable. It also suggests that a better coordinated regulation of CO2 transport and CO2 fixation is important in metabolism.

Figure 4.

Figure 4

Time courses of dry cell weight (a), residual sugar concentration (b) and the production of succinate (c), relative expression levels of sbtA, bicA, ppc and pck (d), and the specific activities of the PCK and PPC (e) under the collaborative expression of multiple HCO3 transporters and CO2 fixation genes in fed-batch fermentation. Symbols for E. coli strains: Tang1509 (pTrc99A and pACYC184) (open triangle, Inline graphic), Tang1510 (sbtA, bicA and ppc) (black triangle, Inline graphic), Tang1511 (sbtA, bicA and pck) (open circle, ○), Tang1512 (sbtA, ppc and pck) (black circle, Inline graphic), Tang1513 (bicA, ppc and pck) (open square, Inline graphic), Tang1514 (sbtA, bicA, ppc and pck) (black square, Inline graphic). Different letters (e.g., (a–c)) were assigned to significantly different groups, and for the results between two groups, a combination of the two corresponding letters was used (e.g., a,b and b,c).

Table 3. Effect of collaborative regulation of CO2 transportation and fixation on the production of succinate.
Strains Succinate productivity (g L−1 h−1) Succinate yield on DCW (g g−1 DCW)a Succinate yield on glucose (g g−1 glucose)
Tang1509 (pTrc99A and pACYC184) 0.96 4.82 0.54
Tang1510 (sbtA, bicA and ppc) 0.72 3.22 0.38
Tang1511 (sbtA, bicA and pck) 0.69 4.02 0.39
Tang1512 (sbtA, ppc and pck) 0.95 3.54 0.60
Tang1513 (bicA, ppc and pck) 0.88 3.49 0.57
Tang1514 (sbtA, bicA, ppc and pck) 0.79 3.34 0.53
Tang1515 (sbtA and ppc) 0.99 4.80 0.49
Tang1516 (bicA and ppc) 0.74 4.54 0.46
Tang1517 (sbtA and pck) 1.08 4.94 0.58
Tang1518 (bicA and pck) 0.87 3.58 0.42

aAt an OD600 of 1.0, E. coli has a concentration of 0.44 g dry cell weight per liter.

As shown in Fig. 4d, when the CO2 transport and fixation genes were individually or combinedly expressed, the sbtA, bicA, ppc or pck was up-regulated by more than 2-fold, correspondingly. The significant higher activity of PCK was obtained by recombined strains, and the overexpression of PPC and/or PCK showed insignificantly improved effect on the succinate biosynthesis (Fig. 4e).

Co-expression of single CO2 transport and fixation gene

In order to find out the best combination of CO2 transport and CO2 fixation that has a synergistic effect in improving succinate production, we further investigated the expression of single transport gene coupled with single fixation gene. As shown in Fig. 5a, the biomass production was similar, except that Tang1517 (sbtA and pck) grew slightly better, which may be due to the increased HCO3 supplement and increased PCK activity leading to more active cell metabolism. The higher PCK activity leads to more OAA and ATP formation, and the energy conserved by PCK was beneficial for cell growth. In addition, no significant difference was observed for glucose consumption among the four strains, Tang1515 (sbtA and ppc), Tang1516 (bicA and ppc), Tang1517 (sbtA and pck) and Tang1518 (bicA and pck) (Fig. 5b).

Figure 5.

Figure 5

Time courses of dry cell weight (a), residual sugar concentration (b), the production of succinate (c), relative expression levels of sbtA, bicA, ppc and pck (d), and the specific activities of the PCK and PPC (e) under the collaborative expression of single HCO3 transporter and single CO2 fixation gene in fed-batch fermentation. Symbols for E. coli strains: Tang1515 (sbtA and ppc) (black triangle, Inline graphic), Tang1516 (bicA and ppc) (open circle, ○), Tang1517 (sbtA and pck) (black circle, Inline graphic), Tang1518 (bicA and pck) (open square, Inline graphic). Error bars show standard deviation (n = 3). Different letters (e.g., (a–e) were assigned to significantly different groups, and for the results between two groups.

The succinate production was also greatly improved when a single transport and a single fixation gene were co-expressed (Fig. 5c). The highest succinate production was 73.4 g L−1 from Tang1517 (sbtA and pck), which was 13.3%, 66.4% and 15.0% higher than that obtained from Tang1503 (pck), Tang1506 (sbtA) and Tang1509 (pTrc99A and pACYC184), respectively. This result indicates that the best combination of transport and fixation genes was represented by sbtA and pck. HCO3 transported into cells under the overexpression of SbtA was promptly fixed by PCK. Transport and fixation flux balanced. In addition, the succinate productivity, succinate yield on DCW and succinate yield on glucose obtained by Tang1517 attained the highest value (Table 3). When bicA was co-expressed with ppc (Tang1516) or pck (Tang1518), succinate production was lower than that obtained by Tang1509 (pTrc99A and pACYC184). However, compared with the succinate production obtained from Tang1507 (bicA) (Fig. 3c), the inhibitory effect on succinate biosynthesis caused by BicA alone was attenuated by combined expression with CO2 fixation gene. It suggested that the collaborative metabolic regulation was effective on improving the utilization rate of CO2.

As shown in Fig. 5d, when the CO2 transport and fixation gene were combinedly expressed, the sbtA, bicA, ppc or pck was up-regulated by more than 2-fold, correspondingly. The PCK activities of Tang1515 (sbtA and ppc), Tang1516 (bicA and ppc), Tang1517 (sbtA and pck) and Tang1518 (bicA and pck) were 0.19, 0.16, 0.22, and 0.14 U mg−1 protein, respectively (Fig. 5e). This result was positively correlated with the succinate biosynthesis (Fig. 5c). The corresponding PPC activities were 0.14, 0.10, 0.11, and 0.15 U mg−1 protein, respectively. When sbtA and ppc were expressed together, there was no obvious improvement in PPC activity probably due to various factors affecting the activity of PPC, such as aspartate and citrate35. On the other hand, PPC has a Km for bicarbonate of 0.1 μM, whereas PCK has a Km for bicarbonate of 13 μM36,37. PPC is more sensitive to the concentration of bicarbonate than PCK, and carries out PEP carboxylation at a lower concentration of HCO3. As the active substrate for PPC, when the concentrations of intracellular HCO3 was at a high level, PPC activity was likely limited owing to substrate inhibition.

PCK catalyzed the reaction at a higher concentration of HCO3− 14. As previously reported, when 20 g L−1 of NaHCO3 was added, succinic acid production in recombinant E. coli overexpressing PCK was 2.2-fold higher than that observed in the wild-type strain38. Interestingly, we noted that when SbtA was expressed, PCK was activated (Fig. 3d,e). It may be the reason why the higher activity of PCK reached the peak value when sbtA and pck were expressed together.

Conclusions

To improve succinate production, two sets of genes, one for CO2 fixation (ppc and pck) and another for CO2 transport (sbtA and bicA), were overexpressed individually or in various combinations in E. coli. Our results showed that overexpression of either set of genes individually did not improve succinate production. To our surprise, when the two sets of genes (at least 3 genes) were co-expressed, no improvement on succinate production was observed. However, when only one gene from each gene set was co-expressed, succinate production was significantly increased, especially for gene combination of pck and sbtA, which reached the highest succinate production (73.4 g L−1) compared with other strains. Based on our results, we believe that collaborative regulation of CO2 transport and fixation is critical for succinate production. Imbalanced gene expression located upstream and downstream of the metabolic pathway may cause harmful effects to cell growth and succinate production.

Additional Information

How to cite this article: Zhu, L.-W. et al. Collaborative regulation of CO2 transport and fixation during succinate production in Escherichia coli. Sci. Rep. 5, 17321; doi: 10.1038/srep17321 (2015).

Acknowledgments

Financial supports from the National Natural Science Foundation of China (NSFC, Project Nos. 21176059, 21206035, 21376066, 81503112, 21506049, and 31570054), and Hubei Provincial Natural Science Foundation for Innovative Research Team (2015CFA013) are gratefully acknowledged. Prof. Ya-Jie Tang also thanks the National High Level Talents Special Support Plan (“Million People Plan”) by the Organization Department of the CPC Central Committee (2014), Training Program for Top Talents in Hubei Province (2013), and Training Program for Huanghe Talents in Wuhan Municipality (2014).

Footnotes

Author Contributions Y.J.T. conceived the project. L.W.Z. designed the experiments, L.W.Z., L.Z. and L.N.W implemented the analysis workflow and conducted the experiments. L.W.Z., H.M.L., Z.P.Y. and T.C. analyzed and interpreted the results, Y.L.T. and X.H.L. prepared all figures and tables, L.W.Z. and Y.J.T. prepared and wrote the manuscript. All authors reviewed, commented on, and approved the final manuscript.

References

  1. Zeikus J. G., Jain M. K. & Elankovan P. Biotechnology of succinic acid production and markets for derived industrial products. Appl. Microbiol. Biotechnol. 51, 545–552 (1999). [Google Scholar]
  2. Werpy T. A. & Petersen G. Top Value Added Chemicals From Biomass. Washington, DC. US Department of Energy (2004). Available at: http://www1.eere.energy.gov/biomass/pdfs/35523.pdf [Google Scholar]
  3. Chatterjee R., Cynthia S. M., Kathleen C., David P. C. & Donnelly M. I. Mutation of the ptsG gene results in increased production of succinate in fermentation of glucose by Escherichia coli. Appl. Environ. Microbiol. 67, 148–154 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Vemuri G. N., Eiteman M. A. & Altman E. Succinate production in dual-phase Escherichia coli fermentations depends on the time of transition from aerobic to anaerobic conditions. J. Ind. Microbiol. Biotechnol. 28, 325–332 (2002). [DOI] [PubMed] [Google Scholar]
  5. Jantama K. et al. Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate. Biotechnol. Bioeng. 99, 1140–1153 (2008). [DOI] [PubMed] [Google Scholar]
  6. Sánchez A. M., Bennett G. N. & San K. Y. Novel pathway engineering design of the anaerobic central metabolic pathway in E. coli to increase succinate yield and productivity. Metab. Eng. 7, 229–239 (2005). [DOI] [PubMed] [Google Scholar]
  7. Unden G. & Kleefeld A. Escherichia coli and Salmonella: Cellular and Molecular Biology, eds Bock A. et al. (ASM Press, Washington, DC), Chapter 3.4.5 (2004). [Google Scholar]
  8. Tan Z., Zhu X., Chen J., Li Q. & Zhang X. Activating phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in combination for improvement of succinate production. Appl. Environ. Microbiol. 79, 4838–4844 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Zhang X., Jantama K., Shanmugam K. T. & Ingram L. O. Reengineering Escherichia coli for succinate production in mineral salts medium. Appl. Environ. Microbiol. 75, 7807–7813 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Thakker C., Zhu J., San K. Y. & Bennett G. Heterologous pyc gene expression under various natural and engineered promoters in Escherichia coli for improved succinate production. J. Biotechnol. 155, 236–243 (2011). [DOI] [PubMed] [Google Scholar]
  11. Goldie H. Regulation of transcription of the Escherichia coli phosphoenolpyruvate carboxykinase locus: Studies with pck-lacZ operon fusions. J. Bacteriol. 159, 832–36 (1984). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Karp P. D. et al. Multidimensional annotation of the Escherichia coli K-12 genome. Nucleic Acids Res. 35, 7577–7590 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lin H., San K. Y. & Bennett G. N. Effect of Sorghum vulgare phosphoenolpyruvate carboxylase and Lactococcus lactis pyruvate carboxylase coexpression on succinate production in mutant strains of Escherichia coli. Appl. Microbiol. Biotechnol. 67, 515–523 (2005). [DOI] [PubMed] [Google Scholar]
  14. Lu S., Eiteman M. A. & Altman E. Effect of CO2 on succinate production in dual-phase Escherichia coli fermentations. J. Biotechnol. 143, 213–223 (2009). [DOI] [PubMed] [Google Scholar]
  15. Nghiem N. P. & Senske G. E. Capture of carbon dioxide from ethanol fermentation by liquid absorption for use in biological production of succinic acid. Appl. Biochem. Biotechnol. 175, 2104–2113 (2015). [DOI] [PubMed] [Google Scholar]
  16. Wang D., Li Q., Li W. L., Xing J. M. & Su Z. G. Improvement of succinate production by overexpression of a cyanobacterial carbonic anhydrase in Escherichia coli. Enzyme Microb. Tech. 45, 491–497 (2009). [Google Scholar]
  17. Price G. D. Inorganic carbon transporters of the cyanobacterial CO2 concentrating mechanism. Photosynth. Res. 109, 47–57 (2011). [DOI] [PubMed] [Google Scholar]
  18. Shibata M. et al. Genes essential to sodium-dependent bicarbonate transport in cyanobacteria. J. Biol. Chem. 277, 18658–18664 (2002). [DOI] [PubMed] [Google Scholar]
  19. Price G. D., Woodger F. J., Badger M. R., Howitt S. M. & Tucker L. Identification of a SulP-type bicarbonate transporter in marine cyanobacteria. Proc. Natl. Acad. Sci. USA 52, 18228–18233 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Donnelly M. I., Millard C. S., Clark D. P., Chen M. J. & Rathke J. W. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid and ethanol. Appl. Biochem. Biotechnol. 72, 187–198 (1998). [DOI] [PubMed] [Google Scholar]
  21. Yan C. & Xu X. Bifunctional enzyme FBPase/SBPase is essential for photoautotrophic growth in cyanobacterium Synechocystis sp. PCC 6803. Prog. Nat. Sci. 18, 149–153 (2008). [Google Scholar]
  22. He J. et al. Complete genome sequence of Bacillus thuringiensis mutant strain BMB171. J. Bacteriol. 192, 4074–4075 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. López-Igual R., Picossi S., López- Garrido J., Flores E. & Herrero A. N and C control of ABC-type bicarbonate transporter Cmp and its LysR-type transcriptional regulator CmpR in a heterocyst-forming cyanobacterium, Anabaena sp. Environ. Microbiol. 14, 1035–1048 (2012). [DOI] [PubMed] [Google Scholar]
  24. Van der Werf M. J., Guettler M. V., Jain M. K. & Zeikus J. G. Environmental and physiological factors affecting the succinate product ratio during carbohydrate fermentation by Actinobacillus sp. 130Z. Arch. Microbiol. 167, 332–342 (1997). [DOI] [PubMed] [Google Scholar]
  25. Bradford M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (1976). [DOI] [PubMed] [Google Scholar]
  26. Zhu L. W. et al. Activation of glyoxylate pathway without the activation of its related gene in succinate-producing engineered Escherichia coli. Metab. Eng. 20, 9–19 (2013). [DOI] [PubMed] [Google Scholar]
  27. Zhang X. et al. Metabolic evolution of energy-conserving pathways for succinate production in Escherichia coli. Proc. Natl. Acad. Sci. USA 106, 20180–20185 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wang C. et al. Bio-oil based biorefinery strategy for the production of succinic acid. Biotechnol. Biofuels 1, 26–34 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhang P. P. et al. Expression and functional roles of the two distinct NDH-1 complexes and the carbon acquisition complex NdhD3/NdhF3/CupA/Sll1735 in Synechocystis sp. PCC 6803. Plant Cell 16, 3326–3340 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. McGinn P. J., Price G. D. & Badger M. R. High light enhances the expression of low-CO2-inducible transcripts involved in the CO2-concentrating mechanism in Synechocystis sp. PCC6803. Plant Cell Environ. 27, 615–626 (2004). [Google Scholar]
  31. Woodger F. J., Badger M. R. & Price G. D. Inorganic carbon limitation induces transcripts encoding components of the CO2- concentrating mechanism is Synechococcus sp. PCC7942 through a redox-independent pathway. Plant Physiol. 133, 2069–2080 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Saier M. H. A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol. Mol. Biol. Rev. 60, 354–411 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shelden M. C., Howitt S. M. & Price G. D. Membrane topology of the cyanobacterial bicarbonate transporter, BicA, a member of the SulP (SLC26A) family. Mol. Membr. Biol. 27, 12–23 (2010). [DOI] [PubMed] [Google Scholar]
  34. Deniaud A. et al. Expression of a chloroplast ATP/ADP transporter in E. coli membranes: Behind the Mistic strategy. Biochim. Biophys. Acta 1808, 2059–2066 (2011). [DOI] [PubMed] [Google Scholar]
  35. Gold E. W. & Smith T. E. Escherichia coli phosphoenolpyruvate carboxylase: effect of allosteric inhibitors on the kinetic parameters and sedimentation behavior. Arch. Biochem. Biophys. 164, 447–455 (1974). [DOI] [PubMed] [Google Scholar]
  36. Krebs A. & Bridger W. A. The kinetic properties of phosphoenolpyruvate carboxykinase of Escherichia coli. Can. J. Biochem. 58, 309–318 (1980). [DOI] [PubMed] [Google Scholar]
  37. Kai Y. et al. Three-dimensional structure of phosphoenolpyruvate carboxylase: a proposed mechanism for allosteric inhibition. Proc. Natl. Acad. Sci. USA 96, 823–828 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kwon Y. D., Lee S. Y. & Kim P. Influence of gluconeogenic phosphoenolpyruvate carboxykinase (PCK) expression on succinic acid fermentation in Escherichia coli under high bicarbonate condition. J. Microbiol. Biotechnol. 16, 1448–1452 (2006). [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES