Abstract
Background and Objectives:
Streptococcus pneumoniae is the main causative agent of acute bacterial meningitis in the world. This study aimed to detect pneumoniae infection in cerebrospinal fluid (CSF) samples of patients with suspected meningitis.
Materials and Methods:
In this study, 200 CSF samples in patients with suspected meningitis and with negative bacterial cultures were tested. Demographic data of patients and the laboratory analysis of CSF samples were also collected in a questionnaire. Pneumococcal capsular gene spn9802 was examined by real-time PCR technique.
Results:
Of 200 CSF samples from patients with the average age of 32.1±25.3 year old, 20 were positive for S. pneumoniae in patients with the average age of 35.05±24.6. The biochemical and cytological analysis of positive samples showed significant changes, including, 39.7 mg/DL protein, 46.2 mg/DL glucose and 1173 white blood cells per microliter of CSF on average.
Conclusion:
The results of this study showed the significant pneumococcal infection in culture negative CSF samples. The majority of this infection occurred in middle-aged patients and with a higher incidence rate in the winter. It seems that the traditional methods of cultivation are not sensitive enough to detect this bacterium in CSF. Alternatively, the molecular techniques such a real-time seem to be accurate, sensitive and rapid for the detection of this agent in CSF. The cytological and biochemical findings of CSF can provide valuable clues in the diagnosis of bacterial meningitis.
Keywords: Culture-negative meningitis, real-time PCR, Streptococcus pneumoniae
INTRODUCTION
Streptococcus pneumoniae can cause a range of illnesses, including pneumonia, sinusitis, otitis media, bacteremia, cellulitis, and acute bacterial meningitis (1, 2). Every year a large number of people, particularly in developing countries, lose their lives from different diseases caused by this bacterium (3,4). S. pneumoniae is the leading cause of acute bacterial meningitis in adults and young people (5). Meningitis caused by this bacterium has a higher rate of mortality than any other bacteria that cause this disease (16 to 37%) (6). Permanent neurological disabilities occur in 30 to 52% of surviving patients (7,8). Traditional methods used in the diagnosis of meningitis include microscopy, bacterial culture, cytology and biochemical analysis of CSF, and serological methods (1,2,4,9). Direct examination of smears prepared from CSF is a quick method to make a clinical decision but needs at least 104 to 105 bacteria per mL of CSF to get a positive result. This factor reduces the sensitivity of this method. As afastidious organism, S. pneumoniae grows very difficult using conventional culture media and requires at least 24–48 hours time (10,11). Due to the risk of death or permanent neurological sequels, patients with suspected bacterial meningitis usually receive antibiotics in the first medical visit prior to sampling. This can kill the bacteria in sterile fluids of the body within 2–4 hours (12).
Consequently, it might result in a negative culture of bacteria and thus reduces the sensitivity of this method to approximately 30% in medical diagnostic laboratories (13). Therefore, if the conventional bacteriogy is used for diagnosis, as it occurs in many medical laboratoirs in Iran, the prevalence of pneumococcal meningitis is underestimated. Alternative methods based on DNA amplification using distinct target genes have been developed for the detection and rapid diagnosis of pneumococcal meningitis (11,14). Given the advantages, including the reducing of time, the elimination of post PCR processing and quantitative analysis, real-time PCR method has been updated for this purpose (15). Furthermore, the rate of possible contamination of samples is lower in real-time PCR than conventional PCR, making it more sensitive and specific technique for diagnosis (15–17). The purpose of this study was to evaluate the quantitative real time PCR assay for detection of S. pneumoniae from CSF specimens of patients suspected with meningitis.
MATERIALS AND METHODS
Sampling.
A total of 200 culture-negative CSF samples from patients suspected with meningitis, according to an infectious disease specialist examination were investigated in this study. Samples were collected during 2011 to 2013 from patients in the main hospital (Imam Reza) in Kermanshah city located in the west of Iran. The samples were quickly transported in an ice box under sterile conditions to the microbiology laboratory and kept at −70 °C until DNA was extracted (2). CSF samples with volume less than 50 μl and samples with positive bacterial cultures were exluded from the study.
Real-time PCR assay.
The 100 μl of CSF samples were used for DNA extraction by CinnaPure DNA kit (SinaClon, Iran) according to manufacturer’s instructions. The concentration of extracting DNA (OD 260/280NM) was determined by spectrophotometry and gel electrophoresis and the specificity and characteristics of the DNA were determined using the internal control. Extracted DNA was kept at minus 20°C until used in real-time PCR assay. The following primers were used to amplify a part of spn9802 gene (18) of S. pneumoniae, F: (AGTCGTCCAAGGTAAACAAGTCT) and R: (ACCAACTCGACCACCTCTTT). Real-time PCR reaction was prepared in a final volume of 20μl, using 6 μl of Master mix Eva Green, 0.5 μl of each primer, 9μl deionized distilled water and 4μl of DNA template. The real-time PCR apparatus was Rotor-Gene 6000 (Corbett Research, Australia). The initial denaturing temperature of 95 °C was used for 10 min followed by 40 cycles of 95°C for 30 s, and 60°C for 60 seconds.
Five serial dilutions of standard bacterial DNA contained the 101 to 105 copies per mL of bacterial genome were prepared as positive control reactions in each run of real-time PCR. At each stage, based on E (efficiency) equals to 1.02 ± 0.05, and the amount of R 2 (Coefficient of Determination) and R (Regression) which was lower than 0.975, the test was repeated.
Specificity of reaction.
Genome of various bacteria including Staphylococcus aureus (PTCC 1189), Enterococcus faecalis (PTCC 1237), Streptococcus epidermidis (PTCC 1435), Streptococcus agalactiae (PTCC 1768), Streptococcus pyogenes (PTCC 1447); Neisseria meningitidis (ATCC 13090); Escherichia coli (PTCC 1395), Klebsiella pneumoniae (PTCC 1053), Pseudomonas aeruginosa (PTCC 1310), Haemophilus influenzae (PTCC 1766), Salmonella typhi (PTCC 1609); and gram-positive bacilli: Listeria menocytogenes (PTCC 1297) and human DNA were extracted and used as controls in real-time reactions.
Determinination of sensitivity of reaction.
To determine the sensitivity of the method, the serial dilutions of 101 to 105 copies per mL of S. pneumoniae (PTCC1240) genome were prepared. These serial dilutions were used for making the standard curve of real-time PCR (Table 1).
Table 1.
The results of serial dilutions of S. pneumoniae (PTCC1240)
| No. | Std* | CFU/mL | CT | Bacterial Count(CFU/mL) |
|---|---|---|---|---|
| 1 | S1 | 105 | 19.42 | 1.5e+5 |
| 2 | S2 | 104 | 22.64 | 1.7e+4 |
| 3 | S3 | 103 | 25.35 | 2.5e+3 |
| 4 | S4 | 102 | 28.03 | 5.5e+2 |
| 5 | S5 | 101 | 32.11 | 7.6e+1 |
Std=Standard
Statistical analysis. All collected data were statistically analyzed using SPSS version 18 and the comparison of data was done using t-test.
RESULTS
Of 200 cases, 99 (%49) and 101 (%51) were males and females, respectively. Their age ranged from one day to 91 year old with an average age of 35.05± 24.6 years. In total, 20 cases of pneumococcal infections were detected in CSF samples (Table 2 and Fig. 2). Of these, 11 and 9 were males and females, respectively, with an average age of 35.5 years old (Fig. 1). Seven cases occurred in winter that was slightly higher than other seasons. The average number of bacterial genomes in CSF samples was 2.6×104copies/ml. The statistical results of the comparison of positive and negative samples are presented in Table 3.
Table 2.
Biochemical and cytological characteristics of positive samples.
| Gender | Age | Protein mg/dL | Glucose mg/dL | WBC | Differential counts | CT | Bacterial count (copies/mL) | |
|---|---|---|---|---|---|---|---|---|
| Seg. % | Lym. % | |||||||
| M | 75 | 27 | 91 | 25 | 75 | 25 | 23.07 | (2.7e+3) |
| M | 73 | 40 | 41 | 700 | 70 | 30 | 20.81 | (9.4e+4) |
| M | 69 | 16 | 70 | 8000 | 90 | 10 | 19.45 | (1.4e+5) |
| M | 53 | 37 | 20 | 160 | 15 | 85 | 23.94 | (1.5e+3) |
| M | 50 | 65 | 55 | 8000 | 90 | 10 | 19.64 | (1.5e+5) |
| M | 47 | 32 | 52 | 200 | 50 | 50 | 24.27 | (1.4e+3) |
| M | 32 | 20 | 42 | 3200 | 80 | 20 | 22.83 | (1.3e+4) |
| M | 26 | 90 | 35 | 110 | 75 | 25 | 21.91 | (1.5e+4) |
| M | 19 | 25 | 36 | 140 | 20 | 80 | 26.02 | (1.3e+3) |
| M | C* | 40 | 20 | 50 | 70 | 30 | 30.51 | (8.1e+2) |
| M | C* | 42 | 66 | 100 | 90 | 10 | 20.97 | (6.5e+4) |
| F | 60 | 20 | 47 | 100 | 40 | 60 | 26.01 | (1.1e+3) |
| F | 53 | 65 | 22 | 900 | 70 | 30 | 22.64 | (1.4e+4) |
| F | 42 | 100 | 39 | 1350 | 85 | 15 | 22.59 | (9.8e+3) |
| F | 35 | 18 | 82 | 53 | 85 | 15 | 24.28 | (1.4e+3) |
| F | 24 | 20 | 55 | 50 | 82 | 18 | 24.37 | (1.3e+3) |
| F | 23 | 28 | 55 | 50 | 80 | 20 | 24.76 | 1.3e+3 |
| F | 19 | 56 | 23 | 200 | 70 | 30 | 25.66 | (2.5e+3) |
| F | C* | 18 | 43 | 40 | 60 | 40 | 33.03 | (5e+1) |
| F | C* | 40 | 41 | 40 | 75 | 25 | 25.48 | (1.1e+3) |
C= Children less than a year old F= Female M=Male CT=Cycle threshold
Fig. 2.
Real-time PCR results. S. pneumoniae (PTCC1240) standard dilutions (105 up to 101), Pneumococcal positive Samples (number 1 to 6), Negative Samples (7 to 9), Negative control (10).
Fig. 1.
The age distribution of patients with positive and negative cases.
Table 3.
Comparison analysis of positive and negative samples.
| Characteristic | Negative samples (180) | Positive samples (20) | p-value |
|---|---|---|---|
| Average age | 36.23 | 35.05 | 0.24 |
| Protein | 28.27 | 39.95 | 0.001 |
| Glucose | 62.26 | 46.75 | 0.008 |
| WBC count | 203.34 | 1174.40 | 0.041 |
DISCUSSION
Despite great advances in medical knowledge, bacterial meningitis remains as one of the infectious disease with high mortality rate. S. pneumoniae is the major cause of bacterial meningitis in all ages in many countries, although with different rates of prevalence. Our results showed 10% of culture-negative CSF was positive for S. pneumoniae infection. That indicates the significant rate of pneumococcal meningitis among undiagnosed CSF samples. In many cases, CSF samples are not routinely tested by molecular methods to detect this bacterium (2,9,13,14,19). Studies in different countries using PCR and real-time PCR methods, have reported the positive cases of pneumococcal infection in culture-negative CSF samples. In Brazil, of 428 CSF samples tested, 70 cases were positive (16.35%), for S. pneumoniae while in the United States, 5 samples out of 11 (45.45%) and in England 3 out of 7 (42.85%) samples gave positive results for this organism as causative of infection (5,19,20). Because of better primary examination and evaluation by doctors, it seems that in developed countries more cases can be detected. Coveresly, in India 2 out of 43 samples (4.65%) were positive for S. pneumoniae in cases suspected with meningitis (14).
The conventional methods for identification of bacterial meningitis need to have at least 104 to 106 live bacteria per mL of CSF that is hard to occur because of antibiotic consumption before sampling (10,11). Our results indicated the range of bacterial genome copy was from 50 to 150000 per mL of CSF. This is mainly less than limit range for conventional culture methods and explained, at least in part, the lower sensitivity of conventional methods.
In bacterial meningitis, biochemical and cytological characteristics of CSF can provide valuable clues for diagnosis. Among these characteristics, increased in the number of white blood cells (WBC), increase in protein level and the decrease of glucose level in CSF are helpful clues. However, these factors cannot unequivocally differentiate viral from bacterial cases (21,22).
In our study, a significant increase in the number of WBC and protein level and decrease in glucose level was observed, which is consistent with the medical context (26). In terms of age distribution of patients, the results of other studies indicated that the S. pneumoniae is the main cause of bacterial meningitis in elderly people with the age range 40 to 60 years, which is in agreement with our findings (23,24). In terms of the incidence of pneumococcal meningitis in men and women, our results showed the slightly higher rate of the positive cases among men, which is consistent with other reports (25,26). The incidence of bacterial meningitis occurs mostly in winter (26–28) and that is similar to our results. However, because of a small number of positive cases, seasonal pattern was not statistically approved.
CONCLUSION
The results of this study showed the significant pneumococcal infection rate in culture - negative CSF samples in Kermanshah. The majority of these infections occurred in middle-aged patients and with the slightly higher incidence rate in the winter. It seems that the traditional methods of cultivation are not sensitive enough to detect this bacterium in CSF. Alternatively, real-time PCR seems to be accurate, sensitive and rapid for the detection of this agent in CSF. The cytological and biochemical findings of CSF analysis, including the increase in the number of WBC and protein level and decrease in the glucose level can provide valuable clues for the diagnosis of bacterial meningitis.
ACKNOWLEDGEMENTS
This work was performed in partial fulfillment of the requirements for Master’s degree of Medical Microbiology of Kamal Ahmadi, in Faculty of Medicine, Kermanshah University of Medical Sciences,Kermanshah, Iran.
REFERENCE
- 1. Rintamäki S, Saukkoriipi A, Salo P, Takala A, Leinonen M. Detection of Streptococcus pneumoniae DNA by using polymerase chain reaction and microwell hybridization with Europium-labelled probes. J Microbiol Methods 2002; 50: 313– 318 . [DOI] [PubMed] [Google Scholar]
- 2. Greiner O, Day PJR, Bosshard PP, Imeri F, Altwegg M, Nadal D. Quantitative detection of Streptococcus pneumoniae in nasopharyngeal secretions by real-time PCR. J Clin Microbiol 2001; 39: 3129– 3134 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Kim DW, Kilgore PE, Kim EJ, Kim SA, Anh DD, Dong BQ, et al. The Enhanced Pneumococcal LAMP Assay: A clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae. PLoS One 2012; 7: 1– 8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Williams TM, Loman NJ, Ebruke C, Musher DM, Adegbola RA, Pallen MJ, et al. Genome analysis of a highly virulent serotype 1 strain of Streptococcus pneumoniae from West Africa. PLoS One 2012; 7 (10): 1– 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Cherian T, Lalitha MK, Manonaran A, Thomas K, Yolken RH, Steinhoff MC. PCR-enzyme immunoassay for detection of Streptococcus pneumoniae DNA in cerebrospinal fluid samples from patients with culture-negative meningitis. J Clin Microbiol 1998; 36: 3605– 3608 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Weisfelt M, Beek DVD, Spanjaard L, Reitsma JB, Gans JD. Clinical features, complications, and outcome in adults with pneumococcal meningitis: a prospective case series. Lancet Neurol 2006; 5: 123– 129 . [DOI] [PubMed] [Google Scholar]
- 7. Chavez-Bueno S, McCracken GH., Jr Bacterial meningitis in children. Pediatr Clin North Am 2005; 52: 795– 810 . [DOI] [PubMed] [Google Scholar]
- 8. Kastenbauer S, Pfister H-W. Pneumococcal meningitis in adults: spectrum of complications and prognostic factors in a series of 87 cases. J Brain Dis 2003; 126: 1015– 125 . [DOI] [PubMed] [Google Scholar]
- 9. Tunkel AR, Hartman BJ, Kaplan SL, Kaufman BA, Roos KL, Scheld MW, et al. Practice guidelines for the management of bacterial meningitis. Clin Infect Dis 2004;39: 1267– 84 . [DOI] [PubMed] [Google Scholar]
- 10. Failace L, Wagner M, Chesky M, Scalco R, Jobim LF. Simultaneous detection of Neisseria meningitidis, Haemophilus influenza and Streptococcussp. by polymerase chain reaction for the diagnosis of bacterial meningitis. Arq Neuropsiquiatr 2005; 63: 920– 924 . [DOI] [PubMed] [Google Scholar]
- 11. Ghotaslou R, Farajnia S, Yeganeh F, Abdoli-Oskouei S, Ahangarzadeh-Rezaee M, Barzegar M. Detection of acute childhood meningitis by PCR, culture and agglutination tests in Tabriz, Iran. Acta Medica Iranica 2012; 50: 192– 196 . [PubMed] [Google Scholar]
- 12. Kanegaye JT, Soliemanzadeh P, Bradley JS. Lumbar puncture in pediatric bacterial meningitis: defining the time interval for recovery of cerebrospinal fluid pathogens after parenteral antibiotic pretreatment. JAMA Pediatr 2001; 108: 1169– 1174 . [PubMed] [Google Scholar]
- 13. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Fox AJ, Kaczmarski EB. Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR. J Clin Microbiol 2001; 39: 1553–1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Pandit L, Kumar S, Karunasagar I, Karunasagar I. Diagnosis of partially treated culture-negative bacterial meningitis using 16S rRNA universal primers and restriction endonuclease digestion. J Med Microbio 2005; 54: 539– 542 . [DOI] [PubMed] [Google Scholar]
- 15. Espy MJ, Uni JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, et al. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. J Clin Microbiol Reviews 2006; 19: 165– 256 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Saukkoriipi A, Palmu A, Kilpi T, Leinonen M. Real-time quantitative PCR for the detection of Streptococcus pneumoniae in the middle ear fluid of children with acute otitis media. Mol Cell Probes 2002; 16: 385– 390 . [DOI] [PubMed] [Google Scholar]
- 17. Bryant PA, Li HY, Zaia A, Griffith J, Hogg G, Curtis N, et al. Prospective study of a real-time PCR that is highly sensitive, specific, and clinically useful for diagnosis of meningococcal disease in children. J Clin Microbiol 2004; 42: 2919– 2925 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Suzuki N, Seki M, Nakano Y, Kiyoura Y, Maeno M, Yamashita Y. Discrimination of Streptococcus pneumoniae from viridans group streptococci by genomic subtractive hybridization. J Clin Microbiol 2005; 43: 4528– 4534 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Sacchi CT, Fukasawa LO, Goncalves MG, Salgado MM, Shutt KA, Carvalhanas TR, et al. Incorporation of real-time PCR into routine public health surveillance of culture negative bacterial meningitis in Sao Paulo, Brazil. PLoS One 2011; 6: 1– 8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Kearns AM, Freeman R, Murphy OM, Seiders PR, Steward M, Wheeler J. Rapid PCR-based detection of Streptococcus pneumoniae DNA in cerebrospinal fluid. J Clin Microbiol 1999; 37: 3434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Reilly BM, Evans AT. Translating clinical research into clinical practice: Impact of using prediction rules to make decisions. Ann Intern Med 2006; 144: 201– 209 . [DOI] [PubMed] [Google Scholar]
- 22. Negrini B, Kelleher KJ, Wald ER. Cerebrospinal fluid findings in aseptic versus bacterial meningitis. JAMA Pediatr 2000;105: 316– 319 . [DOI] [PubMed] [Google Scholar]
- 23. Ataee RA, Mehrabi-Tavana A, Izadi A, Hosseini SMJ, Ataee MH. Bacterial meningitis: a new risk factor. JRMS 2011;16: 207– 210 . [PMC free article] [PubMed] [Google Scholar]
- 24. Brindusa T, Klara B, Tilea I. Incidence, epidemiology and etiology of acute meningitis in Mures County–an observational study. ARS Medica Tomitana 2012; 3: 116– 125 . [Google Scholar]
- 25. Mosavi-Jarrahi A, Abdolreza Esteghamati A, Asgari F, Heidarnia M, Mousavi-Jarrahi Y, Goya M. Temporal analysis of the incidence of meningitis in the Tehranmetropolitan area, 1999–2005. Population Health Metrics 2009; 7: 1– 7 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Bahador M, Amini M, Bahador M. Common cause and cerebrospinal fluid changes of acute bacterial meningitis. IJP 2009; 4 : 75– 79 . [Google Scholar]
- 27. Thomas JD, Hatcher CP, Satterfield DA, Theodore MJ, Bach MC, Linscott KB, et al. SodC-Based Real-Time PCR for Detection of Neisseria Meningitidis. PLoS One 2011;6: 1– 8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Mandell, Douglas , Bennett’s (2010). Principles and practice of infectious diseases. 7th ed Churchill Livingstone Elsevier. [Google Scholar]


