The Regulation of the AdcR Regulon in Streptococcus pneumoniae Depends Both on Zn²⁺- and Ni²⁺-Availability

Abstract

By using a transcriptomic approach, we have elucidated the effect of Ni²⁺ on the global gene expression of S. pneumoniae D39 by identifying several differentially expressed genes/operons in the presence of a high extracellular concentration of Ni²⁺. The genes belonging to the AdcR regulon (adcRCBA, adcAII-phtD, phtA, phtB, and phtE) and the PsaR regulon (pcpA, prtA, and psaBCA) were highly upregulated in the presence of Ni²⁺. We have further studied the role of Ni²⁺ in the regulation of the AdcR regulon by using ICP-MS analysis, electrophoretic mobility shift assays and transcriptional lacZ-reporter studies, and demonstrate that Ni²⁺ is directly involved in the derepression of the AdcR regulon via the Zn²⁺-dependent repressor AdcR, and has an opposite effect on the expression of the AdcR regulon compared to Zn²⁺.

Introduction

In bacteria, the transition metal ions play an important role in the proper functioning of many enzymes, transporters, and transcriptional regulators. Transition metal ions are the prerequisite for the proper bacterial growth at low concentrations, but metal ions can be lethal at higher concentrations (Blencowe and Morby, 2003; Finney and O'Halloran, 2003; Moore and Helmann, 2005; Ge et al., 2012). Therefore, proper homeostasis of metal ions is very important for the survival of bacteria, which is maintained by the dedicated metal transport- and efflux-systems (Tottey et al., 2008; Waldron and Robinson, 2009; Lisher et al., 2013). These systems are tightly regulated by metal-responsive transcriptional regulators to ensure the proper functioning of the cell by maintaining the minimum levels of metal ions inside the cell.

Streptococcus pneumoniae is one of the most common human pathogens that reside asymptomatically in the human nasopharynx (Mitchell, 2003). However, it may occasionally translocate to the lungs, the eustachian tube, the blood, and the nervous system, causing pneumoniae, otitis media, bacteremia, and meningitis, respectively (Obaro and Adegbola, 2002; Bogaert et al., 2004). During translocation from the nasopharynx to other infection sites, S. pneumoniae may encounter different environmental conditions including varying metal ions concentrations, which might affect the expression of different genes including virulence genes (Gupta et al., 2009; Shafeeq et al., 2011b, 2013; Plumptre et al., 2014a). However, the exact conditions that S. pneumoniae might face during infections, are poorly understood.

The role of manganese (Mn²⁺), zinc (Zn²⁺), copper (Cu²⁺), iron (Fe²⁺), cobalt (Co²⁺), and cadmium (Cd²⁺) on the gene regulation of S. pneumoniae have already been established and several metal-specific acquisition- and efflux-systems have been characterized. These systems include AdcRCBA (the Zn²⁺-uptake system), CzcD (the Zn²⁺-efflux system), PsaBCA (the Mn²⁺-uptake system), MntE (the Mn²⁺-efflux system), the cop operon (the Cu²⁺-efflux system), and PiaABCD, PiuBCDA, and PitADBC (the Fe²⁺- and Fe³⁺-uptake systems) (Kloosterman et al., 2007, 2008; Hendriksen et al., 2009; Rosch et al., 2009; Bayle et al., 2011; Shafeeq et al., 2011a, 2013; Manzoor et al., 2015c). These systems have further been shown to be regulated by metal-specific transcriptional regulators in S. pneumoniae. The Zn²⁺-uptake system (AdcRCBA) is repressed by transcriptional regulator AdcR in the presence of Zn²⁺ (Shafeeq et al., 2011a). Similarly, the psaBCA operon encoding Mn²⁺-uptake system are repressed by transcriptional regulator PsaR in the presence of Mn²⁺ (Johnston et al., 2006; Kloosterman et al., 2008), whereas, this PsaR-mediated repression is relieved by the addition of Zn²⁺, Co²⁺, Cd²⁺, or Ni²⁺ (Kloosterman et al., 2008; Jacobsen et al., 2011; Begg et al., 2015; Manzoor et al., 2015a,b,c).

Ni²⁺ is an essential micronutrient for certain bacteria, due to its role in various cellular processes like methane formation, hydrolysis of urea, and consumption of molecular hydrogen (Chen and Burne, 2003; Mulrooney and Hausinger, 2003; Rodionov et al., 2006; Anwar et al., 2007). In Escherichia coli, the nik operon (nikABCDE) involved in the transport of Ni²⁺ is shown to regulate by transcriptional regulator NikR (De Pina et al., 1999). Moreover, the expression of NmtA, an ATP-dependent transporter involved in the efflux of Ni²⁺ and Co²⁺, is tightly regulated by Ni²⁺-responsive transcriptional regulator NmtR in Mycobacterium tuberculosis (Cavet et al., 2002). Ni²⁺ is also shown to regulate the expression of urease activity in Streptococcus salivarius and Helicobacter pylori (van Vliet et al., 2001; Chen and Burne, 2003). The amount of Ni²⁺ in the human blood is estimated to be 0.83 ng ml⁻¹ (Alimonti et al., 2005) and it is likely that S. pneumoniae may encounter Ni²⁺ during infection in blood. So far, very little is known about the impact of Ni²⁺ on the global gene expression of S. pneumoniae. Previously, the role of Ni²⁺ in the regulation of the Zn²⁺-efflux system czcD was reported (Kloosterman et al., 2007). It was shown that the SczA-mediated expression of czcD was highly increased in the presence of Zn²⁺, Co²⁺, or Ni²⁺ (Kloosterman et al., 2007). Moreover, a number of proteins and motif with Co²⁺- and Ni²⁺-binding capacity has been identified by Immobilized metal affinity column (IMAC) and LTQ-Orbitrap mass spectrometry (MS) that have diverse functions in the S. pneumoniae (Sun et al., 2013). In a recent study, we demonstrated the role of Ni²⁺ in regulation of the PsaR regulon and showed that Ni²⁺ not only alleviates the Mn²⁺-dependent binding of PsaR to the promoter regions of the PsaR regulon genes, but also cause Mn²⁺ deficiency possibly by blocking Mn²⁺-uptake via PsaA, hence leading to the high expression of the PsaR regulon in the presence of Ni²⁺ (Manzoor et al., 2015b).

In this current study, we used a transcriptomic analysis approach for the identification of differentially expressed genes/operons in response to high extracellular Ni²⁺ in S. pneumoniae. The expression of genes belonging to the AdcR regulon and the PsaR regulon was highly upregulated in the presence of Ni²⁺. We further studied the role of Ni²⁺ in the AdcR-mediated regulation of the adcRCBA, adcAII-phtD, phtA, phtB, and phtE by using transcriptional lacZ-reporter studies, inductively coupled plasma-mass spectrometry (ICP-MS) analysis and electrophoretic mobility shift assays (EMSAs), and showed that Ni²⁺ and Zn²⁺ play an opposite role in the regulation of the adcRCBA, adcAII-phtD, phtA, phtB, and phtE.

Materials and methods

Bacterial strains and media

Bacterial strains used in this study are listed in Table 1. Growth of bacteria and DNA manipulation were performed as described (Shafeeq et al., 2011a; Manzoor et al., 2015a). All experiments in this study were performed in chemically defined medium (CDM). Salts of metal ion ZnSO₄.7H₂O and NiSO₄.6H₂O were used as specified in the Results section. Primers used in this study are based on the genome sequence of S. pneumoniae D39 and are listed in Table 2.

Table 1.

List of strains and plasmids used in this study.

Strain/plasmid	Description	Source
S. pneumoniae
D39	Serotype 2 strain, cps 2	Laboratory of P. Hermans
SS200	D39 ΔadcR; EryR	Shafeeq et al., 2011a
IM404	D39 ΔbgaA::PczcD-lacZ; TetR	Manzoor et al., 2015a
IM501	D39 ΔbgaA::PadcR-lacZ; TetR	This study
IM502	D39 ΔbgaA::PadcAII-lacZ; TetR	This study
IM503	D39 ΔbgaA::PphtA-lacZ; TetR	This study
IM504	D39 ΔbgaA::PphtB-lacZ; TetR	This study
IM505	D39 ΔbgaA::PphtE-lacZ; TetR	This study
IM551	SS200 ΔbgaA::PadcR-lacZ; TetR	This study
IM552	SS200 ΔbgaA::PadcAII-lacZ; TetR	This study
IM553	SS200 ΔbgaA::PphtA-lacZ; TetR	This study
IM554	SS200 ΔbgaA::PphtB-lacZ; TetR	This study
IM555	SS200 ΔbgaA::PphtE-lacZ; TetR	This study
E. coli
EC1000	KmR; MC1000 derivative carrying a single copy of the pWV1 repA gene in glgB	Laboratory collection
Plasmids
pPP2	AmpR TetR; promoterless lacZ For replacement of bgaA with promoter lacZ-fusion. Derivative of pPP1	Halfmann et al., 2007
pIM501	pPP2 PadcR-lacZ	This study
pIM502	pPP2 PadcAII-lacZ	This study
pIM503	pPP2 PphtA-lacZ	This study
pIM504	pPP2 PphtB-lacZ	This study
pIM505	pPP2 PphtE-lacZ	This study
SS107	pNZ8048 carrying strep-tagged AdcR downstream of PnisA	Shafeeq et al., 2011a

Table 2.

List of primers used in this study.

Name	Nucleotide sequence (5′3′)	Restriction site
Padcr-F	CGGAATTCTTTTTCAGCAAAGATTGGG	EcoRI
Padcr-R	CGGGATCCCTTTCCTTTTAGACTTCTC	BamHI
PadcAII-F	CGGAATTCCTTCACTTATGGCTATAAGC	EcoRI
PadcAII-R	CGGGATCCAAAGAAAGACACTTAACAGG	BamHI
PphtA-F	CGGAATTCTGAACTTCAAAAAGAATACG	EcoRI
PphtA-R	CGGGATCCCTTAAAATCAAAGCTGCCGC	BamHI
PphtB-F	GCATGAATTCGGCAGAAGCAGAAAAATTAC	EcoRI
PphtB-R	CGATGGATCCAAGTGTAGCTACTGACC	BamHI
PphtE-F	CGGAATTCAGAAGTAGATAGTCTCTTGG	EcoRI
PphtE-R	CGGGATCCACGATAACAGCTGATCCAGC	BamHI

DNA microarray and data analysis

For microarray analysis in response to Ni²⁺, S. pneumoniae D39 wild-type was grown in two biological replicates in CDM with and without the addition of 0.5 mM NiSO_4.6H₂O. To analyze the impact of adcR deletion on the transcirptome of S. pneumoniae in the presence of Ni²⁺, D39 wild-type and ΔadcR (SS200) (Shafeeq et al., 2011a) were grown in two biological replicates in CDM with 0.3 mM of NiSO_4.6H₂O. All other procedures regarding microarray experiments and data analysis were done as described before (Shafeeq et al., 2011b; Afzal et al., 2015). For the identification of differentially expressed genes a Bayesian p < 0.001 and a fold change cut-off of 2 was applied. The DNA microarray data have been submitted to gene expression omnibus (GEO) database under the accession number GSE73852.

Construction of transcriptional lacZ-fusions and β-galactosidase assays

Chromosomal transcriptional lacZ-fusions to the promoter regions of adcR, adcAII, phtA, phtB, and phtE were constructed in plasmid pPP2 (Halfmann et al., 2007) with the primer pairs listed in Table 2, resulting in pIM501-505. These plasmids were introduced into D39 wild-type and ΔadcR (SS200) (Shafeeq et al., 2011a) resulting in strains IM501-505 and IM551-554, respectively. All plasmids were checked for the presence of correct insert by means of PCR and DNA sequencing. For β-galactosidase activity, the derivatives of S. pneumoniae were grown in triplicate in CDM supplemented with different metal ion concentrations (w/v) mentioned in the Results and harvested at the mid-exponential growth phase. The β-galactosidase activity was measured as described before (Kloosterman et al., 2006). Standard deviations were calculated from three independent replicates of each sample.

Inductively coupled plasma-mass spectrometry (ICP-MS) analysis

To determine the cell-associated concentration of metal ions, an ICP-MS analysis was performed on the cells grown in triplicates in CDM with and without the addition of 0.5 mM Ni²⁺ till the mid-exponential growth phase. Cell cultures were centrifuged at 4°C and washed twice with overnight Chelex (Sigma) treated phosphate-buffered saline (PBS) with 1 mM nitrilotriacetic acid. Cells were dried overnight in a Speedvac at room temperature. The dried cells were dissolved in 2.5% nitric acid (Ultrapure, Sigma Aldrich) and lysed at 95^oC for 10 min by vigorous vortexing after each 30 s. The lysed cell samples were used for ICP-MS analysis as described (Jacobsen et al., 2011). Metal ion concentrations were expressed as μg g⁻¹ dry weight of cells.

Overexpression and purification of strep-tagged AdcR

The nisin-inducible (NICE) expression system (Kuipers et al., 1998) in Lactococcus lactis strain NZ9000 was used for the overexpression of C-terminally Strep-tagged AdcR (Shafeeq et al., 2011a). Cells were grown until an OD₆₀₀ of 0.4 in 1 L culture followed by the induction with 10 ng ml⁻¹ nisin. The purification of AdcR-Strep tag was performed using the Streptactin column from IBA according to the supplier's instructions (www.iba-go.com). The purified protein was eluted in buffers without EDTA and stored at a concentration of 0.5 mg/ml in the elution buffer (100 mM Tris-HCl [pH 8], 150 mM NaCl, 2.5 mM desthiobiotin, and 1 mM β-mercaptoethanol) with 10% glycerol at −80°C.

Electrophoretic mobility shift assays

Electrophoretic mobility shift assays (EMSAs) were performed as described (Kloosterman et al., 2008). In short, PCR products of the promoter regions of adcR, adcAII, phtA, phtB, and pcpA were labeled with [γ-³³P] ATP. All the EMSAs were performed with 5000 cpm of [γ-³³P] ATP-labeled PCR products in buffer containing 20 mM Tris-HCL (pH 8.0), 5 mM MgCl₂, 8.7% (w/v) glycerol, 62.5 mM KCl, 25 μg/ml bovine serum albumin and 25 μg/ml poly (dI-dC). Various metal ions were added in concentrations as described in the Results section. Reactions were incubated at 30°C for 30 min before loading on gels. Gels were run in 1 M Tris-borate buffer (pH 8.3) at 95 V for 90 min.

Results

Identification of Ni²⁺-dependent genes in S. pneumoniae

To investigate the impact of Ni²⁺ on the transcriptome of S. pneumoniae, a DNA microarray-based comparison of D39 wild-type grown in CDM with 0.5 mM Ni²⁺ to the same strain grown in CDM with 0 mM Ni²⁺ was performed. Table 3 summarizes the list of differentially expressed genes in the presence of 0.5 mM Ni²⁺. The PsaR regulon consisting of the operon psaBCA (encoding Mn²⁺-dependent ABC transporters, PsaBCA), pcpA (encoding a choline binding protein, PcpA), and prtA (encoding a serine protease PrtA) were highly upregulated in the presence of Ni²⁺. The Ni²⁺-dependent upregulation of the PsaR regulon in the presence of Ni²⁺ is consistent with our recent study, where we have explored the Ni²⁺-dependent regulation of the PsaR regulon in more details (Manzoor et al., 2015b). Expression of a gene cluster including the cation efflux system gene czcD, the MerR family transcriptional regulator, and the Zn²⁺-containing alcohol dehydrogenase adhB was increased more than 35-fold in the presence of Ni²⁺. The cation efflux system CzcD was shown to protect S. pneumoniae against the intracellular Zn²⁺-stress (Kloosterman et al., 2007). A novel TetR family transcriptional regulator SczA has been shown to activate the expression of czcD in the presence of Zn²⁺, Co²⁺, or Ni²⁺ (Kloosterman et al., 2007). Therefore, the upregulation of czcD in our transcriptomic analysis is consistent with the finding presented in previous study (Kloosterman et al., 2007). Furthermore, genes encoding a heat shock protein (HtpX) and a Dpr homolog (spd_1402) were also differentially expressed. The Dpr protein has been shown to protect bacterial cells from oxidative stress (Pulliainen et al., 2003).

Table 3.

Summary of transcriptome comparison of S. pneumoniae D39 wild-type grown in CDM plus 0.5 mM Ni²⁺ to CDM plus 0 mM Ni²⁺.

Gene taga	Functionb	Ratioc	P-value
SPD0475	CAAX amino terminal protease family protein	5.39	1.48E−11
SPD0526	Fructose-1,6-bisphosphate aldolase, class II	3.07	1.93E−13
SPD0558	Cell wall-associated serine protease, PrtA	9.67	2.92E−13
SPD0738	Cytidine deaminase	21.92	6.05E−07
SPD0888	Adhesion lipoprotein, AdcAII (LmB)	2.07	7.08E−07
SPD0889	Pneumococcal histidine triad protein D, PhtD	2.06	5.81E−10
SPD0890	Pneumococcal histidine triad protein E, PhtE	7.13	2.81E−05
SPD1038	Pneumococcal histidine triad protein A, PhtA	12.54	2.00E−14
SPD1078	L-lactate dehydrogenase	4.21	2.04E−14
SPD1138	Heat shock protein, HtpX	3.61	9.44E−05
SPD1360	Hypothetical protein	7.29	1.15E−10
SPD1402	Non-heme iron-containing ferritin, DpR	2.65	2.10E−11
SPD1461	Manganese ABC transporter, ATP-binding protein, PsaB	11.90	5.33E−15
SPD1462	Manganese ABC transporter, permease protein, PsaC	10.71	5.26E−14
SPD1464	Thiol peroxidase	2.13	8.68E−10
SPD1632	Hypothetical protein	2.32	3.47E−05
SPD1633	Galactose-1-phosphate uridylyl transferase, GalT	2.68	7.81E−06
SPD1634	Galactokinase, GalK	4.13	1.29E−08
SPD1635	Galactose operon repressor, GalR	5.00	4.27E−07
SPD1636	Alcohol dehydrogenase, zinc-containing, AdhB	35.69	0.00E+00
SPD1637	Transcriptional regulator, MerR family	38.25	0.00E+00
SPD1638	Cation efflux system protein, CzcD	77.89	5.55E−15
SPD1651	Iron-compound ABC transporter, ATP-binding protein	−3.91	1.27E−13
SPD1652	Iron-compound ABC transporter, iron-compound-binding protein	−3.73	4.57E−12
SPD1965	Choline binding protein, PcpA	2.80	8.16E−04
SPD1997	Zinc ABC transporter, zinc-binding lipoprotein, AdcA	3.91	1.14E−12
SPD1998	Zinc ABC transporter, permease protein, AdcB	2.00	2.47E−04
SPD1999	Zinc ABC transporter, ATP-binding protein, AdcC	4.17	1.29E−13
SPD2000	adc operon repressor, AdcR	3.88	2.46E−11

^aGene numbers refer to D39 locus tags.

^bD39 annotation/TIGR4 annotation (Hoskins et al., 2001; Lanie et al., 2007).

^cRatios >2.0 or < 2.0 (wild-type + 0.5 mM Ni²⁺/wild-type + 0 mM Ni²⁺).

The genes belonging to the AdcR regulon were also upregulated in the presence of Ni²⁺. The expression of the adc operon was 4-fold upregulated. The expression of adcAII-phtD operon was upregulated 2-fold. The expression of other genes encoding for Pht family proteins (PhtA and PhtE), was upregulated more then 7-fold. Previously, it was shown that the expression of the AdcR regulon is repressed by the transcriptional regulator AdcR in the presence of Zn²⁺ (Shafeeq et al., 2011a). Transcriptome data was further validated by qRT-PCR analysis (Supplementary data: Table S1). Upregulation of the AdcR regulon in the presence of Ni²⁺ might also indicate the putative role of Ni²⁺ in the regulation of the AdcR regulon by the transcriptional regulator AdcR. Therefore, we decided to further explore the role of Ni²⁺ in the regulation of the AdcR regulon and to determine the intracellular concentrations of metal ions in S. pneumoniae D39 grown in the presence of either 0.5 mM Ni²⁺ or 0 mM Ni²⁺ in CDM.

S. pneumoniae accumulates more Ni²⁺ when grown in the presence of 0.5 mM Ni²⁺

To investigate whether the observed transcriptomic responses correlated with high cell-associated concentration of Ni²⁺, we performed an ICP-MS analysis on the same conditions used for performing the transcriptome analysis, i.e., cells grown either in the presence of 0.5 mM Ni²⁺ or 0 mM Ni²⁺ in CDM. Our ICP-MS data revealed that the cells grown in the presence of 0.5 mM Ni²⁺ accumulate 30-fold more cell-associated Ni²⁺ compared to the cells grown in 0 mM Ni²⁺ (30 μg g^−l dry mass of cells vs. < 1 μg g^−l dry mass of cells) (Figure 1). Moreover, 2.6-fold decrease in the cell-associated concentration of Mn²⁺ was observed. The cell-associated concentration of other metal ions was not changed in the presence of 0.5 mM Ni²⁺ compared to 0 mM Ni²⁺. Therefore, it is likely that the transcriptomic changes observed in the presence of 0.5 M Ni²⁺ are due to the high intracellular concentration of Ni²⁺.

Figure 1.

Cell-associated metal ion concentrations (expressed ug g⁻¹) of S. pneumoniae D39 wild-type when grown in CDM with either 0 mM or 0.5 mM Ni²⁺. The statistical significance of the differences in the mean metal ion concentrations was determined by One-way ANOVA (NS not significant, ^*P < 0.05, and ^**P < 0.001).

Ni²⁺-dependent expression of the AdcR regulon

To explore the transcriptional regulation of the genes/operons belonging to the AdcR regulon (adcRCBA, adcAII-phtD, phtA, phtB, and phtE) found in our microarray analysis, transcriptional lacZ-fusions were constructed to the promoter regions of adcR, adcAII, phtA, phtB, and phtE in plasmid pPP2 (Halfmann et al., 2007) and transferred to S. pneumoniae D39 wild-type. The expression of PadcR-lacZ, PadcAII-lacZ, PphtA-lacZ, PphtB-lacZ, and PphtE-lacZ was measured in CDM and CDM-Zn²⁺ (Zn²⁺ depleted medium) with the addition of 0, 0.1, 0.3, or 0.5 mM Ni²⁺. As AdcR represses the expression of the AdcR regulon in the presence of Zn²⁺, we also used Zn²⁺-depleted medium (CDM-Zn²⁺). β-galactosidase activity (Miller Units) showed that the elevated concentration of Ni²⁺ led to the high expression of all these promoters in CDM and CDM-Zn²⁺ (Figures 2A,B). However, the expression of these promoters was much higher in CDM-Zn²⁺ compared to CDM. The full CDM contains minor amounts of Zn²⁺ (around 883 μg l⁻¹) (Manzoor et al., 2015a), which could explain the lower expression of these promoters in CDM compared to CDM-Zn²⁺. This data not only suggests the role of Ni²⁺ in the regulation of the adcRCBA, adcAII-phtD, phtA, phtB, and phtE, but also indicate the ability of Ni²⁺ to derepress the Zn²⁺-dependent repression of these genes.

Figure 2.

Expression level (in Miller units) of the D39 wild-type containing transcriptional lacZ-fusions to PadcR, PadcAII, PphtA, PphtB, and PphtE, grown in CDM (A) and CDM-Zn²⁺ (Zn²⁺-depleted medium) (B) with different added concentrations of Ni²⁺. Standard deviation of three independent replications is indicated with error bars. Statistical significance of the differences in the expression levels was determined by One-way ANOVA (NS, not significant, ^*P < 0.05, ^**P < 0.001, and ^***P < 0.0001).

Opposite effect of Zn²⁺ and Ni²⁺ on the expression of the AdcR regulon

β-galactosidase activities shown above indicate that Ni²⁺ might compete with Zn²⁺ and that both metal ions have opposite effects on the expression of the adcRCBA, adcAII-phtD, phtA, phtB, and phtE. In order to study the interplay of Ni²⁺ and Zn²⁺ in the regulation of adcRCBA, adcAII-phtD, phtA, phtB, and phtE in more details, we performed β-galactosidase assays with PadcR-lacZ, PadcAII-lacZ, PphtA-lacZ, PphtB-lacZ, and PphtE-lacZ in CDM with the addition of varying concentrations of Ni²⁺ and Zn²⁺ together. β-galactosidase data (Miller Units) showed that addition of Zn²⁺ in the medium leads to the repression of PadcR-lacZ, PadcAII-lacZ, PphtA-lacZ, PphtB-lacZ, and PphtE-lacZ, even in the presence of Ni²⁺. However, repression caused by Zn²⁺ was much weaker at higher concentrations of Ni²⁺ (Figures 3A–E). This data confirm that Ni²⁺ and Zn²⁺ have an opposite effects on the expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE, where Zn²⁺ represses and Ni²⁺ derepresses the expression of these genes.

Figure 3.

Expression level (in Miller units) of the D39 wild-type containing transcriptional lacZ-fusions to PadcR (A), PadcAII (B), PphtA (C), PphtB (D), and PphtE (E), grown in CDM with or without addition of different concentrations of Ni²⁺ and Zn²⁺. Standard deviation of three independent replications is indicated with error bars. Statistical significance of the differences in the expression levels was determined by One-way ANOVA (^*P < 0.05, ^**P < 0.001, and ^***P < 0.0001).

Role of the transcriptional regulator AdcR in the Ni²⁺-dependent expression of the AdcR regulon

Previously, it has been shown that the transcriptional regulator AdcR represses the expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE in the presence of Zn²⁺ (Shafeeq et al., 2011a). In this study, our transcriptomic analysis and transcriptional lacZ-reporter data indicate that Ni²⁺ derepresses the expression of these genes. To identify whether the transcriptional regulator AdcR is also responsible for the Ni²⁺-dependent expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE, we have transformed PadcR-lacZ, PadcAII-lacZ, PphtA-lacZ, PphtB-lacZ, and PphtE-lacZ into the adcR mutant (SS200) and performed β-galactosidase assays. β-galactosidase data revealed that the deletion of adcR leads to increase expression of PadcR-lacZ, PadcAII-lacZ, PphtA-lacZ, PphtB-lacZ, and PphtE-lacZ even in the absence of Ni²⁺ (Figure 4). Upregulation of these transcriptional lacZ-fusions in the adcR mutant indicates that Ni²⁺-dependent expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE is mediated by transcriptional regulator AdcR.

Figure 4.

Expression level (in Miller units) of the adcR mutant containing transcriptional lacZ-fusions to PadcR, PadcAII, PphtA, PphtB, and PphtE grown in CDM with or without addition of 0.5 mM Ni²⁺. Standard deviation of three independent replications is indicated with error bars. Statistical significance of the differences in the expression levels was determined by One-way ANOVA (NS, not significant).

To elucidate the Ni²⁺-dependent role of AdcR in more details and find more targets of AdcR in the presence of Ni²⁺, microarray comparison of the adcR mutant with D39 wild-type was performed in CDM with 0.3 mM Ni²⁺. As expected, the expression of genes belonging to the AdcR regulon was highly upregulated (Table 4), except for the adc operon, which was downregulated in our transcriptome analysis (Table 4). For creating an adcR mutant in previous study, an erythromycin-resistance gene cassette was used to replace the adcR gene (Shafeeq et al., 2011a). Therefore, downregulation of the adc operon might be due to the polar effect of adcR deletion on the downstream genes of adcR (Shafeeq et al., 2011a). We further validated our DNA microarray data by qRT-PCR. qRT-PCR data is also in agreement with our transcriptome data (Supplementary data: Table S2).

Table 4.

Summary of transcriptome comparison of S. pneumoniae D39 wild-type with ΔadcR (SS200) grown in CDM with 0.3 mM Ni²⁺.

Gene taga	Functionb	Ratioc	P-value
SPD0126	Pneumococcal surface protein A, PhpA	2.29	1.35E−05
SPD0277	6- phospho-beta-glucosidase, CelA	12.36	2.28E−13
SPD0278	Hypothetical protein	6.67	1.12E−09
SPD0279	PTS system, IIB component, CelB	7.82	3.99E−09
SPD0280	Transcriptional regulator, CelR	10.24	2.71E−12
SPD0281	PTS system, IIA component, CelC	4.80	1.75E−07
SPD0282	Hypothetical protein	6.8	6.87E−10
SPD0283	PTS system, IIC component, CelD	7.10	8.67E−09
SPD0308	ATP-dependent Clp protease, ATP-binding subunit, ClpL	4.21	5.54E−10
SPD0888	Adhesion lipoprotein, AdcAII (LmB)	1.65	3.39E−04
SPD0889	Pneumococcal histidine triad protein D, PhtD	3.51	1.21E−08
SPD0893	Hypothetical protein	3.51	8.62E−07
SPD1038	Pneumococcal histidine triad protein A, PhtA	5.59	8.67E−09
SPD1514	ABC transporter, ATP-binding protein	−3.35	4.04E−08
SPD1515	Hypothetical protein	−4.06	4.50E−09
SPD1516	Hypothetical protein	−4.57	3.25E−09
SPD1997	Zinc ABC transporter, zinc-binding lipoprotein, AdcA	−18.45	4.07E−13
SPD1998	Zinc ABC transporter, permease protein, AdcB	−2.71	1.29E−04
SPD1999	Zinc ABC transporter, ATP-binding protein, AdcC	−10.76	3.21E−12
SPD2000	adc operon repressor, AdcR	−15.29	7.99E−11
SPD2001	Hypothetical protein	−25.05	1.31E−12

^aGene numbers refer to D39 locus tags.

^bD39 annotation/TIGR4 annotation (Hoskins et al., 2001; Lanie et al., 2007).

^cRatios >2.0 or < 2.0 (SS200+0.3 mM Ni²⁺/wild-type + 0.3 mM Ni²⁺).

Binding of AdcR to its target is Zn²⁺-and Ni²⁺-dependent

To study the direct interaction of AdcR with the promoter regions of the genes belonging to the AdcR regulon in the presence of Ni²⁺, we performed EMSAs with purified Strep-tagged AdcR (Ad-Strep tag) and ³³P-labeled promoters of adcR, adcAII, phtA, phtB, and pcpA. To prevent the interference of metal ions with Ad-Strep tag, all the experiments were performed in EDTA free gels and buffers. The pcpA promoter region was taken as a negative control. Ad-Strep tag was unable to shift the promoter regions of adcR, adcAII, phtA, and phtB in the absence of metal ions (Lane 2 in Figure 5). However, the addition of 0.2 mM Zn²⁺ led to the binding of Ad-Strep tag to the promoter regions of adcR, adcAII, phtA, and phtB (Lane 3 in Figures 5A–D), which is consistent with our previous study (Shafeeq et al., 2011a). Interestingly, 0.2 and 0.4 mM Ni²⁺ were unable to stimulate the binding of Ad-Strep tag with the promoter regions of adcR, adcAII, phtA, and phtB (Lane 4 and 5 in Figures 5A–D). In our transcriptome data mentioned above, Ni²⁺ showed a derepressive effect on the expression of the AdcR regulon. Therefore, we also decided to check the interaction of Ad-Strep tag with the promoter regions of adcR, adcAII, phtA, and phtB in the presence of both Zn²⁺ and Ni²⁺ together. The Zn²⁺-dependent interaction of AdcR with these promoters in the presence of 0.2 mM Zn²⁺ was alleviated with the addition of 0.2 mM or 0.4 mM Ni²⁺ (Lane 6 and 7 in Figures 5A–D). Under the same conditions, we did not see any band shift with the promoter region of pcpA as a negative control (Figure 5E). Thus, this data indicates that Zn²⁺ and Ni²⁺ have an opposite effects on the interaction of AdcR with the promoter regions of adcR, adcAII, phtA, and phtB.

Figure 5.

In vitro interaction of Ad-Strep tag with the promoter regions of adcR (A), adcAII (B), phtA (C), phtB (D), and pcpA (E). Ad-Strep was added at a concentration of 30 nM as indicated above panel, while lane 1 is without added protein. Arrows indicate the position of shifted probe and asterisks indicate the position of free probe. 0.2 mM Zn²⁺ was added in lanes 3, 6, and 7. Whereas, Ni²⁺ was added at the concentration of 0.2 mM in lane 4 and 6, and 0.4 mM in lanes 5 and 7.

Effect of Ni²⁺on SczA-mediated expression of the Zn²⁺-efflux system czcD

To investigate the regulation of czcD in the presence of Ni²⁺, we studied the transcriptional response of PczcD-lacZ grown in complete CDM with the addition of different concentrations of Ni²⁺. β-galactosidase assays showed that PczcD-lacZ responded to Ni²⁺ and its expression was highly increased with an increasing concentration of Ni²⁺ (Figure 6). This data is in agreement with our transcriptomic data mentioned above and suggests the putative role of CzcD in Ni²⁺ homeostasis.

Figure 6.

Expression level (miller units) of the D39 wild-type containing transcriptional lacZ-fusion to PczcD grown in CDM with different added concentrations of Ni²⁺. Standard deviation of three independent replications is indicated with error bars. Statistical significance of the differences in the expression levels was determined by One-way ANOVA (NS, not significant and ^***P < 0.0001).

Discussion

Transition metal ions such as Mn²⁺, Zn²⁺, Cu²⁺, Fe²⁺, Co²⁺, and Cd²⁺ have been shown to play a pivotal role in the metabolism and virulence of S. pneumoniae (Brown et al., 2001; Kloosterman et al., 2008; Shafeeq et al., 2011b; Begg et al., 2015). However, the role of Ni²⁺ on the global gene expression of S. pneumoniae has not been studied before. In this study, we analyze the transcriptome changes in S. pneumoniae D39 wild-type in response to high Ni²⁺ concentration. The expression of a number of important genes and operons with diverse functions, including the AdcR regulon (adcRCBA, adcAII-phtD, phtA, phtB, and phtE), the PsaR regulon (pcpA, prtA, and psaBCA) regulon, and the Zn²⁺-efflux system czcD were significantly altered in the presence of Ni²⁺. We further studied the role of Ni²⁺ in the regulation of the AdcR regulon and demonstrated that Ni²⁺ plays an opposite role compared to Zn²⁺ in the regulation of the AdcR regulon.

The AdcR regulon consists of adcRCBA, adcAII-phtD, phtA, phtB, phtE, and adhC in S. pneumoniae. The adc operon (adcRCBA) is involved in Zn²⁺ acquisition, and encodes for a Zn²⁺-responsive MarR family transcriptional regulator, AdcR, two ABC transporter proteins AdcC and AdcB, and an extracellular Zn²⁺-binding protein AdcA (Dintilhac et al., 1997; Dintilhac and Claverys, 1997; Bayle et al., 2011). The adcAII gene encodes an adhesion lipoprotein which has an overlapping specificity with AdcA for Zn²⁺ (Bayle et al., 2011). AdcAII belongs to the LraI-lipoprotein family and is organized in an operon with a phtD gene encoding pneumococcal histidine triade protein precursor D (PhtD). phtA, phtB, and phtE encodes for pneumococcal histidine triade protein A, B, and E, respectively. Recent studies have demonstrated the role of the PhT family proteins (PhtA, PhtB, PhtE, and PhtD) in intracellular Zn²⁺ acquisition and pathogenesis in S. pneumoniae (Hava and Camilli, 2002; Ogunniyi et al., 2009; Plumptre et al., 2014b). The adhC gene encodes for a Zn²⁺-containing alcohol dehydrogenase. Previously, it was demonstrated that the expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE is repressed, while the expression of adhC is activated by the transcriptional regulator AdcR in the presence of Zn²⁺ (Shafeeq et al., 2011a). Here, we show that Ni²⁺ also plays a role in the regulation of adcRCBA, adcAII-phtD, phtA, phtB, and phtE. Our β-galactosidase assays showed that the expression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE was increased with increasing concentrations of Ni²⁺. However, we did not find any significant change in the expression of adhC in our both transcriptome analysis performed in this study. This might exclude the role of Ni²⁺ in the AdcR mediated regulation of adhC.

High concentrations of Ni²⁺ can be very toxic for bacteria (Macomber and Hausinger, 2011). Therefore, bacteria must limit the toxic amount of Ni²⁺ to perform normal cellular functions. In many bacteria, CDF-family efflux pumps help to maintain proper concentrations of heavy metals in the cell. For example, in Bacillus subtilis, the CzcD heavy metal efflux pump is involved in the homeostasis of Zn²⁺, Co²⁺, Cu²⁺, and Ni²⁺, and is regulated by CzrA (Moore et al., 2005). It is also important to note that the expression of czcD is highly upregulated in our transcriptome analysis in response to Ni²⁺. Expression of czcD is regulated by the TetR family transcriptional regulator SczA in the presence of Zn²⁺, Co²⁺, or Ni²⁺ (Kloosterman et al., 2007). Moreover, Zn²⁺, Co²⁺, or Ni²⁺ has been shown to stimulate the binding of SczA to the promoter region of czcD (Kloosterman et al., 2007). In this study, we further confirmed the expression of czcD in the presence of Ni²⁺ by transcriptional lacZ-reporter study with PczcD-lacZ and our results are consistent with a previous study (Kloosterman et al., 2007).

The PsaR regulon consists of psaBCA, pcpA, and prtA that encodes for the Mn²⁺ uptake system (PsaBCA), a choline binding protein (PcpA), and a serine protease (PrtA), respectively. The expression of the PsaR regulon is shown to be repressed by the DtxR family transcriptional regulator PsaR in the presence of Mn²⁺ (Johnston et al., 2006). Notably, Zn²⁺ and Co²⁺ can bind with PsaR to relieve the Mn²⁺-dependent repression of the PsaR regulon (Kloosterman et al., 2008; Manzoor et al., 2015a). Recently, we have studied the regulation of the PsaR regulon in the presence of Ni²⁺ and demonstrated that like Zn²⁺ and Co²⁺, Ni²⁺ also has the ability to derepress the Mn²⁺-dependent repression of the PsaR regulon, and that high concentrations of Ni²⁺ leads to cell-associated Mn²⁺ deficiency (Manzoor et al., 2015b). In this study, we have also observed the significant upregulation of the PsaR regulon in our transcriptome analysis performed in the presence of Ni²⁺ (Table 3). Upregulation of the PsaR regulon in our transcriptome further verifies our previous results (Manzoor et al., 2015b). Moreover, we have also observed the cell-associated deficiency of Mn²⁺ in our ICP-MS analysis performed in this study (Figure 1), which is also in consistent with our previous results (Manzoor et al., 2015b).

The interplay, or competition, of metal ions plays an important role in the regulation of metal responsive genes. In S. pneumoniae, competition of Mn²⁺ with Zn²⁺, Co²⁺, or Ni²⁺ in the regulation of the PsaR regulon by transcriptional regulator PsaR has already extensively been studied (Kloosterman et al., 2008; Manzoor et al., 2015a,b). Similarly, the interplay of Cu²⁺ and Zn²⁺ in the regulation of cop operon by transcriptional regulator CopY was studied before, where Cu²⁺ induces and Zn²⁺ represses the CopY-mediated expression of cop operon (Shafeeq et al., 2011b). Here, we elaborated for the first time the interplay of Ni²⁺ and Zn²⁺ in the regulation of genes belonging to the AdcR regulon. Our lacZ-reporter studies determined the ability of Ni²⁺, in derepressing the Zn²⁺-dependent repression of adcRCBA, adcAII-phtD, phtA, phtB, and phtE. Our in vitro data showed that the Zn²⁺-dependent binding of AdcR to the promoter regions of the genes belonging to the AdcR regulon was alleviated by the addition of Ni²⁺. Recently, it has been shown that Cd²⁺-uptake reduces the accumulation of cell-associated Mn²⁺ and Zn²⁺ (Begg et al., 2015). Our ICP-MS comparison of cells grown in CDM with 0.5 mM to 0 mM Ni²⁺ has not shown any difference in the concentration of Zn²⁺ or other metal ions, which also indicates the direct role of Ni²⁺ in the regulation of adcRCBA, adcAII-phtD, phtA, phtB, and phtE. Moreover, the role of genes belonging to the AdcR regulon in the pathogenesis of S. pneumoniae has already been demonstrated, which also suggests the important role of Ni²⁺ in pneumococcal virulence.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fcimb.2015.00091