Skip to main content
Cerebral Cortex (New York, NY) logoLink to Cerebral Cortex (New York, NY)
. 2014 Aug 21;26(1):131–143. doi: 10.1093/cercor/bhu183

The Role of Sonic Hedgehog in the Specification of Human Cortical Progenitors In Vitro

Nevena V Radonjić 1,2, Fani Memi 1, Juan Alberto Ortega 1, Nicole Glidden 1, Haiying Zhan 1, Nada Zecevic 1
PMCID: PMC4677972  PMID: 25146370

Abstract

Impaired sonic hedgehog (Shh) signaling is involved in the pathology of cortical formation found in neuropsychiatric disorders. However, its role in the specification of human cortical progenitors is not known. Here, we report that Shh is expressed in the human developing cortex at mid-gestation by radial glia cells (RGCs) and cortical neurons. We used RGC cultures, established from the dorsal (cortical) telencephalon of human brain at mid-gestation to study the effect of Shh signaling. Cortical RGCs in vitro maintained their regional characteristics, expressed components of Shh signaling, and differentiated into Nkx2.1, Lhx6, and calretinin-positive (CalR+) cells, potential cortical interneuron progenitors. Treatment with exogenous Shh increased the pool of Nkx2.1+ progenitors, decreased Lhx6 expression, and suppressed the generation of CalR+ cells. The blockade of endogenous Shh signaling increased the number of CalR+ cells, but did not affect Nkx2.1 expression, implying the existence of parallel Shh-independent pathways for cortical Nkx2.1 regulation. These results support the idea that, during human brain development, Shh plays an important role in the specification of cortical progenitors. Since direct functional studies in humans are limited, the in vitro system that we established here could be of great interest for modeling the development of human cortical progenitors.

Keywords: calretinin, cortical interneurons, development of human cerebral cortex, Lhx6, Nkx2.1, radial glia cultures

Introduction

Sonic hedgehog (Shh), an essential ventral morphogen, plays a role in the embryonic central nervous system patterning by regulating various developmental processes (Dahmane and Ruiz-i-Altaba 1999). In mice, Shh influences the expression of the ventral transcription factors (TFs) Nkx2.1 (thyroid transcription factor-1, TTF1), Dlx1/2, and Ascl1 (Mash1) as well as the specification of cortical interneurons (Anderson et al. 1997; Kohtz et al. 1998; Sussel et al. 1999; Xu et al. 2004, 2005; Butt et al. 2005).

Genetic fate mapping studies showed that the majority of cortical interneurons in mice originate at the medial ganglionic eminence (MGE) from progenitors that express the homeodomain TF Nkx2.1 (Anderson et al. 1997; Sussel et al. 1999; Xu et al. 2005). After down-regulating Nkx2.1, these cells migrate into the cortex and become parvalbumin- (PV) and somatostatin- (Sst) expressing interneurons, whereas calretinin+ (CalR) interneurons originate from the caudal and lateral GE regions of the ventral pallium (Wichterle et al. 2001; Xu et al. 2004, 2010; Butt et al. 2005; Fogarty et al. 2007; Nobrega-Pereira et al. 2008). In primates, however, in addition to the GE of the ventral telencephalon, the ventricular/subventricular zone (VZ/SVZ) of the dorsal telencephalon has been suggested as another source of cortical interneurons (Letinic et al. 2002; Rakic and Zecevic 2003; Zecevic et al. 2005, 2011; Fertuzinhos et al. 2009; Petanjek et al. 2009; Clowry et al. 2010; Jakovcevski et al. 2011; Al-Jaberi et al. 2015). This topic is still controversial since 2 recent studies reported that the majority of cortical interneurons in primates have ventral origin, similar to findings in mice (Hansen et al. 2013; Ma et al. 2013). Nevertheless, consensus has been reached that, in primates, the complexity of cortical progenitor populations increased in the expanded outer SVZ (oSVZ; Smart et al. 2002; Zecevic et al. 2005; Hansen et al. 2010; Fietz and Huttner 2011; Lui et al. 2011; Betizeau et al. 2013).

Although humans heterozygous for Shh mutation display numerous neuropathologies (Belloni et al. 1996; Odent et al. 1999; Schell-Apacik et al. 2003), the role of Shh signaling in the specification of human cortical progenitors has not been studied. We explored this issue in vitro using enriched human radial glia cells (RGCs) from cortical and GE regions of the second trimester fetal telencephalon. Human RGCs are multipotent progenitors with a potential to generate both glia and neurons (Mo et al. 2007; Mo and Zecevic 2009; Yu and Zecevic 2011).

Our results demonstrate that human fetal RGCs in vitro retain the expression of characteristic dorsal and ventral TFs and thus, represent a valuable model for studies of human cortical progenitors. Treatment of cortical RGCs with Shh resulted in a reduction of CalR+ cells and an increase of the Nkx2.1+ cell population, whereas blocking of endogenous Shh with cyclopamine resulted in an increase of CalR+ cells but did not affect Nkx2.1 protein expression. Thus, our in vitro study suggests that human cortical progenitors are a highly plastic cell population which reacts in a specific way to manipulation of Shh signaling. Since it is not possible to study human cortical progenitors in vivo, this in vitro system can contribute to a better understanding of normal human corticogenesis, as well as developmental brain defects resulting in neuropsychiatric disorders.

Materials and Methods

Human Fetal Brain Tissue

Human fetal brain tissue (n = 14) ranging in age from 14 to 22 gestational weeks (GW; Table 1) was obtained from Advanced Bioscience Resources (ABR, Alameda, CA) and StemEx (Diamond Springs, CA, USA) with proper parental consent and the approval of the Ethics Committees. No apparent abnormalities that could influence the development of the central nervous system (CNS) were noted at the time of tissue collection. Fetal age was estimated on the basis of weeks after ovulation, crown-rump length, and anatomical landmarks. Apart from gestational age and sex, no other information was received. Brain tissue was collected in oxygenized Hank's balanced salt solution (HBSS; Life Technologies, Grand Island, NY, USA) with 0.75% antibiotic/antimycotic (Sigma, St Louis, MO, USA) and transported on ice. Dissociated cell cultures were prepared from dorsal and ventral regions of the telencephalon as described previously (Zecevic et al. 2005).

Table 1.

Human fetal brain tissues used in the study and methods applied

Case number GW Method
1 14a Dissociated mixed cell culture, WB, ELISA
2 15a ELISA
3 17b Dissociated mixed cell culture, WB, ELISA
4 17a Dissociated mixed cell culture, WB, RT-PCR
5 17b ELISA
6 18b Dissociated mixed cell culture, WB, RT-PCR, ELISA
7 18c ELISA
8 19a Dissociated mixed cell culture, WB
9 19b ELISA
10 19b ELISA
11 19 Hybridization in situ
12 21 Hybridization in situ
13 22 Hybridization in situ
14 Mid-gestationb ELISA

GW, gestational week; WB, western blot; RT-PCR, real-time PCR; ELISA, enzyme-linked immunosorbent assay.

aCortical proliferative zone.

bCortical and GE proliferative zones separated.

cGE proliferative zone.

Dissociated Mixed Cell Culture and Enrichment of RGCs

Isolated tissue of interest was mechanically dissociated and enzymatically degraded at 37 °C for 30 min with 0.025% trypsin (Gibco). Afterwards, DNase (Sigma-Aldrich, St Louis, MO, USA; 2 mg/mL) was added to the cell suspension and cells were washed in HBSS (Life Technologies). Cells were resuspended in the proliferation medium consisting of DMEM/F12 [Life Technologies with 10 ng/mL of basic fibroblast growth factor (bFGF, Peprotech, Rocky Hill, NJ, USA), 10 ng/mL of epidermal growth factor (EGF, Millipore, Billerica, MA, USA), and supplemented with B27 (Life Technologies)]. Cells were kept in proliferating medium until 80% confluence was achieved, usually 7–10 days after plating. CD15 (Lewis X, Lex), a glycan surface marker of RGCs, was used for immunomagnetic cell sorting of RGCs using MACS columns (Miltenyi Biotec, Auburn, CA, USA). Previously, we have shown that this method results in an enrichment of RGCs to 96% (Mo et al. 2007; Yu and Zecevic 2011; Fig. 1A). For immunocytochemistry, approximately 250 000 cells were plated on coverslips coated with poly-d-lysine (Sigma-Aldrich). For total protein and RNA isolation, approximately 2 million cells were plated in poly-d-lysine-coated wells. In order to confirm the identity of isolated cells, 24 h after isolation live immunocytochemistry was performed using markers for radial glia—CD15 and brain lipid-binding protein (BLBP; Fig. 1B). After 3 days in vitro (DIV), cells were transferred from proliferation to differentiation medium (DM; DMEM/F12/B27 without bFGF and EGF) and kept for an additional 7 or 14 DIV (Fig. 1A).

Figure 1.

Figure 1.

Experimental design. (A) Drawing of a coronal section of mid-gestational fetal brain—cortical VZ/SVZ (blue square) and GE (red square) regions are dissected to make dissociated mixed cell cultures and to enrich RGCs through immunomagneting column sorting; time line depicts days spent in proliferation (PM) and differentiation (DM) medium before fixing cultures. (B) The initial (after 24 h) immunocytochemical verification of isolated RGCs with anti-BLBP (red) and anti-CD15 antibody (green); nuclear staining with bis-benzimide (blue); scale bar: 10 μm. (C) Molecular targets used in the treatment of cultured cells: anti-Shh antibody binds Shh and prevents its action; PMM acts as an agonist of Smo receptor while cyclopamine inhibits it. Ptc1 and Smo are membrane receptors; Glis and SuFu are intracellular downstream effectors in the Shh signaling pathway.

Pharmacological Treatments of Cell Cultures

While in DM, cells were treated for 7, 14, or 21 DIV (every third day) with recombinant human Shh (C24II), N-terminus (200 ng/mL; R&D systems, Minneapolis, MN, USA); purmorphamine (PMM), an agonist of Smoothened (Smo) receptor (1 μM; Calbiochem Millipore); combination of Shh (200 ng/mL) and PMM (1 μM); cyclopamine, an antagonist of Smo receptor (2.5 μM; EnzoLife Sciences, NY, USA); and anti-Shh antibody (10 μg/mL, R&D Systems Cat# MAB4641; Fig. 1C). Control cells were kept in DM (Fig. 1A).

Technical Note

Small synthetic molecule PMM dosage (0.5, 1, and 2 μM) was tested in a pilot experiment. As previously described (Li et al. 2008; El-Akabawy et al. 2011), 1 μM of PMM induced effects on cell proliferation and this was the dose used for further experiments. For cyclopamine we tested doses of 1 and 2.5 μM and in further experiments used the higher dose (Mo and Zecevic 2009).

In Situ Hybridization

The human Shh full coding sequence plasmid was purchased from Addgene (plasmid 13996; Marigo et al. 1995). Riboprobe was generated from the linearized vector construct by in vitro transcription using digoxigenin-UTP (Roche) as the label. In situ hybridization was performed as previously described (Radonjic et al. 2014). Briefly, cryosections (15 μm) were dried at room temperature (RT) for 2 h, subsequently fixed for 10 min with 4% PFA, and washed twice in diethyl pyrocarbonate (DEPC)-treated phosphate buffer solution (PBS) before overnight incubation at 68 °C in hybridization buffer 1× DEPC-treated “salts” (200 mM NaCl, 5 mM EDTA, 10 mM Tris, pH 7.5, 5 mM NaH2PO4·2H2O, 5 mM Na2HPO4; Sigma-Aldrich), 50% deionized formamide (Roche), 0.1 mg/mL of RNase-free yeast tRNA (Invitrogen, Carlsbad, CA, USA), 1× Denhardts (RNase/DNase free; Invitrogen), 10% dextran sulfate (Sigma-Aldrich) containing 100–500 ng/mL of digoxigenin (DIG)-labeled RNA probe. After hybridization, sections were washed 3 times in a solution containing 50% formamide 1× SSC (saline-sodium citrate, Invitrogen) and 0.1% Tween 20 (Sigma-Aldrich) at 65 °C, and 2 times at RT in 1× MABT (20 mM Maleic Acid, 30 mM NaCl, 0.1% Tween 20; Sigma-Aldrich) before incubating in a solution containing 2% blocking reagent (Roche) and 10% heat-inactivated sheep serum in MABT, followed by overnight incubation in alkaline phosphatase (AP)-conjugated anti-DIG antibody (1 : 1500; Roche Applied Science Cat# 11093274910 RRID:AB_514497). Fast Red (Roche) was used for fluorescent color detection of probe (FISH) by incubation in 100 mM Tris, pH 8.2, 400 mM NaCl containing Fast Red for 1–2 h at 37 °C. Sections were counterstained with bis-benzimide and coverslipped using Fluoromount G mounting medium. Specificity of the procedure was assessed with a probe corresponding to the sense strand of Shh.

Immunohistochemistry After In Situ

Following overnight incubation with mouse anti-MAP2 antibody (Sigma-Aldrich Cat# M4403) and goat anti-Sox2 antibody (Santa Cruz Biotechnology Cat# sc-17320), sections were thoroughly washed in PBST (PBS with 0.2% Triton) and incubated with Alexa 488 secondary antibody to detect immunoreactivity. Nuclei were counterstained with bis-benzimide.

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde 24 h after isolation of RGCs or 7 and 14 DIV after pharmacological treatments. Cells were stained with the following antibodies diluted in blocking solution [1% bovine serum albumin, 5% normal goat serum, and 0.5% Tween-20 in PBS: rabbit anti-BLBP (Abcam Cat# ab27171), mouse anti-calbindin (Sigma-Aldrich Cat# C9848), mouse anti-CalR (EMD Millipore Cat# MAB1568), mouse anti-CD15 (Lab Vision Cat# MS-1259-P), rabbit anti-GABA (Sigma-Aldrich Cat# A2052), mouse anti-Ki67 (Beckman Coulter Cat# IM1316), monoclonal rabbit anti-Nkx2.1 (Abcam Cat# ab76013), rabbit anti-neuropeptide Y (ImmunoStar, Inc. Cat# 22940), mouse anti-Pax6 (Developmental Studies Hybridoma Bank Cat# PAX6), mouse anti-PV (Sigma-Aldrich Cat# P3088), mouse anti-Smi31 (Covance, Inc. Cat# SMI-31P-100), and rat anti-Sst (Millipore Cat# MAB354, rabbit anti-Tbr1 (Proteintech Group, Inc. Cat# 20932-1-AP). Primary antibodies were applied overnight at +4 °C, followed by corresponding secondary Alexa 488- (Life Technologies Cat# A11001; A11008; A11055) or Alexa 555-conjugated antibodies (Life Technologies Cat# A11003; A11010) for 2 h at RT. Nuclei were counterstained with a nuclear stain bis-benzimide (Sigma; 5 min at RT).

Characterization of Antibody Specificity

Nkx2.1 immunoreactivity (Abcam Cat# ab76013) in mice closely matched the pattern of staining in previously published studies (Marín et al. 2000) and was not detectable in the brain of thyroid-specific enhancer-binding protein (T/ebp; TTF-1; Nkx2.1) null mouse (Kimura et al. 1996; generous gift from S. Anderson, University of Pennsylvania). In addition, after incubation of antibody with the corresponding Nkx2.1 peptide, no immunoreactivity was observed. Detection of protein in the sample of lysated CD15+ cells by western blot resulted with the band at 38 kDa as expected.

Assessment of Cell Viability

For the assessment of RGC viability after 7 DIV, a LIVE/DEAD viability/cytotoxicity kit (Molecular Probes) was used following manufacturer's instructions. Live cells exhibit intracellular esterase activity, determined by enzymatic conversion of the non-fluorescent cell permeant calcein acetoxymethyl to the intensely green fluorescent calcein, which is well retained within live cells. Ethidium homodimer enters into cells with damaged membranes and binds to nucleic acid producing a bright red fluorescence of dead cells.

Cell Counting and Statistical Analysis

Cells co-labeled with the nuclear stain bis-benzimide and various cellular markers were visualized with a Zeiss fluorescence microscope using the Axiovision software and photographed with a digital camera. Ten predesignated adjacent optical fields of view were examined at magnification ×10 (0.5 mm2 surface area); counts of immunolabeled cells were pooled together, expressed as means ± SEMs (standard error of the means), and analyzed using Student's t-test. The criterion for significance was set at 5%.

Western Blot

Cells were homogenized in lysis buffer [50 mM Tris–HCl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail] on ice for 30 min, centrifuged at 14 000 × g for 15 min at 4 °C, and the supernatants were collected as the cell lysates. Equal amounts of protein from each sample were separated by SDS–PAGE on 10–15% gels and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The following primary antibodies were used: rabbit anti-doublecortin (Dcx; Santa Cruz Biotechnology Cat# sc-28939 RRID:AB_2088488), rabbit anti- panDlx (gift from Dr Yuri Morozov, Yale University), rabbit monoclonal anti-Nkx2.1 (Abcam Cat# ab76013), mouse anti-Lhx6 (Sigma-Aldrich Cat# WH0026468M1), mouse anti-Mash1 (BD Biosciences Cat# 556604), rabbit anti-Tbr2 (gift from Dr Robert F. Hevner, Washington University), goat anti-Emx1 (Santa Cruz Biotechnology Cat# sc-19955), and rabbit anti-Pax6 (Covance, Inc. Cat# PRB-278P-100). All membranes were probed with anti β-tubulin (Thermo Scientific Pierce Antibodies Cat# PA1-16947), GAPDH (Millipore, Cat# MAB374), or anti-actin (Thermo Scientific Pierce Antibodies Cat# MA5-15739) antibodies to ensure that all wells were equally loaded. Western blots were scanned and densitometric analysis was performed using ImageQuant 5.2 (GE Healthcare Life Sciences) and Image J software (ImageJ). Statistical analyses were performed using paired t-test. The criterion for significance was set at 5%.

Real-Time PCR

mRNA expression levels of Shh, Patched1 (Ptc1), Smo, suppressor of fused (SuFu), and various TFs were determine by real-Time PCR (RT-PCR; Table 2). Total RNA was extracted from cells using TRIZOL® reagent (Invitrogen) according to the manufacturer's instructions. Approximately 1 μg of RNA was used in the reverse transcription reaction using M-MuLV reverse transcriptase with random hexamers (Fermentas, Vilnus, Lithuania) according to the manufacturer's instructions. RT-PCR was performed in a Realplex2 Mastercycler (Eppendorf, Hamburg, Germany) using 96-well reaction plates (Eppendorf). The reactions were prepared according to the standard protocol for one-step QuantiTect SYBR Green RT-PCR (Applied Biosystems, Cheshire, UK). The sequences of the forward and reverse primers are presented in Table 2. The thermal cycle conditions were 95°C for 2 min followed by 40 cycles of 15 s at 95°C, 15 s at 55 °C, and 20 s at 68 °C. All assays were performed in triplicates. Averaged cycle of threshold (Ct) values of GAPDH triplicates were subtracted from Ct values of target genes to obtain ΔCt, and then relative gene expression was determined as 2−ΔCt . The results were presented relative to the control value, which was arbitrarily set to 1.

Table 2.

List of primer sequences used in the study

Gene Forward Reverse
Ascl1 (Mash1) TCTCATCCTACTCGTCGGACGA CTGCTTCCAAAGTCCATTCGCAC
Emx1 TCGAGAAGAACCACTACGTG CCTGCTTCGTGGCAAT
GAPDH ACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA
Gli1 AGGAGAAGCGTGAGCCTGAAT GGCTTCTCGCCAGTGTGTCT
Gli2 ATGGAGACGTCTGCCTCAGC CCGTGGACAGAATGAGGCTC
Gli3 TTCTCAAATGCCTCTGATCGC CTCGCTGCTTCTTGGTGACAT
Gsx2 GGAGATTCCACTGCCTCACCAT CGGAGTCGAGACAGGTACATGT
Lhx6 CGCATCCACTACGACACCATGA GCTTGGGTTGACTGTCCTGTTC
Nkx2.1 CACGCAGGTCAAGATCTGGTT TTGCCGTCTTTCACCAGGA
Pax6 ACAGACACAGCCCTCACAAACA CGGGAACTTGAACTGGAACTGAC
Shh AATGTGGCCGAGAAGACCC AGATGGCCAAAGCGTTCAAC
Smo CACCCTGGCCACATTCGT AAGTGTGCCAGGCATAGGT
SuFu CAGCAAACCTGTCCTTCCACCA CAGATGTACGCTCTCAAGCTGC
Patched1 GCGGCTACTTACTCATGCTCG ACCAACACCAAGAGCGAGAAA
Tbr2 GGGCACCTATCAGTACAGCCA AAGGAAACATGCGCCTGC

Enzyme-Linked Immunosorbent Assay

For determination of Shh concentration, we used enzyme-linked immunosorbent assay (ELISA) following manufacturer's instructions (Abcam Cat#100639). Shh concentration was determined in human fetal cortices (n = 9; 14–19 gw) and GEs (n = 7; 15–19 gw) as well as lysates of cortical and GE RGCs (n = 3).

Results

Shh Expression in the Dorsal Telencephalon of the Human Fetal Brain

Cell types expressing Shh in cortical regions of the human fetal telencephalon are largely unknown, due to the technical difficulties with available antibodies to this secreted protein. We thus assessed the expression of Shh using in situ hybridization on cryosections and RT-PCR on human fetal tissue dissected from the dorsal (cortical) and ventral (GE) telencephalon at mid-gestation (∼20 gw). At this developmental stage, Shh mRNA signal in the cortex had a wide distribution, with transcripts detected in the VZ, oSVZ, intermediate zone (IZ), subplate (SP), and cortical plate (CP; n = 3; Fig. 2A). The majority of cells expressing Shh mRNA were localized in the CP/SP border and deeper in the IZ/oSVZ, congruent with transcriptome analysis performed for the same gestational age (www.brainspan.org; Kang et al. 2011; Miller et al. 2014). We expanded these results to determine that the cells expressing Shh transcript belonged to either radial glia progenitor cells co-labeled with Sox2 or neurons co-labeled with MAP2 antibody (Fig. 2B,C). These results are in line with reported expression of Shh in layer V pyramidal cells of the mouse neocortex (Garcia et al. 2010; Harwell et al. 2012).

Figure 2.

Figure 2.

The expression of Shh in the human forebrain. (A) Distribution of Shh mRNA transcripts in the fetal dorsolateral cerebral cortex (21 gw) as revealed by hybridization in situ. Insets show a higher magnification of the boxed areas. (B and C) Double-labeling with fluorescent hybridization in situ for Shh and immunohistochemistry for MAP2 (B) and Sox2 (C) show neurons and RGCs expressing Shh. (D) Relative expression of Shh, Ptc1, Smo, Gli1, Gli2, Gli3, and SuFu mRNAs in GE and cortical regions of the human fetal forebrain (17 gw). The results are presented relative to the cortical tissue which value is arbitrarily set to 1. (E) Shh concentration in cortical (n = 9; 14–19 gw) and GE (n = 7; 15–19 gw) regions of the human fetal brain determined by ELISA. CP, cortical plate; SP, subplate; IZ, intermediate zone; oSVZ, outer subventricular zone; iSVZ, inner subventricular zone; VZ, ventricular zone. Scale bars: 50 μm (A), 10 μm (A inset, B). *compared with the cortex (P < 0.05).

It is well described that Shh binding to its receptor Ptc1 relieves inhibition of Smo which signals intracellularly through interaction with TFs of the Gli family (Glis). Glis can further activate or repress the transcription of specific target genes (Fig. 1C, reviewed in Fuccillo et al. 2006; Le Dréau and Martí 2012). The TFs Gli1 and Gli2 are activators, while Gli3 represses the function of Shh (Ruiz i Altaba 1998). A SuFu acts as a negative regulator of Shh signaling and inhibits Gli transport from the cytoplasm to the nucleus (Ding et al. 1999; Barnfield et al. 2005). We evaluated the mRNA levels of Shh and its downstream effectors (Fig. 2D) in human fetal tissue dissected from cortical and GE regions of 2 cases (17 and 18 gw). The levels of mRNA for Shh, Ptc1, and Smo were several times higher in the GE than in the cortex (2.5 ± 1.3, 2.7 ± 1.1, and 2.5 ± 0.3 times, respectively; cortical tissue levels arbitrarily set to 1; Fig. 2D). The mRNA levels of downstream effectors Gli1, Gli2, and SuFu were also higher in the GE; Gli1 had the highest fold increase in the GE (5 ± 1.3-fold), followed by Gli2 (1.9 ± 0.01-fold) and SuFu (1.1 ± 0.2) when compared with the cortex (Fig. 2D). The levels of Gli3, a repressor of Shh signaling, were however reduced in the GE in respect to that in the cortex (0.4 ± 0.02-fold; Fig. 2D). These findings demonstrated that various effectors of Shh signaling were present in both the cortical region and ventral (GE) human telencephalon at mid-gestation. Moreover, results on human fetal tissue support findings in mice (Komada 2012) and confirmed that all studied Shh signaling effectors, except Gli3, were more prominent in GE than in cortical region of the telencephalon.

Finally, we determined by ELISA the concentration of Shh in cortical (n = 9; 14–19 gw) and GE regions (n = 7; 15–19 gw) of the human developing brain (Fig. 2E). Shh concentration was 4.4-folds higher in the GE (12 241 ± 3345 pg/mL) compared with the cortical region (2777 ± 482 pg/mL). These results are congruent with our obtained mRNA data. Hence, although at lower levels than ventrally, Shh transcript and protein are present in the dorsal telencephalon of the human fetal brain.

TF Profile of Human RGC Cultures In Vitro

Experimental studies on human brain development can only be performed in vitro. For the purpose of this study, we enriched RGCs from the dorsal (cortical) and ventral (GE) telencephalon in the second trimester of gestation (14–19 gw). These regions can be precisely dissected in a relatively large human fetal brain. We first sought to assess whether enriched human RGCs retain their dorsal and ventral characteristics in vitro, based on the expression of TFs mRNAs and proteins that in the mouse identify the dorsal and ventral pallium (Fig. 3A,B). In rodents, Emx1, a homeodomain TF, is expressed during development in cortical regions but not in the ventral pallium (Yoshida et al. 1997; Bishop et al. 2003; Puelles and Rubenstein 2003). In accord with these findings, our RT-PCR results showed Emx1 mRNA only in dorsal and not in ventral RGC cultures (Fig. 3A). Two other dorsal markers, Pax6 and Tbr2, were mainly expressed dorsally, although smaller amounts were also seen ventrally. As expected, TF mRNAs for Lhx6, Ascl1, and Gsx2 were higher ventrally, with the most prominent difference in Lhx6 levels (Fig. 3A). These RT-PCR results were confirmed with western blot protein levels (Fig. 3B). Hence, we concluded that cortical and GE RGCs express characteristic regional TFs in vitro. In addition, we demonstrated that human cortical RGCs express Dlx, Nkx2.1, and Lhx6, TFs involved in interneuron generation (Fig. 3B). This is consistent with previous results obtained by immunolabeling freshly isolated cortical RGCs, where both Dlx and Nkx2.1 were observed in vimentin-labeled RGCs (Yu and Zecevic 2011).

Figure 3.

Figure 3.

Characterization of RGC cultures and the effect of Shh signaling on RGCs. (A–C) TF profile of RGCs. (A) Relative expression of Emx1, Pax6, Tbr2, Ascl1, Lhx6, and Gsx2 in cortical and GE RGCs at 17 gw by RT-PCR. (B) Protein expression of TFs in cortical and GE RGCs by western blot. (C) Relative expression of Shh and its downstream effectors at 17 gw in GE and cortical RGC cultures by RT-PCR. (D) Shh concentration in cortical and GE RGCs determined by ELISA. (E–H) Effect of Shh signaling on cell proliferation and cell survival in RGC cultures (17 gw). (E) Representative staining of proliferating cells labeled with anti-Ki67 antibody (red) and nuclear staining with bis-benzimide in blue. (F) Percentage of proliferating cells in cortical and GE RGC cultures. (G) Live–dead viability staining of cortical RGCs after 7 DIV; alive cells in green and dead cells in red. (H) Percentages of dead cells out of total cell number from dorsal and ventral RGCs. Scale bars: 20 μm (E), 50 μm (G). *compared with control cortical RGCs; #compared with control GE RGCs (P < 0.05).

Human RGC Cultures Have the Necessary Components to Respond to Shh Signaling

To verify the presence of Shh in RGCs and gain quantitative information about its expression levels, we determined the concentration of Shh in enriched cortical and GE RGCs by ELISA. We found that Shh concentration was similar. In cortical RGCs, it was 7482 ± 1756 pg/mL while in GE RGCs it was 8018 ± 1722 pg/mL (Fig. 3D). Next, we established the presence of the molecular machinery (Smo, Ptc1, Glis, and SuFu) necessary to respond to Shh signaling in these cultures (Fig. 3C). Results on mRNA level are in accord with the concentration of Shh in cortical and GE RGCs, with differences between regions not as prominent as in the brain tissue (Fig. 3C). This is probably due to the fact that, in the tissue, there are multiple sources of Shh, which include not only RGCs but also neurons and glia cells, as we have previously demonstrated (Fig. 2B,C). However, further experiments are needed to test this hypothesis. The levels of Shh and Ptc1 mRNAs were 0.93 ± 0.25 and 0.6 ± 0.4 in GE compared with cortical RGC cultures, while Smo and Gli1 mRNA expressions were approximately the same in RGCs from either region (Fig. 3C). Furthermore, the levels of Gli2, Gli3, and SuFu mRNA were reduced in GE cultures compared with the cortical (0.8 ± 0.4, 0.22 ± 0.1, and 0.6 ± 0.16, respectively; Fig. 3C). Despite individual variations in the studied cases, the important conclusion is that RGCs enriched from either the human fetal cortex and GE at the second trimester of gestation have the necessary elements to respond to Shh signaling.

The Effect of Shh Manipulation on Human RGC Cultures

We next examined the response of human RGC cultures obtained from cortical and GE regions to Shh (Table 3). First, we studied how treatment with exogenous Shh affected various members of Shh signaling, and found that after 7 DIV it induced an increase in Gli1 and Ptc1 mRNA levels and a decrease in Gli3, in cultures of either region (Table 3). In contrast, inhibition of Shh signaling with cyclopamine resulted in a decrease in the mRNA levels of Gli1 and Ptc1, while the mRNA levels of the suppressor Gli3 either remained unchanged or decreased. These results are in accord with previous reports in mice (Sasaki et al. 1999; Dahmane et al. 2001).

Table 3.

Effect of exogenous Shh and cyclopamine on the expression of Gli1, Gli3, and Ptc1 mRNA in cortical and GE RGCs after 7 DIV

Treatment Gene
Gli1
Gli3
Ptc1
Shh Cyclop Shh Cyclop Shh Cyclop
Cortical 17 gw ↑4.68 ↓0.46 ↓0.69 1.06 ↑1.75 0.95
Cortical 18 gw ↑54.95 ↓0.29 ↓0.57 ↓0.56 ↑7.05 ↓0.54
GE 17 gw ↑15.30 ↓0.34 1.06 ↓0.76 ↑3.27 ↓0.77
GE 18 gw ↑1.70 ↓0.67 ↓0.56 1.12 ↑1.25 ↓0.69

Shh is a well-known inducer of cell proliferation and survival in rodent models, both in vivo and in vitro (Rowitch et al. 1999; Gulacsi and Lillien 2003; Komada et al. 2008; Shikata et al. 2011; Komada 2012). Thus, we estimated the effect of Shh on cell proliferation and viability in human RGC cultures (Fig. 3E–H). In cortical RGC cultures, the number of proliferating cells (Ki67+) increased after treatment with either the small molecule PMM (130%) or Shh (122%) compared with control conditions (Fig. 3F). Inhibition of Shh signaling with either an anti-Shh antibody or cyclopamine reduced the percentage of proliferating RGCs to 61% and 66%, respectively, compared with controls (Fig. 3F). In GE cultures, an increase in proliferation was induced only by application of exogenous Shh (205%) but not of PMM. Treatment with anti-Shh antibody or cyclopamine reduced a fraction of proliferating cells to 11% and 71% of controls, respectively (Fig. 3F). These results suggest that neutralizing endogenously the secreted Shh with antibody was more effective than blocking the downstream Shh receptor, Smo. A similar response in the density of Ki67+ cells was present after 14 DIV (data not shown) in both cortical and GE RGC cultures.

Additionally, we assessed the viability of the cells in these cultures by the LIVE/DEAD viability/cytotoxicity test (Fig. 3G,H). A 7-DIV Shh treatment did not compromise cell viability, whereas endogenous Shh inhibition by cyclopamine increased the number of dead cells both in cortical and GE RGC cultures (172% and 191%, respectively) compared with untreated control cultures (Fig. 3H).

Shh Maintains the Progenitor State of Nkx2.1+ Cells

Previously, we reported that Nkx2.1-expressing cells are proliferating in the human oSVZ (Jakovcevski et al. 2011; Zecevic et al. 2011), and that Nkx2.1+ cells can be generated from cortical RGCs in vitro (Yu and Zecevic 2011) at the same gestational period studied here. Now, we explored whether Shh signaling has an effect on the expression of Nkx2.1 and Lhx6 TFs in our cortical RGC cultures. Indeed, the exogenous Shh treatment induced an increase in the number of Nkx2.1+ progenitor cells (Fig. 4A). Furthermore, Nkx2.1+ cells proliferated in both the control and Shh-treated group, as seen by double-labeling with Ki67 (Fig. 4B). Although cyclopamine treatment decreased both the total cell number and the number of proliferating cells, Nkx2.1 expression was still present after 7 DIV (Fig. 4B). We estimated the level of Nkx2.1 and Lhx6 protein expression in cortical RGC cultures from 5 cases (14–19 gw) using western blot analysis (Fig. 4C). PMM/Shh treatment induced a 54% increase in Nkx2.1 expression (P = 0.028), while cyclopamine did not affect the level of Nkx2.1 protein (Fig. 4C,D). We used the same samples to determine the expression of Lhx6, a downstream molecule from Nkx2.1. In contrast to Nkx2.1, treatment with PMM/Shh decreased the expression of Lhx6 by 46% as compared with the control (P = 0.034), while cyclopamine did not have a significant effect (Fig. 4C,E). Therefore, it seems that Shh primarily acts on cortical Nkx2.1+ progenitors to increase their number and to maintain them in the progenitor state, without their further lineage progression into Lhx6+ cells. This effect of Shh treatment is similar to that of Shh on Olig2+ progenitors in vitro, where we reported that exogenous Shh induced and maintained a pool of Olig2+ oligodendrocyte progenitors derived from cortical RGCs (Ortega et al. 2013). Blockade of endogenous Shh signaling with cyclopamine, however, did not result in expected changes in the expression of Nkx2.1 and Lhx6. These findings suggest that Shh is not the only regulator of either Nkx2.1 or Lhx6 expression.

Figure 4.

Figure 4.

The effect of Shh signaling on Nkx2.1+ cells generated from cortical RGCs (17 gw) after 7 DIV. (A) Representative images of Nkx2.1+ cells (green) and (B) proliferating Nkx2.1+ cells (green) co-labeled with anti-Ki67 antibody (red, arrows); nuclear staining with bis-benzimide (blue). (C) Representative western blots of Nkx2.1 and Lhx6 protein expressions in cortical RGCs (19 gw) treated with Shh/PMM and cyclopamine; β-tubulin was used as a loading control. (D and E) Densitometric analysis of the effect of PMM/Shh and cyclopamine treatment on the levels of Nkx2.1 and Lhx6 protein expression in cortical RGCs. *compared with the control (P < 0.05). Scale bars: 50 μm (A) and 20 μm (B).

Classes of GABAergic Cells Derived from RGC Cultures In Vitro

To estimate the number of total interneurons in enriched RGC cultures after 7 DIV of differentiation, we used immunolabeling with anti-GABA antibody. In 4 fetal brains at 2 developmental ages, 14 gw (n = 1) and 17–18 gw (n = 3), the percentage of GABA+ cells from all cells varied from 45% in cortical RGC cultures at 14 gw to 29% at 17–18 gw. Thus, by the second trimester of gestation, approximately one-third of cells in RGC cultures isolated from the cortical region of the human fetal telencephalon have the capacity to generate GABAergic neurons.

To investigate which classes of GABAergic neurons are produced in human cortical RGC cultures, we performed double-labeling with GABA and several accepted markers of interneuron subtypes, such as CalR, calbindin (CB), PV, Sst, and NPY. At investigated time points, the majority of GABAergic cells were co-labeled with CalR (Fig. 5), and no cells were labeled with other studied interneuron markers, namely PV, Sst, CB, or NPY. However, a fraction of CalR+ cells did not co-localize with GABA. From all CalR+ cells, the percentage of CalR+/GABA− cells was 8–10% at 14 gw and 27% at 17 gw. A similar result was reported in mouse neuron cultures where 15% of CalR+ cells did not express GABA (Xu et al. 2004). CalR is rarely expressed in pyramidal cells (DeFelipe et al. 2002) and to investigate that possibility, we used double-labeling at 21 DIV with Tbr1, a TF specific for glutamatergic projection neurons (Englund et al. 2005; Fig. 5D). We did not observe CalR/Tbr1 double-labeled cells, and this result supports our previous findings that glutamatergic markers (vGlut1/vGlut2) did not co-localize in the same cells with CalR in cultured human fetal RGCs (Yu and Zecevic 2011). Notably, the percentage of CalR+ cells in our cultures was age-dependent. At 14 gw after 7 DIV, 45% of total cells were CalR+, whereas at 17–18 gw this percentage decreased to 30% (n = 3; Fig. 5E,F). This finding agrees with our previous studies on human RGC differentiation (Mo et al. 2007; Radonjic et al. 2014), supporting the idea that, at this developmental time window, cortical RGCs have a considerable potential to generate CalR+ cells.).

Figure 5.

Figure 5.

The effect of Shh signaling on generation of CalR+ cells from cortical RGC cultures. (A–C) At 7 DIV, CalR+ (red) and GABA+ (green) immunolabeled cells from 17 gw RGCs. (D) CalR+ (red) and Tbr1+ (green) immunolabeled cells from 17 gw at 21 DIV; nuclear staining with bis-benzimide (blue). Percentages of CalR+ cells generated from RGCs at 14 gw (E) and 17–18 gw (F). (G) Effect of PMM/Shh and cyclopamine treatment on the level of Ascl1/Mash1 protein expressions in RGC cultures at mid-gestation (n = 5); actin was used as a loading control. *compared with the control (P < 0.05). Scale bars: 50 μm.

In Vitro Treatment with Shh Decreases the Density of CalR+ Cells

We next assessed whether Shh treatment affects the number of generated CalR+ cells in cortical RGC cultures (Fig. 5). Cases were separated by age into 2 groups: 14 gw (n = 1) and 17–18 gw (n = 3; Fig. 5). After 7 DIV, in the 14 gw group, treatment with PMM reduced the number of CalR+ cells by 17% of controls, treatment with Shh by 27%, and the combined PMM/Shh treatment by 22% (Fig. 5E). Opposite to this, cyclopamine treatment increased by one-third the number of CalR+ cells (28%; Fig. 5E). The same pattern of changes was observed in the 17–18 gw group (Fig. 5F). CalR+ cells were decreased 44%, 38%, or 30% by treatment with PMM, Shh, or Shh/PMM, respectively, whereas cyclopamine led to a 22% increase in the percentage of CalR+ cells compared with the control cultures (Fig. 5F). Thus, progenitor cells from cortical regions had the same response to exogenous Shh (decrease of CalR+ cells) and blocking of endogenous Shh (increase of CalR+ cells) at 2 time points studied (14 and 17–18 gw).

In order to examine if these changes are absolute or only relative to the total cell number, we expressed the density of CalR cells per mm2 surface area and obtained similar results. Although the number of studied cases is limited and needs to increase as they become available, it is important to emphasize that different molecules used to enhance the Shh signaling lead to the same type of changes in all experiments. Hence, our results suggest that, at mid-gestation, increased Shh signaling reduced the number of CalR+ cells in our cortical RGC cultures. Similar results were obtained for the expression of Ascl1/Mash1, which in the embryonic mouse the telencephalon is required in CalR lineage as a downstream effector of the Gsx gene (Wang et al. 2009). We determined that treatment with PMM/Shh resulted in a 30% decrease in Ascl1 expression in cortical RGC cultures, which parallels the effect on CalR+ cells. Blockade of Shh signaling by cyclopamine treatment did not have an effect on Ascl1 levels (Fig. 5H).

Finally, to examine the effect of Shh treatment on the generation of excitatory neurons, we estimated the expression of dorsal TFs, Emx1, Pax6, Tbr2, and the marker for immature neurons, doublecortin (Dcx), produced in our RGC cultures. Western blot analysis demonstrated no difference in Emx1, Tbr2, and Dcx levels after PMM/Shh treatment. However, inhibition of endogenous Shh by cyclopamine induced a 90% increase in Emx1 expression (Fig. 6A). Previously, we demonstrated that, at the time of their isolation, 95% of RGCs are Pax6-positive (Mo and Zecevic 2008; Yu and Zecevic 2011). Consistent with this, we now demonstrated that, after 7 DIV of differentiation, still a majority (72%) of RGCs expresses Pax6 (Fig. 6B). Similar to Emx1, exogenous Shh/PMM treatment did not influence the number of Pax6+ cells, whereas treatment with cyclopamine increased their number (Fig. 6C). Immunolabeling with SMI31, a marker of a subtype of pyramidal neurons (Campbell and Morrison 1989; del Río and DeFelipe 1994; Mo and Zecevic 2008), did not show a difference in the number of labeled cells after Shh/PMM or cyclopamine treatment (Fig. 6D,E).

Figure 6.

Figure 6.

The effect of Shh signaling on cortical projection progenitors. (A) Effect of PMM/Shh and cyclopamine treatments on the level of Tbr2, Dcx, and Emx1 protein expressions; actin and GAPDH were used as loading controls. (B and D) Representative staining of Pax6-positive (red; B) and Smi31-positive (red; D) stainings; nuclear staining with bis-benzimide in blue; (C and E) Effect of Shh signaling on the percentage of Pax6+ (C) and Smi31+ (E) cells from the total cell number. *compared with the control (P < 0.05). Scale bars: 50 μm.

Our results, thus, support the idea that increased Shh signaling at mid-gestation does not affect cortical projection neurons. We hypothesize that Shh plays a role in the specification of the interneuron progenitor pool by increasing and maintaining Nkx2.1+ progenitors at the expense of Ascl1/CalR progenitors (Fig. 7).

Figure 7.

Figure 7.

Hypothetical model for the differential specification of cortical RGCs by Shh signaling. Cortical RGCs have the capacity to generate CalR+ cells and Nkx2.1+ progenitors, which further progress to Lhx6+ cells. Shh suppresses the expression of Ascl1/Mash1 and subsequent generation of CalR+ cells and promotes the expression of Nkx2.1+ cells but not their further progression to Lhx6+ cells.

Discussion

The present study demonstrates a wide expression of Shh in neurons and RGCs throughout the developing human cerebral cortex at mid-gestation and effects of Shh on specification of human cortical progenitors in vitro. Three findings obtained in our in vitro system of human RGCs should be emphasized. First, human cortical progenitors at mid-gestation have the necessary elements to respond to Shh signaling. Treatment with Shh and its agonist increased proliferation, while inhibition of Shh signaling decreased proliferation and increased cell death of cortical progenitors. Secondly, Shh treatment increased the number of Nkx2.1 progenitors, but did not promote their further differentiation into Lhx6+ cells. Thirdly, exogenous Shh reduced the number of CalR+ cells and the expression of Ascl/Mash1, whereas blocking of endogenous Shh with cyclopamine had the opposite effect.

Shh Signaling Plays a Role in the Cell Cycle of the Cortical RGCs

In addition to the well-known role of Shh in ventral telencephalon patterning and specification of MGE-derived interneurons in mice, in the dorsal telencephalon Shh plays a role in the differentiation of cortical pyramidal neurons (Garcia et al. 2010) and the formation of cortical circuitry (Harwell et al. 2012). Another proposed role for dorsal Shh is enabling the transition from tangential to radial migration of cortical interneurons, signaling through their primary cilium (Baudoin et al. 2012). While heterozygous Shh mouse mutants appear normal, humans heterozygous for Shh mutation display a wide variety of pathologies (e.g., attention deficit, language impairment, and autism), suggesting that in humans one copy of the Shh gene is not sufficient for adequate Shh protein level expression necessary for cortical development (Shikata et al. 2011).

Shh expression has been reported in the embryonic human CNS (Hajihosseini et al. 1996; Odent et al. 1999; Orentas et al. 1999), but our results are the first to demonstrate the concentration of Shh protein and cell type-specific distribution of Shh mRNA in RGCs and postmitotic neurons in the human fetal cerebral cortex. These results are in agreement with reported transcriptome analysis of human fetal neocortex at the respective age (Kang et al. 2011; Miller et al. 2014; www.brainspan.org). Importantly, cultured human fetal RGCs, both from the cortex and GE, express the necessary components for Shh signaling, at the mRNA and protein level, including Shh receptors and Gli family TFs. In some cases (e.g., Lhx6), our RT-PCR results did not fully mirror the results obtained by western blot. The discrepancy between mRNA and protein levels has been reported before, and a number of factors ranging from post-transcriptional modifications to variable protein turnover or different gene regulation feedbacks were suggested to underlie this phenomenon (Greenbaum et al. 2003; Raser and O'Shea 2005; Dessaud et al. 2008; Fancy et al. 2011).

Treatment with Shh in our cortical cultures increased cell proliferation, whereas inhibition of endogenous Shh decreased the number of dividing cells and increased cell death. These findings correlate well with previous in vitro studies in mice (Dahmane et al. 2001; Gulacsi and Lillien 2003; Komada et al. 2008) or knockout mice phenotypes, where the change of cell cycle kinetics resulted in a smaller telencephalon and cortex (Komada et al. 2008).

Shh Increases Nkx2.1 Expression in Human Cortical RGC Cultures

Cells in the human neocortical VZ/SVZ at mid-gestation express several TFs implicated in interneuron specification, such as Dlx1/2, Nkx2.1, Lhx6, and Ascl1/Mash1, and some of these cells are proliferating locally (Rakic and Zecevic 2003; Zecevic et al. 2005; Jakovcevski et al. 2011). Our previous results showed that human cortical progenitors have the capacity to generate Nkx2.1+ and Dlx+ cells in vitro (Yu and Zecevic 2011), and in the present study we demonstrate that a subpopulation of these Nkx2.1+ cells are proliferating (Fig. 4). However, we cannot exclude the possibility that, in our cortical RGC cultures, some progenitors migrated from the GE and re-entered the mitotic cycle in the dorsal pallium as reported in mice studies (Wu et al. 2011); therefore, this issue should be further explored. Our findings are in contrast to rodent studies, where Nkx2.1 is exclusively expressed in the ventral telencephalon, particularly in the MGE (Anderson et al. 1997; Sussel et al. 1999; Nobrega-Pereira et al. 2008) or in isolated cortical cells in neonatal mice (Ohira et al. 2010). They are also different from other reports in human fetal brains, which did not observe proliferating Nkx2.1+ cells in the human cortical VZ/SVZ (Hansen et al. 2013; Ma et al. 2013). This discrepancy might be due to differences in tissue fixation methods, antibodies used, or variations present in the human fetal brain samples. Additionally, we demonstrated that, in the process of differentiation, cortical RGCs express not only Nkx2.1 but also Lhx6, a TF downstream of Nkx2.1, which suggests their commitment to specific PV/Sst interneuron lineage.

The ectopic expression of Shh gene in the dorsal telencephalon of zebrafish and mice induced expression of Nkx2.1 (Barth and Wilson 1995; Shimamura and Rubenstein 1997; Kohtz et al. 1998), and treatment of mice cortical progenitors with Shh results in generation of GABAergic cells (Götz et al. 1995; Gulacsi and Lillien 2003). Nkx2.1+ cells were also produced from human pluripotent stem cells, but only if a combination of PMM/Shh and Wnt/BMP inhibitors was used to induce ventral characteristics in these cells (Maroof et al. 2013). In contrast, we demonstrated that human cortical RGCs at mid-gestation have the potential to generate Nkx2.1+ cells (Yu and Zecevic 2011) and we showed here a Shh-induced increase in Nkx2.1 expression. It would be interesting to further study the role of Wnt signaling and its interplay with Shh in this process. Notably, although treatment with PMM/Shh increased the Nkx2.1 expression, the level of Lhx6 decreased, suggesting a delayed differentiation of Nkx2.1+ progenitors into Lhx6+ migratory cells. Thus, human cortical interneuron progenitors seemed to share some similarities with mice where Shh is important to maintain ventral Nkx2.1+ progenitors, but does not affect their migration or further differentiation (Xu et al. 2005). It is, however, important to stress that the progeny of cortical Nkx2.1+ cells in humans is still not known, and thus its lineage relationship to Lhx6+ cells and further to PV and Sst interneurons is yet to be determined.

On the other hand, inhibition of endogenous Shh with cyclopamine did not have a significant effect on Nkx2.1 or Lhx6 expression in our RGC cultures, similar to a report in mice where anti-Shh antibodies did not affect Nkx2.1 but reduced Dlx expression (Kohtz et al. 1998). Differences in Shh function in vivo and in vitro were previously observed in oligodendrocyte generation, where Shh has a crucial role in overcoming negative regulation of oligodendrogenesis in vivo but not in vitro (Nery et al. 2001).

Shh Represses the Generation of Cortical CalR Interneurons in Human Cortical RGC Cultures

We demonstrated that the treatment with Shh and its agonists reduced both the number of CalR+ cells and expression of Ascl1/Mash1, a TF upstream of CalR. This is in agreement with reports in mice that the exogenous Shh treatment of MGE progenitors down-regulated CalR (Xu et al. 2005; Carney et al. 2010; Xu et al. 2010). On the other hand, we found that in vitro blocking of Shh increased the number of generated CalR+ cells. This is similar to findings in mice where down-regulation of Shh in MGE or creating conditional Nkx2.1 mutants resulted in the conversion of interneuron fate in favor of CalR+ and Vasointestinal Peptide expressing (VIP+) neurons (Butt et al. 2005, 2008; Xu et al. 2005, 2010; Carney et al. 2010). Our in vitro results demonstrate for the first time the role of Shh in fate determination of human cortical progenitors, showing their remarkable plasticity.

Conclusion

Multiple reports suggested that larger progenitor diversity has a profound impact on the phenotype of primate cortex (Zecevic et al. 2005, 2011; Hansen et al. 2010; Al-Jaberi et al. 2015; Betizeau et al. 2013; Geschwind and Rakic 2013). Direct functional studies of the human brain are limited, hence modeling the development of human cortical interneurons is of great interest, and was successfully done using human stem cells (Mariani et al. 2012; Maroof et al. 2013; Reinchisi et al. 2013). Here, we established human RGC cultures and demonstrated that Shh affects RGCs by promoting proliferation and maintaining the progenitor state of cortical cells while blocking their further differentiation (Fig. 7). We show that Shh can influence the plasticity of human cortical progenitors, inversely affecting CalR+ and Nkx2.1+ cells generated in vitro. The limitation of our study is that it relies mainly on results obtained in vitro, as this is the only way to perform this type of experiments on human fetal brain. Importantly, in contrast to rodents, our in vitro results on cortical progenitors support previous ex vivo findings of dividing Nkx2.1+ and CalR+ cells in the human cortical SVZ (Jakovcevski et al. 2011; Zecevic et al. 2011). The in vitro system established in this study could be a useful model for further exploration of human cortical progenitors and possible better understanding of neuropsychiatric disorders which they underlie.

Funding

This work was supported by the National Institute of Health (2R01NSO41489-10A1 and R21NSO73585-01A1).

Notes

Human fetal tissue has been procured from Advanced Bioscience Resources (ABR, Alameda, CA, USA) and StemEx (Diamond Springs, CA, USA). Pax6 antibody (Developmental Studies Hybridoma Bank) is developed by Atsushi Kawakami under the auspices of the NICHD and maintained by the University of Iowa, Department of Biology, Iowa City, IA, USA. Plasmid 13996 made by Cliff Tabin was used from Addgene (Cambridge, MA, USA). Conflict of Interest: None declared.

References

  1. Al-Jaberi N, Lindsay S, Sarma S, Bayatti N, Clowry GJ. 2015. The early fetal development of human neocortical GABAergic interneurons. Cereb Cortex. 25:631–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anderson SA, Eisenstat DD, Shi L, Rubenstein JLR. 1997. Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes. Science. 278:474–476. [DOI] [PubMed] [Google Scholar]
  3. Barnfield PC, Zhang X, Thanabalasingham V, Yoshida M, Hui C-C. 2005. Negative regulation of Gli1 and Gli2 activator function by suppressor of fused through multiple mechanisms. Differentiation. 73:397–405. [DOI] [PubMed] [Google Scholar]
  4. Barth KA, Wilson SW. 1995. Expression of zebrafish nk2.2 is influenced by sonic hedgehog/vertebrate hedgehog-1 and demarcates a zone of neuronal differentiation in the embryonic forebrain. Development. 121:1755–1768. [DOI] [PubMed] [Google Scholar]
  5. Baudoin J-P, Viou L, Launay P-S, Luccardini C, Espeso Gil S, Kiyasova V, Irinopoulou T, Alvarez C, Rio J-P, Boudier T, et al. 2012. Tangentially migrating neurons assemble a primary cilium that promotes their reorientation to the cortical plate. Neuron. 76:1108–1122. [DOI] [PubMed] [Google Scholar]
  6. Belloni E, Muenke M, Roessler E, Traverso G, Siegel-Bartelt J, Frumkin A, Mitchell H, Donis-Keller H, Helms C, Hing A, et al. 1996. Identification of sonic hedgehog as a candidate gene responsible for holoprosencephaly. Nat Genet. 14:353–356. [DOI] [PubMed] [Google Scholar]
  7. Betizeau M, Cortay V, Patti D, Pfister S, Gautier E, Bellemin-Ménard A, Afanassieff M, Huissoud C, Douglas Rodney J, Kennedy H, et al. 2013. Precursor diversity and complexity of lineage relationships in the outer subventricular zone of the primate. Neuron. 80:442–457. [DOI] [PubMed] [Google Scholar]
  8. Bishop KM, Garel S, Nakagawa Y, Rubenstein JLR, O'Leary DDM. 2003. Emx1 and Emx2 cooperate to regulate cortical size, lamination, neuronal differentiation, development of cortical efferents, and thalamocortical pathfinding. J Comp Neurol. 457:345–360. [DOI] [PubMed] [Google Scholar]
  9. Butt SJB, Fuccillo M, Nery S, Noctor S, Kriegstein A, Corbin JG, Fishell G. 2005. The temporal and spatial origins of cortical interneurons predict their physiological subtype. Neuron. 48:591–604. [DOI] [PubMed] [Google Scholar]
  10. Butt SJB, Sousa VH, Fuccillo MV, Hjerling-Leffler J, Miyoshi G, Kimura S, Fishell G. 2008. The requirement of Nkx2-1 in the temporal specification of cortical interneuron subtypes. Neuron. 59:722–732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Campbell MJ, Morrison JH. 1989. Monoclonal antibody to neurofilament protein (SMI-32) labels a subpopulation of pyramidal neurons in the human and monkey neocortex. J Comp Neurol. 282:191–205. [DOI] [PubMed] [Google Scholar]
  12. Carney RS, Mangin JM, Hayes L, Mansfield K, Sousa VH, Fishell G, Machold RP, Ahn S, Gallo V, Corbin JG. 2010. Sonic hedgehog expressing and responding cells generate neuronal diversity in the medial amygdala. Neural Develop. 5:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Clowry G, Molnár Z, Rakic P. 2010. Renewed focus on the developing human neocortex. J Anat. 217:276–288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dahmane N, Ruiz-i-Altaba A. 1999. Sonic hedgehog regulates the growth and patterning of the cerebellum. Development. 126:3089–3100. [DOI] [PubMed] [Google Scholar]
  15. Dahmane N, Sánchez P, Gitton Y, Palma V, Sun T, Beyna M, Weiner H, Ruiz i Altaba A. 2001. The sonic hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development. 128:5201–5212. [DOI] [PubMed] [Google Scholar]
  16. DeFelipe J, Alonso-Nanclares L, Arellano J. 2002. Microstructure of the neocortex: comparative aspects. J Neurocytol. 31:299–316. [DOI] [PubMed] [Google Scholar]
  17. del Río MR, DeFelipe J. 1994. A study of SMI 32-stained pyramidal cells, parvalbumin-immunoreactive chandelier cells, and presumptive thalamocortical axons in the human temporal neocortex. J Comp Neurol. 342:389–408. [DOI] [PubMed] [Google Scholar]
  18. Dessaud E, McMahon AP, Briscoe J. 2008. Pattern formation in the vertebrate neural tube: a sonic hedgehog morphogen-regulated transcriptional network. Development. 135:2489–2503. [DOI] [PubMed] [Google Scholar]
  19. Ding Q, Fukami Si, Meng X, Nishizaki Y, Zhang X, Sasaki H, Dlugosz A, Nakafuku M, Hui CC. 1999. Mouse suppressor of fused is a negative regulator of sonic hedgehog signaling and alters the subcellular distribution of Gli1. Curr Biol. 9:1119–1122. [DOI] [PubMed] [Google Scholar]
  20. El-Akabawy G, Medina LM, Jeffries A, Price J, Modo M. 2011. Purmorphamine increases DARPP-32 differentiation in human striatal neural stem cells through the hedgehog pathway. Stem Cells Develop. 20:1873–1887. [DOI] [PubMed] [Google Scholar]
  21. Englund C, Fink A, Lau C, Pham D, Daza RAM, Bulfone A, Kowalczyk T, Hevner RF. 2005. Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia, intermediate progenitor cells, and postmitotic neurons in developing neocortex. J Neurosci. 25:247–251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fancy S, Harrington E, Yuen T, Silbereis J, Zhao C, Baranzini S, Bruce C, Otero J, Huang E, Nusse R, et al. 2011. Axin2 as regulatory and therapeutic target in newborn brain injury and remyelination. Nat Neurosci. 14:1009–1016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fertuzinhos S, Krsnik Z, Kawasawa YI, Rasin M-R, Kwan KY, Chen J-G, Judas M, Hayashi M, Sestan N. 2009. Selective depletion of molecularly defined cortical interneurons in human holoprosencephaly with severe striatal hypoplasia. Cereb Cortex. 19:2196–2207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Fietz SA, Huttner WB. 2011. Cortical progenitor expansion, self-renewal and neurogenesis—a polarized perspective. Curr Opin Neurobiol. 21:23–35. [DOI] [PubMed] [Google Scholar]
  25. Fogarty M, Grist M, Gelman D, Marín O, Pachnis V, Kessaris N. 2007. Spatial genetic patterning of the embryonic neuroepithelium generates GABAergic interneuron diversity in the adult cortex. J Neurosci. 27:10935–10946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Fuccillo M, Joyner AL, Fishell G. 2006. Morphogen to mitogen: the multiple roles of hedgehog signalling in vertebrate neural development. Nat Rev Neurosci. 7:772–783. [DOI] [PubMed] [Google Scholar]
  27. Garcia ADR, Petrova R, Eng L, Joyner AL. 2010. Sonic hedgehog regulates discrete populations of astrocytes in the adult mouse forebrain. J Neurosci. 30:13597–13608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Geschwind D, Rakic P. 2013. Cortical evolution: judge the brain by its cover. Neuron. 80:633–647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Götz M, Williams B, Bolz J, Price J. 1995. The specification of neuronal fate: a common precursor for neurotransmitter subtypes in the rat cerebral cortex in vitro. Eur J Neurosci. 7:889–898. [DOI] [PubMed] [Google Scholar]
  30. Greenbaum D, Colangelo C, Williams K, Gerstein M. 2003. Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol. 4:117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gulacsi A, Lillien L. 2003. Sonic hedgehog and bone morphogenetic protein regulate interneuron development from dorsal telencephalic progenitors in vitro. J Neurosci. 23:9862–9872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hajihosseini M, Tham TN, Dubois-Dalcq M. 1996. Origin of oligodendrocytes within the human spinal cord. J Neurosci. 16:7981–7994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hansen D, Lui J, Flandin P, Yoshikawa K, Rubenstein J, Alvarez-Buylla A, Kriegstein A. 2013. Non-epithelial stem cells and cortical interneuron production in the human ganglionic eminences. Nat Neurosci. 16:1576–1587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hansen D, Lui J, Parker P, Kriegstein AR. 2010. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature. 464:554–561. [DOI] [PubMed] [Google Scholar]
  35. Harwell Corey C, Parker Philip RL, Gee Steven M, Okada A, McConnell Susan K, Kreitzer Anatol C, Kriegstein Arnold R. 2012. Sonic hedgehog expression in corticofugal projection neurons directs cortical microcircuit formation. Neuron. 73:1116–1126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Jakovcevski I, Mayer N, Zecevic N. 2011. Multiple origins of human neocortical interneurons are supported by distinct expression of transcription factors. Cereb Cortex. 21:1771–1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kang H, Kawasawa Y, Cheng F, Zhu Y, Xu X, Li M, Sousa A, Pletikos M, Meyer K, Sedmak G, et al. 2011. Spatio-temporal transcriptome of the human brain. Nature. 478:483–489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, Gonzalez FJ. 1996. The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev. 10:60–69. [DOI] [PubMed] [Google Scholar]
  39. Kohtz JD, Baker DP, Corte G, Fishell G. 1998. Regionalization within the mammalian telencephalon is mediated by changes in responsiveness to Sonic Hedgehog. Development. 125:5079–5089. [DOI] [PubMed] [Google Scholar]
  40. Komada M. 2012. Sonic hedgehog signaling coordinates the proliferation and differentiation of neural stem/progenitor cells by regulating cell cycle kinetics during development of the neocortex. Congenit Anom. 52:72–77. [DOI] [PubMed] [Google Scholar]
  41. Komada M, Saitsu H, Kinboshi M, Miura T, Shiota K, Ishibashi M. 2008. Hedgehog signaling is involved in development of the neocortex. Development. 135:2717–2727. [DOI] [PubMed] [Google Scholar]
  42. Le Dréau G, Martí E. 2012. Dorsal–ventral patterning of the neural tube: a tale of three signals. Develop Neurobiol. 72:1471–1481. [DOI] [PubMed] [Google Scholar]
  43. Letinic K, Zoncu R, Rakic P. 2002. Origin of GABAergic neurons in the human neocortex. Nature. 417:645–649. [DOI] [PubMed] [Google Scholar]
  44. Li X-J, Hu B-Y, Jones SA, Zhang Y-S, LaVaute T, Du Z-W, Zhang S-C. 2008. Directed differentiation of ventral spinal progenitors and motor neurons from human embryonic stem cells by small molecules. Stem Cells. 26:886–893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Lui Jan H, Hansen David V, Kriegstein Arnold R. 2011. Development and evolution of the human neocortex. Cell. 146:18–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ma T, Wang C, Wang L, Zhou X, Tian M, Zhang Q, Zhang Y, Li J, Liu Z, Cai Y, et al. 2013. Subcortical origins of human and monkey neocortical interneurons. Nat Neurosci. 16:1588–1597. [DOI] [PubMed] [Google Scholar]
  47. Mariani J, Simonini MV, Palejev D, Tomasini L, Coppola G, Szekely AM, Horvath TL, Vaccarino FM. 2012. Modeling human cortical development in vitro using induced pluripotent stem cells. Proc Natl Acad Sci. 109:12770–12775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Marigo V, Roberts DJ, Lee SM, Tsukurov O, Levi T, Gastier JM, Epstein DJ, Gilbert DJ, Copeland NG, Seidman CE, et al. 1995. Cloning, expression, and chromosomal location of SHH and IHH: two human homologues of the Drosophila segment polarity gene hedgehog. Genomics. 28:44–51. [DOI] [PubMed] [Google Scholar]
  49. Marín O, Anderson SA, Rubenstein JLR. 2000. Origin and molecular specification of striatal interneurons. J Neurosci. 20:6063–6076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Maroof A, Keros S, Tyson J, Ying S, Ganat Y, Merkle F, Liu B, Goulburn A, Stanley E, Elefanty A, et al. 2013. Directed differentiation and functional maturation of cortical interneurons from human embryonic stem cells. Cell Stem Cell. 12:559–572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Miller J, Ding S, Sunkin S, Smith K, Ng L, Szafer A, Ebbert A, Riley Z, Royall J, Aiona K, et al. 2014. Transcriptional landscape of the prenatal human brain. Nature. 508:199–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Mo Z, Moore AR, Filipovic R, Ogawa Y, Kazuhiro I, Antic SD, Zecevic N. 2007. Human cortical neurons originate from radial glia and neuron-restricted progenitors. J Neurosci. 27:4132–4145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Mo Z, Zecevic N. 2009. Human fetal radial glia cells generate oligodendrocytes in vitro. Glia. 57:490–498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Mo Z, Zecevic N. 2008. Is Pax6 critical for neurogenesis in the human fetal brain? Cereb Cortex. 18:1455–1465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Nery S, Wichterle H, Fishell G. 2001. Sonic hedgehog contributes to oligodendrocyte specification in the mammalian forebrain. Development. 128:527–540. [DOI] [PubMed] [Google Scholar]
  56. Nobrega-Pereira S, Kessaris N, Du T, Kimura S, Anderson SA, Marin O. 2008. Postmitotic Nkx2-1 controls the migration of telencephalic interneurons by direct repression of guidance receptors. Neuron. 59:733–745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Odent S, Attié-Bitach T, Blayau M, Mathieu M, Augé J, Delezoïde AL, Le Gall JY, Le Marec B, Munnich A, David V, et al. 1999. Expression of the sonic hedgehog (SHH) gene during early human development and phenotypic expression of new mutations causing holoprosencephaly. Hum Mol Genet. 8:1683–1689. [DOI] [PubMed] [Google Scholar]
  58. Ohira K, Furuta T, Hioki H, Nakamura KC, Kuramoto E, Tanaka Y, Funatsu N, Shimizu K, Oishi T, Hayashi M, et al. 2010. Ischemia-induced neurogenesis of neocortical layer 1 progenitor cells. Nat Neurosci. 13:173–179. [DOI] [PubMed] [Google Scholar]
  59. Orentas DM, Hayes JE, Dyer KL, Miller RH. 1999. Sonic hedgehog signaling is required during the appearance of spinal cord oligodendrocyte precursors. Development. 126:2419–2429. [DOI] [PubMed] [Google Scholar]
  60. Ortega J, Radonjic N, Zecevic N. 2013. Sonic hedgehog promotes generation and maintenance of human forebrain Olig2 progenitors. Front Cell Neurosci. 7:254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Petanjek Z, Kostovic I, Esclapez M. 2009. Primate-specific origins and migration of cortical GABAergic neurons. Front Neuroanat. 3:26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Puelles L, Rubenstein JLR. 2003. Forebrain gene expression domains and the evolving prosomeric model. Trends Neurosci. 26:469–476. [DOI] [PubMed] [Google Scholar]
  63. Radonjic N, Ortega Cano J, Memi F, Dionne K, Jakovcevski I, Zecevic N. 2014. The complexity of the calretinin-expressing progenitors in the human cerebral cortex. Front Neuroanat. 8:82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Rakic S, Zecevic N. 2003. Emerging complexity of layer I in human cerebral cortex. Cereb Cortex. 13:1072–1083. [DOI] [PubMed] [Google Scholar]
  65. Raser J, O'shea E. 2005. Noise in gene expression: origins, consequences, and control. Science. 309:2010–2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Reinchisi G, Limaye PV, Singh MB, Antic SD, Zecevic N. 2013. Neurogenic potential of hESC-derived human radial glia is amplified by human fetal cells. Stem Cell Res. 11:587–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Rowitch DH, St.-Jacques B, Lee SMK, Flax JD, Snyder EY, McMahon AP. 1999. Sonic hedgehog regulates proliferation and inhibits differentiation of CNS precursor cells. J Neurosci. 19:8954–8965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Ruiz i Altaba A. 1998. Combinatorial Gli gene function in floor plate and neuronal inductions by sonic hedgehog. Development. 125:2203–2212. [DOI] [PubMed] [Google Scholar]
  69. Sasaki H, Nishizaki Y, Hui C, Nakafuku M, Kondoh H. 1999. Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development. 126:3915–3924. [DOI] [PubMed] [Google Scholar]
  70. Schell-Apacik C, Rivero M, Knepper J, Roessler E, Muenke M, Ming J. 2003. Sonic hedgehog mutations causing human holoprosencephaly impair neural patterning activity. Hum Genet. 113:170–177. [DOI] [PubMed] [Google Scholar]
  71. Shikata Y, Okada T, Hashimoto M, Ellis T, Matsumaru D, Shiroishi T, Ogawa M, Wainwright B, Motoyama J. 2011. Ptch1-mediated dosage-dependent action of Shh signaling regulates neural progenitor development at late gestational stages. Develop Biol. 349:147–159. [DOI] [PubMed] [Google Scholar]
  72. Shimamura K, Rubenstein JL. 1997. Inductive interactions direct early regionalization of the mouse forebrain. Development. 124:2709–2718. [DOI] [PubMed] [Google Scholar]
  73. Smart IHM, Dehay C, Giroud P, Berland M, Kennedy H. 2002. Unique morphological features of the proliferative zones and postmitotic compartments of the neural epithelium giving rise to striate and extrastriate cortex in the monkey. Cereb Cortex. 12:37–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Sussel L, Marin O, Kimura S, Rubenstein JL. 1999. Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum. Development. 126:3359–3370. [DOI] [PubMed] [Google Scholar]
  75. Wang B, Waclow RR, Allen ZJ, 2nd, Guillemot F, Campbell K. 2009. Ascl1 is a required downstream effector of Gsx gene function in the embryonic mouse telencephalon. Neural Develop. 4:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Wichterle H, Turnbull DH, Nery S, Fishell G, Alvarez-Buylla A. 2001. In utero fate mapping reveals distinct migratory pathways and fates of neurons born in the mammalian basal forebrain. Development. 128:3759–3771. [DOI] [PubMed] [Google Scholar]
  77. Wu S, Esumi S, Watanabe K, Chen J, Nakamura KC, Nakamura K, Kometani K, Minato N, Yanagawa Y, Akashi K, et al. 2011. Tangential migration and proliferation of intermediate progenitors of GABAergic neurons in the mouse telencephalon. Development. 138:2499–2509. [DOI] [PubMed] [Google Scholar]
  78. Xu Q, Cobos I, De La Cruz E, Rubenstein JL, Anderson SA. 2004. Origins of cortical interneuron subtypes. J Neurosci. 24:2612–2622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Xu Q, Guo L, Moore H, Waclaw RR, Campbell K, Anderson SA. 2010. Sonic hedgehog signaling confers ventral telencephalic progenitors with distinct cortical interneuron fates. Neuron. 65:328–340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Xu Q, Wonders CP, Anderson SA. 2005. Sonic hedgehog maintains the identity of cortical interneuron progenitors in the ventral telencephalon. Development. 132:4987–4998. [DOI] [PubMed] [Google Scholar]
  81. Yoshida M, Suda Y, Matsuo I, Miyamoto N, Takeda N, Kuratani S, Aizawa S. 1997. Emx1 and Emx2 functions in development of dorsal telencephalon. Development. 124:101–111. [DOI] [PubMed] [Google Scholar]
  82. Yu X, Zecevic N. 2011. Dorsal radial glial cells have the potential to generate cortical interneurons in human but not in mouse brain. J Neurosci. 31:2413–2420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Zecevic N, Chen Y, Filipovic R. 2005. Contributions of cortical subventricular zone to the development of the human cerebral cortex. J Comp Neurol. 491:109–122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Zecevic N, Hu F, Jakovcevski I. 2011. Interneurons in the developing human neocortex. Develop Neurobiol. 71:18–33. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cerebral Cortex (New York, NY) are provided here courtesy of Oxford University Press

RESOURCES