Abstract
PIK3CA has been shown to be involved in many malignant tumors. This study was designed to determine the expression level of PIK3CA in oral squamous cell carcinoma (OSCC) and the association of gene polymorphisms of PIK3CA with OSCC in Chinese population. The expression of PIK3CA was detected by real-time PCR in tumor and pericarcinomatous tissues of 10 OSCC patients. Nine single-nucleotide polymorphisms (SNPs) of PIK3CA (rs1607237, rs17849079, rs2677764, rs2699887, rs4855094, rs4975596, rs6443624, rs7651265 and rs7736074) in blood of 113 OSCC patients and 184 normal controls were genotyped using matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) assay. The gene expression of PIK3CA was significantly higher in tumor tissues of OSCC patients than that in pericarcinomatous tissues (P = 0.012). An increased frequency of the C allele of PIK3CA rs1607237 was observed in OSCC patients as compared with controls; However, the significance was lost after Bonferroni correction (P = 0.048, pc = 0.576). In further stratification analysis, although the frequencies of PIK3CA rs4975596 A allele in male patients and rs1607237 C allele in female patients were increased (P = 0.032, P = 0.020, respectively), the significance was also missing when Bonferroni correction was performed (P c = 0.384, (P c = 0.24, respectively). The prevalence of other SNPs of PIK3CA did not differ between OSCC patients and controls. The expression of PIK3CA was increased in OSCC tumors; however, none of the nine tested SNPs of PIK3CA was associated with susceptibility to OSCC in the studied population.
Keywords: Oral squamous cell carcinoma, PIK3CA, single nucleotide polymorphisms, gene expression, MALDI-TOF MS, RT-PCR
Introduction
Oral cancer is a prevalent worldwide malignant tumor, the epidemiological statistics displayed that annual incidence is around 263,000 and the death number is about 128,000 in the world [1-3]. Squamous cell carcinoma is one of the most common pathological types of oral cancer, and it is especially common in China [2,4]. In recent years, studies of tumor mechanism are gradually deepened, but according to existing results, effective measures for accurate prevention and early diagnosis of OSCC are rare. Due to high recurrence rate and propensity of lymph node metastasis in OSCC, the 5-year survival rate is less than 50%, and the poor prognosis is also hard to accept for patients and their families [5].
Smoking, alcohol drinking and chewing betel nuts are high risk factors to oral squamous cell carcinoma, and they could play a synergistic role in tumor genesis and tumor progression. Every year, the OSCC deaths with former smoking accounted for 42% of worldwide OSCC death tolls, and with former drinking accounted for 16% [6]. Malignant tumor is the result of combined action of many factors. In addition to the above mentioned risk factors, gene factors are also proven to be involved in the pathogenesis of cancers [7].
PIK3CA is located in 3q26.3, encodes 1068 amino acids and produces a 124 kD protein namely PI3K p110 catalytic subunit alpha (PI3K p110α) [8]. PIK3CA was reported to participate in tumorigenesis and development process of cancers as an oncogene [8,9]. Mutations make gene duplication overactive, result in PIK3CA appearing amplification and the enhancive function of PI3K p110α. Through catalytic function of PI3K p110α, PIP3 increase, which is an important medium of activating PI3K/AKT signaling pathway. PIP3 is combined with the C-terminal pleckstrin homology (PH) domain of phosphoinositide dependence protein kinase 1 (PDK1), activate PDK1. Activated PDK1 phosphorylates the 308th threonine of AKT. On this basis, phosphoinositide dependent protein kinase 2 (PDK2) phosphorylate the 473th serine of AKT. Thus, PI3K/AKT signaling pathway is activated [10].
Previous studies have shown PI3K/AKT signaling pathway was frequently activated by gene mutations to promote tumor growth [11]. Furthermore, genetic polymorphisms of PIK3CA were also reported to be associated with head neck squamous cell carcinoma [9], esophageal squamous cell carcinoma [12], non-small cell lung cancer [13], breast cancer [8], endometrial cancer [14], gastric cancer [15] and rectal cancer [16]. Elevated PIK3CA levels have been reported in tumor tissues and exacerbated the clinical symptoms of patients with colorectal cancer, esophageal squamous cell carcinoma [17,18]. Whether PIK3CA is involved in the development of OSCC patients in Chinese Han population is not yet known and was therefore the subject of the current study.
Materials and methods
Study population
113 OSCC patients and 184 geographically and ethnically matched normal controls were included in this study for SNP analysis of PIK3CA. Ten pairs of tumor and pericarcinomatous tissues of OSCC patients (6 man and 4 women, with an average age of 53.6 years) were randomly selected for measurement of PIK3CA mRNA expression. Pericarcinomatous tissues were adjacent to carcinoma tissue at least 2 mm. All samples were obtained from the Stomatological Hospital of Chongqing Medical University between August 2013 and November 2014. The diagnosis of OSCC cases were strictly based on the histopathological confirmation. Allele and genotype frequencies of patients and controls were in accord with the Hardy-Weinberg equilibrium. The study was approved by the Local Ethics Research Committee and all the investigated subjects provided informed consent before collection of blood and tissues. All procedures were in compliance with the principles of Declaration of Helsinki.
Genotyping
Genomic DNA was extracted by Tiangen DNA blood genome extraction kit (Tiangen, Beijing, China). The gene polymorphisms were genotyped by the Sangon Biotechnology Company (Shanghai, China) using matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) assay.
Real-time PCR
All total RNA were extracted from soft tissues using Takara RNAios Plus (Takara, Dalian, China), followed by reverse transcription using Takara PrimeScrtipit TM 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) with one micrograms of total RNA. Primers synthesized by Sangon Biotechnology Company (Shanghai, China) were designed for the amplification of a 100 bp fragment of PIK3CA cDNA (Table 1). Real-time PCR assay was performed on the Biorad CFX ConnectTM. Relative expression levels were calculated using the 2-ΔΔCt method.
Table 1.
Primer sequences and experimental conditions for the gene expression of PIK3CA analysis
| Gene | Primer sequence (5’-3’) | Product length (bp) | Tm (°C) |
|---|---|---|---|
| PIK3CA | F: CGTTTCTGCTTTGGGACAAC | 100 | 60.67 |
| R: CCTGATGATGGTCGTGGAG | 100 | 60.05 |
Tm, temperature.
Statistical analysis
Hardy-Weinberg equilibrium was evaluated using Chi-square test. The Chi-square test was also used to compare clinical characteristics, genotype and allele frequencies between groups. For genotype analysis, a single genotype vs. the others was used to compare the genotype distribution in controls and patients. In SNP analysis, the p value was corrected by Bonferroni correction and pc<0.05 was considered statistically significant. Gene expression level was analyzed by paired-samples T test. All data were analyzed by SPSS 17.0 (SPSS, Inc Chicago, IL, U S).
Results
Clinical features between OSCC patients and controls
The clinical characteristics of OSCC patients and controls are presented in Table 2. We found no significant differences in terms of distributions on age and smoking status between OSCC patients and controls. However, in contrast with the controls, the OSCC patients had significantly more drinking (P = 0.009). There was a significant difference of gender between OSCC cases and controls (P = 0.005), cases were more likely to be male.
Table 2.
Clinical features between OSCC patients and controls (n, %)
| Characters | OSCC patients (N = 113) | Controls (N = 184) | P value |
|---|---|---|---|
| Age, years | |||
| <60 | 49 (43.4) | 100 (54.3) | 0.074 |
| ≥60 | 64 (56.6) | 84 (45.7) | |
| Gender | |||
| Male | 78 (69.0) | 96 (53.2) | 0.005 |
| Female | 35 (31.0) | 88 (46.8) | |
| Smoking status | |||
| Never | 52 (46.0) | 98 (53.3) | 0.234 |
| Ever | 61 (54.0) | 86 (46.7) | |
| Drinking status | |||
| Never | 75 (66.4) | 148 (80.4) | 0.009 |
| Ever | 38 (33.6) | 36 (19.6) |
Expression of PIK3CA in the tissues of OSCC patients
Gene expression level of PIK3CA was assayed in 10 paired tumor and pericarcinomatous tissues of OSCC patients using Real-time PCR. The gene expression was significantly higher in tumor tissues (0.87±0.84) compared with pericarcinomatous tissues (0.51±0.598, P = 0.012, Figure 1). The expression levels of PIK3CA in tumor tissues were 1.7-fold higher than that in pericarcinomatous tissues.
Figure 1.
PIK3CA mRNA expression in paired tumor and pericarcinomatous tissues of OSCC patients. Relative gene expression of the PIK3CA in paired tumor and pericarcinomatous tissues of OSCC patients (n = 10) was measured by real time PCR. The results of these experiments are presented as expression relative to β-actin. Paired-samples T test was used for statistical analysis. The data are presented as mean ± standard deviation.
Allele and genotype frequencies of SNPs in patients and controls
A total of 9 SNPs of PIK3CA (rs1607237, rs17849079, rs2677764, rs2699887, rs4855094, rs4975596, rs6443624, rs7651265, rs7736074) were genotyped by assaying blood samples of 113 OSCC patients and 184 controls. Allele and genotype frequencies of PIK3CA did not deviate from Hardy-Weinberg equilibrium. All dates of allele and genotype frequencies were presented in the Table 3. The data indicated the frequency of the C allele of rs1607237 was increased in OSCC patients compared with controls (P = 0.048, OR = 1.465, 95% CI = 1.003 to 2.140). However, there was no significant difference when Bonferroni correction was performed (P c = 0.576, n = 12). Compared with controls, OSCC patients had no statistically significant difference to relate to allele and genotype of the other eight SNPs. In the further stratification analysis, we found that the frequency of the rs4975596 A allele in male patients was significantly increased (P = 0.032, OR = 1.610, 95% CI = 1.041 to 2.491), and a significantly higher frequency of the rs1607237 C allele was observed in female patients (P = 0.020, OR = 2.256, 95% CI = 1.123 to 4.532). But when Bonferroni correction was performed, there were also no significant difference between cases and controls (P c = 0.384, (P c = 0.24, respectively, Tables 4 and 5). No differences were found of the else tested SNPs based on other clinical characteristics of OSCC patients and controls in stratification analysis (results were not shown).
Table 3.
Frequencies of genotypes and alleles of PIK3CA polymorphisms in patients with OSCC and controls
| SNP | Genotype/Allele | OSCC (N = 113) | Controls (N = 184) | χ2 | P | P c | OR (95% CI) |
|---|---|---|---|---|---|---|---|
| rs1607237 | CC | 65 (0.575) | 88 (0.478) | 2.635 | 0.105 | NS | 1.477 (0.921-2.368) |
| CT | 43 (0.381) | 78 (0.424) | 0.546 | 0.460 | NS | 0.835 (0.517-1.348) | |
| TT | 5 (0.044) | 18 (0.098) | 2.813 | 0.094 | NS | 0.427 (0.154-1.184) | |
| C | 173 (0.765) | 254 (0.690) | 3.925 | 0.048 | NS | 1.465 (1.003-2.140) | |
| T | 53 (0.235) | 114 (0.310) | 3.925 | 0.048 | NS | 0.683 (0.467-0.997) | |
| rs17849079 | CC | 112 (0.991) | 183 (0.995) | 0.122 | 0.727 | NS | 0.612 (0.038-9.883) |
| CT | 1 (0.009) | 1 (0.005) | 0.122 | 0.727 | NS | 1.634 (0.101-26.384) | |
| C | 225 (0.996) | 367 (0.997) | 0.122 | 0.727 | NS | 0.613 (0.038-9.850) | |
| T | 1 (0.004) | 1 (0.003) | 0.122 | 0.727 | NS | 1.631 (0.102-26.207) | |
| rs2677764 | AG | 12 (0.106) | 23 (0.125) | 0.238 | 0.626 | NS | 0.832 (0.396-1.745) |
| GG | 101 (0.894) | 161 (0.875) | 0.238 | 0.626 | NS | 1.202 (0.573-2.523) | |
| A | 12 (0.053) | 23 (0.062) | 0.223 | 0.637 | NS | 0.841 (0.410-1.725) | |
| G | 214 (0.947) | 345 (0.938) | 0.223 | 0.637 | NS | 1.189 (0.580-2.439) | |
| rs2699887 | AG | 12 (0.106) | 23 (0.125) | 0.238 | 0.626 | NS | 0.832 (0.396-1.745) |
| GG | 101 (0.894) | 161 (0.875) | 0.238 | 0.626 | NS | 1.202 (0.573-2.523) | |
| A | 12 (0.053) | 23 (0.062) | 0.223 | 0.637 | NS | 0.841 (0.410-1.725) | |
| G | 214 (0.947) | 345 (0.938) | 0.223 | 0.637 | NS | 1.189 (0.580-2.439) | |
| rs4855094 | GG | 113 (1.000) | 184 (1.000) | NS | NS | NS | NS |
| G | 226 (1.000) | 368 (1.000) | NS | NS | NS | NS | |
| rs4975596 | AA | 45 (0.398) | 56 (0.304) | 2.749 | 0.097 | NS | 1.513 (0.926-2.470) |
| AG | 57 (0.504)) | 102 (0.554 | 0.701 | 0.402 | NS | 0.818 (0.512-1.309) | |
| GG | 11 (0.097) | 26 (0.141) | 1.240 | 0.265 | NS | 0.655 (0.310-1.384) | |
| A | 147 (0.650) | 214 (0.582) | 2.790 | 0.095 | NS | 1.339 (0.950-1.887) | |
| G | 79 (0.350) | 154 (0.418) | 2.790 | 0.095 | NS | 0.747 (0.530-1.052) | |
| rs6443624 | AA | 1 (0.009) | 1 (0.005) | 0.122 | 0.727 | NS | 1.634 (0.101-26.384) |
| AC | 16 (0.142) | 29 (0.158) | 0.140 | 0.709 | NS | 0.882 (0.455-1.707) | |
| CC | 96 (0.850) | 154 (0.837) | 0.083 | 0.773 | NS | 1.100 (0.576-2.102) | |
| A | 18 (0.080) | 31 (0.084) | 0.039 | 0.843 | NS | 0.941 (0.513-1.724) | |
| C | 208 (0.920) | 337 (0.916) | 0.039 | 0.843 | NS | 1.063 (0.580-1.948) | |
| rs7651265 | AA | 98 (0.867) | 153 (0.833) | 0.683 | 0.409 | NS | 1.324 (0.680-2.578) |
| AG | 13 (0.115) | 29 (0.158) | 1.045 | 0.307 | NS | 0.695 (0.345-1.400) | |
| GG | 2 (0.018) | 2 (0.011) | 0.246 | 0.629 | NS | 1.640 (0.228-11.806) | |
| A | 209 (0.925) | 335 (0.910) | 0.379 | 0.538 | NS | 1.211 (0.658-2.229) | |
| G | 17 (0.075) | 33 (0.090) | 0.379 | 0.538 | NS | 0.826 (0.449-1.520) | |
| rs7736074 | CC | 43 (0.381) | 56 (0.304) | 1.828 | 0.176 | NS | 1.404 (0.858-2.298) |
| CG | 52 (0.460) | 100 (0.543) | 1.944 | 0.163 | NS | 0.716 (0.447-1.146) | |
| GG | 18 (0.159) | 28 (0.152) | 0.027 | 0.869 | NS | 1.056 (0.554-2.011) | |
| C | 138 (0.611) | 212 (0.576) | 0.690 | 0.406 | NS | 1.154 (0.823-1.618) | |
| G | 88 (0.389) | 156 (0.424) | 0.690 | 0.406 | NS | 0.867 (0.618-1.215) |
CI, confidence intervals; OR, odds ratios; NS, not significant; P c, the Bonferroni correction P values.
Table 4.
Frequencies of genotypes and alleles of rs4975596 in male patients with OSCC and controls
| SNP | Genotype/Allele | OSCC (N = 78) | Controls (N = 96) | χ2 | P | P c | OR (95% CI) |
|---|---|---|---|---|---|---|---|
| rs4975596 | AA | 32 (0.410) | 26 (0.271) | 3.764 | 0.052 | NS | 1.873 (0.990-3.542) |
| AG | 39 (0.500) | 53 (0.552) | 0.469 | 0.494 | NS | 0.811 (0.446-1.477) | |
| GG | 7 (0.090) | 17 (0.177) | 2.761 | 0.097 | NS | 0.458 (0.180-1.169) | |
| A | 103 (0.660) | 105 (0.547) | 4.601 | 0.032 | NS | 1.610 (1.041-2.491) | |
| G | 53 (0.340) | 87 (0.453) | 4.601 | 0.032 | NS | 0.621 (0.401-0.961) |
Table 5.
Frequencies of genotypes and alleles of rs1607237 in female patients with OSCC and controls
| SNP | Genotype/Allele | OSCC (N = 35) | Controls (N = 88) | χ2 | P | P c | OR (95% CI) |
|---|---|---|---|---|---|---|---|
| rs1607237 | AA | 23 (0.657) | 42 (0.477) | 3.251 | 0.071 | NS | 2.099 (0.930-4.736) |
| AG | 12 (0.343) | 36 (0.409) | 0.462 | 0.497 | NS | 0.754 (0.333-1.706) | |
| GG | 0 (0.000) | 10 (0.114) | 4.329 | 0.037 | NS | NS | |
| A | 58 (0.829) | 120 (0.682) | 5.393 | 0.020 | NS | 2.256 (1.123-4.532) | |
| G | 12 (0.171) | 56 (0.318) | 5.393 | 0.020 | NS | 0.443 (0.221-0.891) |
Discussion
In present study, we investigated the expression of PIK3CA in OSCC patients. The result indicated a significantly higher gene expression of PIK3CA in tumor tissues compared with the paired pericacinomatous tissues. Moreover, we respectively examined nine single nucleotide polymorphisms of PIK3CA. Our findings showed that there was no association of these tested SNPs with OSCC.
In our study, we found the gene expression of PIK3CA was increased in OSCC tissues, our results are in accord with previous reports indicating the increased PIK3CA expression levels in tumor tissues of patients with colorectal cancer [17], esophageal squamous cell carcinoma [18], head neck squamous cell carcinoma [19] and non-small cell lung cancer [20]. Recent studies have shown that PIK3CA could regulate PIP3 content and promote PIP3 to activate PDK1. AKT activity is regulated by regulating the content of PIP3, which binds AKT to the cell membrane, permitting its activation by activated PDK1. Activated AKT contributes to tumor cells proliferation, survival, metastasis, inhibiting cell apoptosis, even oncogenic transformation [9,12,15,18,21]. These data collectively indicates that increased PIK3CA expression may result in more activation of AKT, then to promote the development of OSCC.
Although OSCC is thought to be caused by gene aberrant expression, genetic polymorphisms are also considered to play a role in this disease. PIK3CA is emerging as a key factor in tumor cell survival. A study has reported that PIK3CA mutations generally appear late in tumorigenesis, just before or coincident with invasion [15], illustrating that PIK3CA may be closely related with the invasiveness of cancer cells. Moreover, PIK3CA polymorphisms caused enhancement of PI3K signaling pathway in tumor tissues, that also suggested PIK3CA may be involved in tumor formation [12]. In this study, we studied whether polymorphisms of PIK3CA were associated with susceptibility to OSCC. The choice of the SNPs of PIK3CA was based on earlier studies. A total of nine SNPs polymorphisms were reported to be associated with some malignant cancers [14,16,22-27] and were selected as candidates in our study. Eight SNPs (rs1607237, rs17849079, rs2677764, rs2699887, rs4975596, rs6443624, rs7651265, rs7736074) have a minor allele frequency of > 1% and another variant (rs4855094) were monozygous. Our results revealed that all selected SNPs were not associated with OSCC. These SNPs based on gender, age, ever smoking or drinking and clinical stage were further analyzed, but did not indicate a detectable association.
In our study, clinical features showed that alcoholic drinking was a high risk factor to OSCC. It suggests that alcoholic drinking may be involved in the pathogenesis of cancers. Moreover, compared with women, men are more likely to drink wine. Which may be the reason that more cases were likely to be male. There were no significant differences in distributions analysis on age and smoking status between OSCC patients and controls.
In conclusion, this study found that the expression of PIK3CA was increased in OSCC tumors. However, none of the nine tested SNPs of PIK3CA was associated with susceptibility to OSCC in the studied population. Reasons for this matter may include 1) the subjects in this study were limited; 2) the chosen SNPs weren’t appropriate for this association study. Therefore, more studies are needed to clarify this issue.
Acknowledgements
This study was supported by the Program for Innovation Team Building at Institutions of Higher Education in Chongqing in 2013, the Program for Chongqing Municipal Key Laboratory of Oral Biomedical Engineering of Higher Education, the Project of the Natural Science Foundation of Chongqing (CSTC2011JJA10014), and the Project of Health and Family Planning Commission of Chongqing (2012-2-125). We are grateful for the contribution of all donors enrolled in this study and the department of clinical laboratory of the stomatological hospital of Chongqing medical university.
Disclosure of conflict of interest
None.
References
- 1.Mirghani H, Amen F, Moreau F, Lacau ST Guily J. Do high-risk human papillomaviruses cause oral cavity squamous cell carcinoma? Oral Oncol. 2015;51:229–36. doi: 10.1016/j.oraloncology.2014.11.011. [DOI] [PubMed] [Google Scholar]
- 2.Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69–90. doi: 10.3322/caac.20107. [DOI] [PubMed] [Google Scholar]
- 3.Li-Ting C, Chung-Ho C, Yi-Hsin Y, Pei-Shan H. The development and validation of oral cancer staging using administrative health data. BMC Cancer. 2014;14:380. doi: 10.1186/1471-2407-14-380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Shieh TM, Lin SC, Liu CJ, Chang SS, Ku TH, Chang KW. Association of expression aberrances and genetic polymorphisms of lysyl oxidase with areca-associated oral tumorigenesis. Clin Cancer Res. 2007;13:4378–4385. doi: 10.1158/1078-0432.CCR-06-2685. [DOI] [PubMed] [Google Scholar]
- 5.Liu CJ, Tsai MM, Tu HF, Lui MT, Cheng HW, Lin SC. miR-196a overexpression and miR-196a2 gene polymorphism are prognostic predictors of oral carcinomas. Ann Surg Oncol. 2013;20(Suppl 3):S406–414. doi: 10.1245/s10434-012-2618-6. [DOI] [PubMed] [Google Scholar]
- 6.Danaei G, Vander Hoorn S, Lopez AD, Murray CJL, Ezzati M. Causes of cancer in the world: comparative risk assessment of nine behavioural and environmental risk factors. Lancet. 2005;366:1784–1793. doi: 10.1016/S0140-6736(05)67725-2. [DOI] [PubMed] [Google Scholar]
- 7.Orsós Z, Szanyi I, Csejtei A, Gerlinger I, Ember I, Kiss I. Association of pre-miR-146a rs2910164 polymorphism with the risk of head and neck cancer. Anticancer Res. 2013;33:341–346. [PubMed] [Google Scholar]
- 8.Pang B, Sun SP, Gao L, Zhu RL, Zhang LX, An C, Liu ZY, Liu GJ. A single nucleotide polymorphism in PIK3CA gene is inversely associated with P53 protein expression in breast cancer. Med Oncol. 2014;31:30. doi: 10.1007/s12032-014-0030-8. [DOI] [PubMed] [Google Scholar]
- 9.Walter V, Yin X, Wilkerson MD, Cabanski CR, Zhao N, Du Y, Ang MK, Hayward MC, Salazar AH, Hoadley KA, Fritchie K, Sailey CJ, Weissler MC, Shockley WW, Zanation AM, Hackman T, Thorne LB, Funkhouser WD, Muldrew KL, Olshan AF, Randell SH, Wright FA, Shores CG, Hayes DN. Molecular subtypes in head and neck cancer exhibit distinct patterns of chromosomal gain and loss of canonical cancer genes. PLoS One. 2013;8:e56823. doi: 10.1371/journal.pone.0056823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Carnero A, Blanco-Aparicio C, Renner O, Link W, Leal JF. The PTEN_PI3K_AKT signalling pathway in cancer, therapeutic implications. Curr Cancer Drug Targets. 2008;8:187–198. doi: 10.2174/156800908784293659. [DOI] [PubMed] [Google Scholar]
- 11.Cohen Y, Goldenberg-Cohen N, Shalmon B, Shani T, Oren S, Amariglio N, Dratviman-Storobinsky O, Shnaiderman-Shapiro A, Yahalom R, Kaplan I, Hirshberg A. Mutational analysis of PTEN/PIK3CA/AKT pathway in oral squamous cell carcinoma. Oral Oncol. 2011;47:946–950. doi: 10.1016/j.oraloncology.2011.07.013. [DOI] [PubMed] [Google Scholar]
- 12.Lin DC, Hao JJ, Nagata Y, Xu L, Shang L, Meng X, Sato Y, Okuno Y, Varela AM, Ding LW, Garg M, Liu LZ, Yang H, Yin D, Shi ZZ, Jiang YY, Gu WY, Gong T, Zhang Y, Xu X, Kalid O, Shacham S, Ogawa S, Wang MR, Koeffler HP. Genomic and molecular characterization of esophageal squamous cell carcinoma. Nat Genet. 2014;46:467–473. doi: 10.1038/ng.2935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pu X, Hildebrandt MA, Lu C, Lin J, Stewart DJ, Ye Y, Gu J, Spitz MR, Wu X. PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung Cancer. 2011;71:82–88. doi: 10.1016/j.lungcan.2010.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wang LE, Ma H, Hale KS, Yin M, Meyer LA, Liu H, Li J, Lu KH, Hennessy BT, Li X, Spitz MR, Wei Q, Mills GB. Roles of genetic variants in the PI3K and RAS/RAF pathways in susceptibility to endometrial cancer and clinical outcomes. J Cancer Res Clin Oncol. 2012;138:377–385. doi: 10.1007/s00432-011-1103-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Rivera M, Ricarte-Filho J, Patel S, Tuttle M, Shaha A, Shah JP, Fagin JA, Ghossein RA. High frequency of mutations of the PIK3CA gene in human cancers. Hum Pathol. 2010;41:172–180. doi: 10.1016/j.humpath.2009.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Slattery ML, Herrick JS, Lundgreen A, Fitzpatrick FA, Curtin K, Wolff RK. Genetic variation in a metabolic signaling pathway and colon and rectal cancer risk: mTOR, PTEN, STK11, RPKAA1, PRKAG2, TSC1, TSC2, PI3K and Akt1. Carcinogenesis. 2010;31:1604–1611. doi: 10.1093/carcin/bgq142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wen F, He S, Sun C, Li T, Wu S. PIK3CA and PIK3CB expression and relationship with multidrug resistance in colorectal carcinoma. Int J Clin Exp Pathol. 2014;7:8295–8303. [PMC free article] [PubMed] [Google Scholar]
- 18.Akagi I, Miyashita M, Makino H, Nomura T, Hagiwara N, Takahashi K, Cho K, Mishima T, Ishibashi O, Ushijima T, Takizawa T, Tajiri T. Overexpression of PIK3CA is associated with lymph node metastasis in esophageal squamous cell carcinoma. Int J Oncol. 2009;34:767–775. doi: 10.3892/ijo_00000202. [DOI] [PubMed] [Google Scholar]
- 19.Fenic I, Steger K, Gruber C, Arens C, Woenckhaus J. Analysis of PIK3CA and Akt-protein kinase B in head and neck squamous cell carcinoma. Oncol Rep. 2007;18:253–259. [PubMed] [Google Scholar]
- 20.Zhao Q, Zhang B, Shao Y, Chen L, Wang X, Zhang Z, Shu Y, Guo R. Correlation between the expression levels of miR-1 and PIK3CA in non-small-cell lung cancer and their relationship with clinical characteristics and prognosis. Future Oncol. 2014;10:49–57. doi: 10.2217/fon.13.242. [DOI] [PubMed] [Google Scholar]
- 21.Xing JC, Tufano RP, Murugan AK, Liu D, Wand G, Ladenson PW, Xing M, Trink B. Single nucleotide polymorphism rs17849071 G/T in the PIK3CA gene is inversely associated with follicular thyroid cancer and PIK3CA amplification. PLoS One. 2012;7:e49192. doi: 10.1371/journal.pone.0049192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Stevens KN, Garcia-Closas M, Fredericksen Z, Kosel M, Pankratz VS, Hopper JL, Dite GS, Apicella C, Southey MC, Schmidt MK, Broeks A, Van ‘t Veer LJ, Tollenaar RA, Fasching PA, Beckmann MW, Hein A, Ekici AB, Johnson N, Peto J, dos Santos Silva I, Gibson L, Sawyer E, Tomlinson I, Kerin MJ, Chanock S, Lissowska J, Hunter DJ, Hoover RN, Thomas GD, Milne RL, Arias Pérez JI, González-Neira A, Benítez J, Burwinkel B, Meindl A, Schmutzler RK, Bartrar CR, Hamann U, Ko YD, Brüning T, Chang-Claude J, Hein R, Wang-Gohrke S, Dörk T, Schürmann P, Bremer M, Hillemanns P, Bogdanova N, Zalutsky JV, Rogov YI, Antonenkova N, Lindblom A, Margolin S, Mannermaa A, Kataja V, Kosma VM, Hartikainen J, Chenevix-Trench G, Chen X, Peterlongo P, Bonanni B, Bernard L, Manoukian S, Wang X, Cerhan J, Vachon CM, Olson J, Giles GG, Baglietto L, McLean CA, Severi G, John EM, Miron A, Winqvist R, Pylkäs K, Jukkola-Vuorinen A, Grip M, Andrulis I, Knight JA, Glendon G, Mulligan AM, Cox A, Brock IW, Elliott G, Cross SS, Pharoah PP, Dunning AM, Pooley KA, Humphreys MK, Wang J, Kang D, Yoo KY, Noh DY, Sangrajrang S, Gabrieau V, Brennan P, McKay J, Anton-Culver H, Ziogas A, Couch FJ, Easton DF GENICA Network; kConFab Investigators; Australian Ovarian Cancer Study Group. Evaluation of variation in the phosphoinositide-3-kinase catalytic subunit alpha oncogene and breast cancer risk. Br J Cancer. 2011;105:1934–1939. doi: 10.1038/bjc.2011.448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Karakas B, Colak D, Kaya N, Ghebeh H, Al-Qasem A, Hendrayani F, Toulimat M, Al-Tweigeri T, Park Bh, Aboussekhra A. Prevalence of PIK3CA mutations and the SNP rs17849079 in Arab breast cancer patients. Cancer Biol Ther. 2013;14:888–896. doi: 10.4161/cbt.25945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li Q, Yang J, Yu Q, Wu H, Liu B, Xiong H, Hu G, Zhao J, Yuan X, Liao Z. Associations between single-nucleotide polymorphisms in the PI3K-PTEN-AKT-mTOR pathway and increased risk of brain metastasis in patients with non-small cell lung cancer. Clin Cancer Res. 2013;19:6252–6260. doi: 10.1158/1078-0432.CCR-13-1093. [DOI] [PubMed] [Google Scholar]
- 25.Lacey JV Jr, Yang H, Gaudet MM, Dunning A, Lissowska J, Sherman ME, Peplonska B, Brinton LA, Healey CS, Ahmed S, Pharoah P, Easton D, Chanock S, Garcia-Closas M. Endometrial cancer and genetic variation in PTEN, PIK3CA, AKT1, MLH1, and MSH2 within a population-based case-control study. Gynecol Oncol. 2011;120:167–173. doi: 10.1016/j.ygyno.2010.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wormald S, Milla L, O’Connor L. Association of candidate single nucleotide polymorphisms with somatic mutation of the epidermal growth factor receptor pathway. BMC Med Genomics. 2013;6:43. doi: 10.1186/1755-8794-6-43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wu IC, Zhao Y, Zhai R, Liu CY, Chen F, Ter-Minassian M, AsOmaning K, Su L, Heist RS, Kulke MH, Liu G, Christiani DC. Interactions between genetic polymorphisms in the apoptotic pathway and environmental factors on esophageal adenocarcinoma risk. Carcinogenesis. 2011;32:502–506. doi: 10.1093/carcin/bgq287. [DOI] [PMC free article] [PubMed] [Google Scholar]