RNA binding proteins as regulators of immune cell biology

Summary

Sequence‐specific RNA binding proteins (RBP) are important regulators of the immune response. RBP modulate gene expression by regulating splicing, polyadenylation, localization, translation and decay of target mRNAs. Increasing evidence suggests that RBP play critical roles in the development, activation and function of lymphocyte populations in the immune system. This review will discuss the post‐transcriptional regulation of gene expression by RBP during lymphocyte development, with particular focus on the Tristetraprolin family of RBP.

Other Articles Published in this Review Series Lessons from The ageing human B cell repertoire: a failure of selection? Clinical and Experimental Immunology 2016, 183: 50–56. Eosinophils: important players in humoral immunity. Clinical and Experimental Immunology 2016, 183: 57–64. Transcription factors regulating B cell fate in the germinal centre. Clinical and Experimental Immunology 2016, 183: 65–75.

Introduction

Regulation of gene expression can occur at every step during the transfer of genetic information from DNA to protein. Transcript abundance is regulated by transcription factors, epigenetic marks such as DNA methylation and by RNA decay, which is an important mechanism for the dynamic control of gene expression. In order to translate mRNA efficiently into protein, localization and availability are as important as transcript abundance. Moreover, qualitative changes in the RNA complement of the cell, which can include alternative splicing, polyadenylation, RNA methylation and RNA editing, have important consequences for the fate of RNA and for the makeup of the proteome. These processes are regulated dynamically by RNA binding proteins (RBP), which have gained increasing prominence as important post‐transcriptional regulators of gene expression. Remarkably, it has been estimated that more than 1500 RBP are encoded by the mammalian genome 1, 2, 3, 4.

RBP carry out their functions by binding to RNA sequences or secondary structures via diverse RNA binding motifs. Some RBP bind short, single‐stranded sequences within mRNA, including AU‐rich elements (AREs), GU‐rich elements or polypyrimidine tracts 5. Specific RNA sequences may interact with a variety of RBP, sometimes with opposing functions, and therefore can result in alternative RNA fates such as stabilization or destabilization of target transcripts (Fig. 1) 6. The ARE is a sequence motif often found in 3′ untranslated regions (3′UTR) of mRNA. It is associated primarily with RNA decay and can interact with multiple proteins with different affinities in the nanoMolar range (Table 1). While the Tristetraprolin (ZFP36) family of RBP bind AREs via tandem CCCH zinc finger domains, HuR (human antigen R) encoded by ELAV1 (embryonic lethal abnormal vision like 1), CUGBP1 (CUG triplet repeat RNA binding protein 1), AUF1 (AU‐rich element binding factor 1, also known as hnRNP D; heterogeneous nuclear ribonucleoprotein D), nucleolin and TIA1 (T cell intracellular antigen 1) and their paralogues bind through RNA recognition motifs (RRM). By contrast, KSRP (KH type splicing regulatory protein), Mex3D (Tino) and Fragile X mental retardation‐related protein 1 (FXR1), bind AREs via K‐homology (KH) domains, a protein domain that was first recognized in in the human hnRNP‐K protein 14, 15.

Figure 1.

Competitive binding by human antigen R (HuR) and Tis11 can direct alternative target mRNA fates. HuR and Tis11 can compete for the same binding sequences, resulting in opposing mRNA fates. (a) Competition for binding to target mRNA is determined by the affinity each RNA binding proteins (RBP) has to shared binding sequences. (b) The relative expression of these RBP will affect competitive binding. (c) Post‐translational regulation of RBP, for example via phosphorylation, affects their ability to bind to target mRNAs.

Table 1.

Binding affinity of tristetraprolin (TTP) and human antigen R (HuR) to synthetic RNA fragments

RNA	ARE sequence	nM binding affinity to TTP	nM binding affinity to HuR	Reference
	AUUUAUUUAUUUA	3·6		7, 8
	AUUUAUUUAUUUAUUUAUUUAUUUA	0·5	0·50	9
	UUAUUUAUU	3·0		7, 8
	UAUUUAU	19·0		7, 8
	UUUUUUUU		Not bound	10
	UUUUUUUUU		0·97	10
	UUUUUUUUUUUUU	280·0		7, 8
	UUUUAUUUAUUUU	3·2		7, 8
	UUUUAUUUUUUUU	56·0		7, 8
	UUUUAUUUCUUUU	83·0		7, 8
	UUUUAUUUGUUUU	28·0		7, 8
	UUUUUUUUAUUUU	54·0		7, 8
	UUUUCUUUAUUUU	93·0		7, 8
	UUUUGUUUAUUUU	28·0		7, 8
	UUAUUUUUU	130·0		7, 8
	UUUUUUAUU	120·0		7, 8
	UUUUAUAUUUU	160·0		7, 8
	UUUUAUUAUUUU	18·0		7, 8
	UUUUAUUUAUUUU	3·2		7, 8
	UUUUAUUUUAUUUU	6·4		7, 8
	UUUUAUUUUUAUUUU	17·0		7, 8
	NNUUNNUUU		0·96	10
	UAUUAUUUU		1·14	10
	A AUUUAUUU		1·01	10
	CUUUCUUUCUUUCUUUC		0·96	10
cFos	UAUUUAUAUUUUUAUUUUAUUU	34		11
c‐Myc	UUA C C AUCUUUUUUUUUCUUUA	>1000		11
Cox‐2	UAUUA AUUUA AUUAUUUA AUA AUAUUUAUAUUA A A		13·6	10
GM‐CSF	AUUUAUUUAUUUAUUUAUUUA	21		11
IL‐1β	UAUUUAUUUAUUUAUUUGUUUGUUUGUUUUAUU		0·12	10, 12
IL‐2	UAUUUAUUUA A AUAUUUA A AUUUUAUAUUUAUU	44	9·5	10, 11, 12
IL‐3	UAUUUAUUUAUGUAUUUAUGUAUUUAUUUAUUUAU	4		11
IL‐8	UAUUUAUUAUUUAUGUAUUUAUUUA A		1·09	10, 12
TNF‐α	AUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUA	2	0·35	10, 11, 12
cFos	3′UTR		10	13
IL‐2	3′UTR		32·77	10
TNF‐α	3′UTR		3·87	10

Dissociation constants (K_d) for TTP and HuR ARE interactions at 25°C. Data taken from published fluorescence anisotropy data. Adenosine residues are shown in red, cytosine and guanine residues are shown in blue and N (any) residues are shown in purple. ARE = adenosine–uridine‐rich element; GM‐CSF = granulocyte–macrophage colony‐stimulating factor; TNF‐α = tumour necrosis factor‐alpha; IL = interleukin.

Regulation of RNA stability provides an important mechanism by which the abundance of different classes of RNA, including mRNA, can be controlled. The first evidence for a role of AREs in mRNA stability came in 1986, when they were identified as conserved sequences in the 3′UTR of transcripts encoding cytokines and some proto‐oncogenes. These proteins were known to be encoded by mRNAs with short half‐lives, and it was demonstrated that the ARE from the 3′UTR of granulocyte–macrophage colony‐stimulating (GM‐CSF) mRNA, when incorporated into a reporter construct, was a destabilizing element 16. At around the same time, it was recognized that a consensus sequence (TTATTTAT) was present in the 3′UTRs of human and mouse tumour necrosis factor (TNF) and interleukin (IL)‐1 mRNAs as well as the human lymphotoxin, colony‐stimulating factor, human and rat fibronectin, and almost all of the then sequenced human and mouse interferons 17. As this consensus sequence appeared at a higher rate than would be dictated by chance alone, it was suggested that it may have some regulatory capacity in controlling the magnitude of the inflammatory response 17. Two years later, this hypothesis was confirmed when it was shown that these identified AREs confer instability to a number of cytokine mRNAs 18. In the same year, AREs contained within the c‐Fos 3′UTR were shown to destabilize the transcript, and play a pivotal role in the process of deadenylation 19. It has been shown since that ARE‐containing mRNAs are recruited selectively to the deadenylase machinery 20, 21. Furthermore, exosome mediated 3′‐5′ mRNA decay has been shown to be an important mechanism of ARE‐containing mRNA decay 22, 23. AU‐rich elements are found in mRNAs from a diverse range of species, including yeast 24, drosophila 25, sea urchin 26 and mouse, indicating that the control of mRNA stability via AREs is a conserved regulatory process that has been selected for during evolution 6.

Some RBP recognize secondary RNA structures, such as the constitutive decay element (CDE); a stem‐loop sequence found in more than 100 transcripts 5. The functional relationship between CDEs and AREs in controlling RNA stability remains to be elucidated fully; however, it is likely that each motif promotes RNA decay via independent mechanisms. A β‐globin reporter transcript, carrying the 3′UTR of TNF, remained labile in mutant cell lines defective for ARE‐mediated mRNA decay, indicating that the TNF 3′UTR contains a further destabilizing element 27. To analyse this further, RAW 264·7 macrophages were transfected stably with a GFP reporter comprising the β‐globin 3′UTR, into which TNF AREs or a section of the TNF 3′UTR thought to contain a CDE were inserted 27. Treatment of these stably transfected cell lines with lipopolysaccharide (LPS), or activation of p38 or PI3K signalling in NIH 3T3 cells, inhibited ARE‐mediated but not CDE‐mediated TNF‐α mRNA destabilization 27. The CDE is bound by the RBP Roquin‐1 and Roquin‐2, which have overlapping functions in the regulation of T cell activation 28, 29, 30, 31.

Post‐translational regulation of RBP

The activity of RBP is governed by the same signalling pathways that control lymphocyte development and activation in response to antigen and cytokine receptor signalling 32. Phosphorylation of RBP controls their function and localization, and it is likely that RBP may act as a point of convergence for the activity of numerous kinases 32. This includes the PI3K pathway, protein kinase B (PKB), mTOR (mammalian target of rapamycin) and p38 mitogen‐activated protein kinase (MAPK). Phosphoproteomic analysis of exogenous Tis11, transfected stably into RAW264·7 macrophages, identified 14 sites of phosphorylation which include 11 serine residues, two threonine residues and one tyrosine reside 33. Phosphorylation of Tis11 and Tis11b at specific serine residues, by p38 MAPK/MK2 and MK2 and PKB, respectively, results in their sequestration by 14–3–3 proteins, and diminished mRNA decay activity due in part to decreased affinity for AREs 9, 34, 35, 36, 37, 38. Additionally, phosphorylated Tis11 is impaired in its ability to recruit mRNA decay enzymes, resulting in decreased deadenylation of target transcripts 20, 21. While association with 14–3–3 proteins is sufficient to prevent effective deadenylase recruitment, this impairment is worsened when Tis11 is phosphorylated 20. This suggests that phosphorylation of Tis11 inhibits its ability to promote mRNA decay in both a 14–3–3‐dependent and ‐independent manner. Furthermore, phosphorylation induced assembly of Tis11/14–3–3 protein complexes result in the exclusion of Tis11 from stress granules, a further mechanism by which phosphorylation impairs Tis11‐mediated mRNA decay (Fig. 2) 36. Recent evidence suggests that MK2‐mediated phosphorylation of serine 52 and serine 178 of Tis11 protect the protein from proteasomal degradation, and may inhibit Tis11 from autoregulating its expression by destabilization of its own mRNA 33. Despite this, replacing serine 52 and 178 codons with non‐phosphorylatable alanine codons in the endogenous murine Tis11 locus, resulted in the production of a mutant form of Tis11, which is highly active and promotes destabilization of target mRNAs 33. Indeed, this mutated Tis11 can compete effectively with an excess of wild‐type Tis11 to promote more rapid mRNA degradation, further suggesting that phosphorylation of Tis11 decreases its affinity for RNA 33. In addition, the dual‐specificity phosphatase 1 (DUSP1), which antagonizes the MAPK signalling pathway, has been shown to regulate Tis11 phosphorylation status 39. Targeted deletion of Dusp1 gives rise to prolonged activation of p38 MAPK signalling, which promotes phosphorylation of serine 52 and serine 178 of Tis11, resulting in the accumulation of inactive Tis11, and subsequent stabilization of its target mRNAs following LPS treatment of bone marrow macrophages (BMMs) 39. Tis11 can also be ubiquitinated by tumour necrosis factor receptor‐associated factor 2 (TRAF2) in a phosphorylation‐dependent manner 40, resulting in protein stabilization 41. It is likely that Tis11 degradation by the proteasome is ubiquitin‐independent, and instead is dependent upon intrinsically disordered N‐ and C‐terminals of the protein, a mechanism which is conserved in the invertebrate drosophila 42. Phosphorylation of HuR at serine residues 202 and 242, which reside within the hinge region of the protein, and serine 158 and 221 by PKCα, affect the subcellular localization of the protein, due to increased binding of 14–3–3 proteins, resulting in nuclear accumulation of HuR 43, 44, 45. Furthermore, stress‐inducing arsenite treatment of HeLa cells resulted in Janus kinase 3 (JAK3) phosphorylation of HuR at tyrosine 200, preventing its localization to stress granules, resulting in accelerated decay of HuR target mRNAs 46.

Figure 2.

Phosphorylation‐mediated regulation of Tis11 downstream of antigen/cytokine receptor signalling. Tis11 is regulated downstream of antigen/cytokine signalling which culminates in phosphorylation of specific serine residues on the protein. (a) Dephosphorylated Tis11 regulates target mRNA expression negatively through binding specific adenosine–uridine‐rich elements (AREs) in the 3′UTR. (b) Tis11 targets mRNA to sites of degradation such as processing bodies. (c) Tis11 recruits mRNA degradation machinery. (d) Phosphorylation of Tis11 results in 14‐3‐3 binding and regulates its function negatively, allowing Tis11 target mRNAs to be translated and expressed. (e) Phosphorylated Tis11 has reduced binding affinity for target mRNAs. (f) Phosphorylation may result in the exclusion Tis11 from sites of degradation such as procession bodies. (g) Phosphorylated Tis11 is deficient in its ability to recruit mRNA decay machinery. (h) As a result of this there may be increased translation of Tis11b target mRNAs.

RBP have also been reported to regulate kinase expression through conserved AREs in the 3′UTRs of PKBα, β and γ and p38α 47. It is likely that RBP regulate the activity of a number of phosphatases, including members of the DUSP family. Under conditions of oxidative stress, DUSP1 mRNA was stabilized in HeLa cells by the binding of HuR and NF90 48, 49. HuR further promotes DUSP1 expression by facilitating recruitment of the DUSP1 transcript to the translation machinery, and enhancing translation efficiency 50. DUSP1 is also a target of Tis11, which plays a role in the degradation of its mRNA 51, 52. Indeed, DUSP1 transcript levels were shown to be elevated in Tis11^–/– dendritic cells 52. This constitutes a potential feedback loop preventing excessive attenuation of Tis11 signalling, thus limiting inflammatory responses. Therefore, DUSP1 mRNA is a target of numerous RBP, indicating that its expression is regulated tightly both at the transcriptional and post‐transcriptional levels, to prevent aberrant MAPK signalling.

Competitive binding of RBP alters the fate of mRNA targets

Binding sequences within target mRNAs interact frequently with a number of different RBPs, with differing functions (Fig. 1) 6, 53, therefore the same sequences within mRNAs can direct alternative fates including stabilization or destabilization of target RNAs 53. In macrophages and T lymphocytes, translation of TNF mRNA is dependent upon binding of HuR to AU‐rich elements within its 3′UTR in the absence of Tis11 9, 54. In a model of the dynamic regulation of TNF mRNA, the phosphorylation of Tis11 by the p38‐MK2 pathway reduces its affinity for the TNF AREs, allowing HuR to bind and promote stabilization and translation of the transcript (Fig. 1) 9. The phosphorylation‐regulated exchange between Tis11 and HuR may allow for a rapid and reversible switch between unstable, non‐translated mRNA and stable, translatable mRNA; however, the extent to which this competitive mechanism occurs in vivo remains to be elucidated. Indeed, a myeloid‐specific deletion of HuR results in an exacerbated inflammatory profile, including enhanced levels of TNF resulting from decreased transcriptional silencing 55. KSRP has been shown to compete for binding of inducible nitric oxide synthase (iNOS) mRNA with HuR in human epithelial colon carcinoma DLD‐1 cells 56. Like Tis11, KSRP has been shown to destabilize target mRNAs. Upon activation, of DLD‐1 cells with a cytokine mixture containing IL‐1β, interferon (IFN)‐γ and TNF, KSRP RNA binding affinity was decreased while HuR affinity for AREs was increased 56. Although Tis11 has not been shown to bind to human iNOS transcripts, it was shown to interact with KSRP in the exosome, indicating a complex interplay of RBP in the regulation of mRNA stability.

RBP in lymphocyte development

A number of roles for RBP in key immunological processes have already been established; however, their role in lymphocyte development remains less well defined 5, 57. Much of the work characterizing the involvement of RBP in lymphocyte development has made use of conditional gene targeting studies in mice 57.

HuR

As germline deletion of HuR is lethal at the embryonic stage, HuR function has been studied in mice using a variety of conditional gene deletion systems, as well as a transgenic system targeted to macrophages 58, 59, 60, 61. Inducible cre‐mediated deletion of HuR using tamoxifen‐regulatable cre resulted in reduced numbers of common lymphoid‐ and B cell‐progenitors 62. Loss of lymphocyte progenitors was linked to increased apoptosis resulting from excessive p53 activity, an effect that was attributed to a requirement for HuR to stabilize mouse double minute 2 homologue (Mdm2) mRNA, which encodes an important negative regulator of p53 57, 62. Inducible cre systems are, however, challenging to use as the tamoxifen‐induced activation of creER^T2 itself can result in increased apoptosis of haematopoietic cells in vivo 63, 64. Furthermore, the link to DNA damage/p53 response has not been widely reproducible; indeed, HuR has been shown to increase expression of p53 65, 66, 67, 68. It also remains unclear why HuR function was attributed to a single RNA–protein interaction when a prevailing view is that HuR, like many RBP, acts to control multiple targets 1. HuR can control additional post‐transcriptional processes such as polyadenylation 69 and splicing 59, 70, although it remains unknown what influence this might have on early lymphocyte development.

Conditional deletion of HuR at the pro‐B cell stage using mb1‐cre indicated that HuR appears to be dispensable for the majority of B cell development and homeostasis. However, the B1 B cell subset was depleted, suggesting an intrinsic requirement for HuR in the development or maintenance of this population 59. The same study found an important role for HuR in mediating the germinal centre (GC) reaction and for the production of class‐switched antibodies in response to thymus‐independent (TI) antigens 59. In addition, it highlights a role for HuR in the quality control of the transcriptome and in regulating mitochondrial metabolism. In the absence of HuR, excessive production of reactive oxygen species led to B cell death 59. Additionally, there was alternative splicing of DLST, a subunit of the α‐KDGH complex which is essential for the maintenance of tricarboxylic acid (TCA)‐cycle flux and cell energy supply, resulting in reduced transcription of enzymatically active protein 59. Conditional deletion of HuR in early thymocyte development, using lck‐cre, results in defective cell cycle progression of DN thymocytes, T cell receptor (TCR) signalling and T cell egress from the thymus 60. These mice had enlarged thymi, but suffer substantial losses of peripheral T cell subsets due to decreased positive selection of HuR‐deficient thymocytes, and an inability of single‐positive T cells to respond to chemotactic signals 60. HuR has been shown to regulate the stability of a number of proinflammatory cytokine mRNAs, including IL‐4, IL‐13, TNF‐α and IL‐17 71, 72, 73. Conditional deletion of HuR in activated T cells under the control of OX40‐cre indicated a gene dosage effect of HuR in the control of cytokine production 74. While GATA binding protein 3 (GATA3), IL‐4 and IL‐13 mRNA was reduced in heterozygous conditional knock‐outs, IL‐2, IL‐4 and IL‐13 mRNA and protein expression was increased in homozygous conditional knock‐outs 74. These apparently discordant results reflect potentially disparate roles for HuR in mRNA metabolism and translation.

AUF1

Recent PAR‐CLIP (photoactivatable‐ribonucleoside‐enhanced cross‐linking and immunoprecipitation) analysis to identify RBP binding sites indicated that AU‐binding factor 1 (AUF1) acts globally to destabilize RNA targets; however, it may also stabilize a discrete subset of RNAs 75. Additionally, AUF1 plays an important role in promoting translation through interactions with HuR 75. AUF1^–/– mice have a small (two‐fold) reduction in the number of splenocytes due to reduced numbers of B and T lymphocytes compared to wild‐type control mice 76. Lymphocyte populations are normal in the bone marrow and thymus, suggesting a predominant role for AUF1 in peripheral lymphocyte homeostasis. The deficit in splenocyte numbers was attributed to a slight decrease in follicular B cell numbers, suggesting that AUF1 may play a role in maintaining the splenic follicular B cell compartment; however, the total numbers of splenic B cells remain unchanged, as the reduction in follicular B cell numbers is counterbalanced by the increase in absolute numbers of marginal zone (MZ) and newly formed B cells 76. In the absence of AUF1, splenic follicular B cells undergo increased apoptosis, resulting from reduced expression of the anti‐apoptotic proteins Bcl2, A1 and Bcl‐XL 76. The transcripts encoding these proteins contain potential binding sites for AUF1 57. While thymus‐dependent (TD) immune responses are normal in AUF1^–/– mice, TI humoral responses are attenuated despite no impairment in GC formation or class switch recombination (CSR), suggesting that AUF1 may also be important for the functionality of MZ B cells in the spleen 76. The prosurvival protein Bcl2 is required to maintain mature B cells in healthy mice 77, 78. AUF1 has been shown to bind to the AU‐rich sequence in the 3′UTR of Bcl2 mRNA in mature primary B cells 79. Deletion of these AU‐rich elements reduces Bcl2 protein expression 79. This is due in part to the lack of AUF1 binding to the 3′UTR of Bcl2, which is required for the stabilization and subsequent translation of the Bcl2 transcript, promoting survival of mature B cells 79.

Roquin‐1 and Roquin‐2

Roquin‐1 and Roquin‐2 bind to secondary RNA structures known as CDE. These proteins are functionally redundant in their capacity to maintain T cell homeostasis 29. In the absence of Roquin‐1 and ‐2 in T cells, or in mice expressing a dominant negative Roquin‐1 (sanroque), T cells differentiate spontaneously into T follicular helper cells (Tfh) 28, 29, 30, 31. This is associated with a lupus‐like autoimmune phenotype in the sanroque mice 31. Roquin‐1 and ‐2 redundantly control the expression of ICOS (inducible co‐stimulator) and OX40 (tumour necrosis factor superfamily member 4) mRNAs, both of which are important in the regulation of effector T cell differentiation and function 29. In addition, the Roquin proteins act in concert with the endoribonuclease Regnase‐1 to inhibit T helper type 17 (Th17) differentiation by co‐operatively binding and promoting degradation of the RNA of Th17‐promoting factors, which include IL‐6, ICOS, c‐Rel and IFN regulatory factor 4 (IRF‐4) 80. Indeed, in the absence of Roquin‐1 and ‐2, Th17 cells were seen to accumulate in the lungs of mice 80. Both Roquin and Regnase‐1 are cleaved downstream of TCR signalling by the paracaspase mucosa‐associated lymphoid tissue lymphoma translocation protein 1 (MALT‐1), resulting in their inactivation, releasing Roquin and Regnase‐1 mRNA targets from repression, providing a mechanism by which TCR signal strength is translated into T cell differentiation 80, 81.

Tis11 family

Tristetraprolin (TTP, Tis11, ZFP36) is the founding member of a small family of RNA binding proteins. The Tis11 family consists of four members in mammals: Tis11, Tis11b (BRF1, ZFP36l1, BERG36, ERF‐1), Tis11d (BRF2, ZFP36l2, ERF‐2), and a fourth protein, ZFP36l3, expressed only in mouse placenta and yolk sac 82, 83. Tis11 orthologues have been found in most vertebrates studied, including lizards and alligators; however, no sequences corresponding to Tis11 have been found in any bird species 84. Despite this, orthologous protein sequences for Tis11b and Tis11d were discovered in chickens, with high sequence conservation to alligator and lizard 84. In addition to vertebrate orthologues, MEX‐5 and MEX‐6 proteins, which have important roles in determining embryonic asymmetry in Caenorhabditis elegans, share the conserved CCCH zinc finger domains with Tis11, but with slightly different spacing of the zinc fingers 85. Tis11 was described originally in 1991 as an immediate early gene induced by the phorbol ester tetradecanoyl phorbol acetate (TPA) and by growth factors 86; however, it is now known that Tis11 family members are up‐regulated downstream of antigen receptor signalling and in response to LPS, insulin and serum stimulation 87, 88, 89, 90, 91, 92, 93, 94. The Tis11 knock‐out mouse exhibited a severe syndrome characterized by growth retardation, cachexia, arthritis, chronic inflammation and autoimmunity that was caused by excess TNF 95. Tis11 was shown subsequently to bind the ARE of TNF mRNA directly, resulting in the destabilization and degradation of the mRNA 91. Moreover, deletion of the TNF ARE in mice showed that it was a dominant inhibitory sequence that limited TNF production and its associated pathology 96. As macrophages were shown to be an important cellular source of TNF in Tis11^–/– mice 97, a myeloid‐specific deletion of Tis11 was generated to confirm whether the excess of TNF in Tis11 germline knock‐outs was produced by myeloid cells 98. However, mice with a LysMcre‐mediated myeloid‐specific knock‐out of Tis11 did not recapitulate the phenotype of the germline knock‐outs, providing evidence that Tis11 has important functional roles outside the myeloid lineage to inhibit inflammation and autoimmunity 97, 99. Tis11 family members share two highly conserved CCCH tandem zinc fingers preceded by a YKTEL motif 100. Mutation of any of the eight amino acids responsible for co‐ordinating the zinc ions within the zinc finger domains completely disrupts RNA binding 101. Tis11 family proteins interact with AREs in the 3′UTR of target mRNAs, where each zinc finger domain binds a separate 5′‐UAUU‐3′ subsite, thus the Tis11 family members bind preferentially a nonameric consensus sequence: UUAUUUAUU with 3·6 nM binding affinity (Table 1) 7, 100. This nonameric sequence is found several times in the 3′UTR of TNF‐α, a well‐characterized target of Tis11 102. Investigations using RNA SELEX selected the same consensus binding site for the Tis11 protein 103. Optimal Tis11 binding requires an RNA substrate greater than 7 nt in length, which must contain two adenylate residues within a U‐rich sequence, the spacing of which contribute to binding affinity of Tis11 7. Thus, Tis11 still has strong (6·4 nM) binding affinity for substrates containing AUUUUA motifs, but only intermediate affinity for AUUA and AUUUUUA binding sequences (18 and 17 nM, respectively) (Table 1) 7.The RNA binds to the zinc fingers in a linear fashion, free from secondary structure, indicating that RNA folding may actually inhibit RNA binding 100. As the presence of AU‐rich sequences alone does not define an RNA as a Tis11 family target, secondary structure may constitute a key factor which distinguishes a functional from a non‐functional ARE. This presents an intriguing possibility whereby binding affinity of Tis11 family proteins may be regulated dynamically by changes in RNA structure.

Once bound to the RNA, the Tis11 family proteins can interact with a number of different effector molecules to bring about degradation or translational arrest of the target transcript. Tis11 associates indirectly with poly(A)‐specific ribonuclease (PARN), resulting in de‐adenylation and destabilization of target mRNAs 104. It has also been shown that Tis11 and Tis11b associate with the decapping enzymes Dcp1 and Dcp2, the 5′‐3′ exonuclease Xrn1 via an N‐terminal activation domain, which acts as a binding platform for mRNA decay enzymes 82, 105, 106. Tis11 has also been shown to co‐exist with the CCR4–CAF‐1 deadenylase complex, which may interact with Tis11 via the largest protein in the complex, Not1 21, 107, 108. This suggests either that RNA decay mediated by Tis11 occurs via a number of different mechanisms, or that Tis11 acts to co‐ordinate RNA decay pathways. AREs are found in the 3′UTRs of a range of mRNAs encoding cytokines, transcription factors, cell cycle regulators and regulators of apoptosis. However, as not all predicted targets have been shown to be physiologically relevant, data from conditional knock‐out models should be considered.

Tis11b‐deficient mice die from a failure of chorioallantoic fusion during embryogenesis, and manifest vascularization defects in the embryo 109, 110. This phenotype is associated with elevated levels of vascular endothelial growth factor‐A (VEGF‐A) in the embryo and in cultured embryonic fibroblasts. In transformed Tis11b‐deficient fibroblasts, increases in VEGF‐A protein are not the result of increased Vegfa mRNA stability, but arise from the increased association of Vegfa mRNA with ribosomes, indicating that Tis11b can regulate translation efficiency independently of mRNA stability 109. This is potentially an important observation because AREs are considered primarily to confer instability on mRNA targets of Tis11 family members. While it has already been recognized that RBP including HuR, T cell intracellular antigen (TIA) and TIA‐1‐related protein (TIAR) are involved in the translational control of RNA targets, it is important to consider the numerous levels of regulation at which RBP can act when defining target transcripts 111. The mechanism of translational repression, mediated by the Tis11 family of RNA binding proteins, remains to be elucidated fully. Like Tis11b, Tis11 has also been shown to shift target transcripts to lighter polysome fractions, resulting in decreased or repressed translation 112. This translational repression of target transcripts is dependent upon the interaction of Tis11 with the DEAD‐box helicase RCK (DDX6), which localizes to processing‐bodies (P‐bodies), sites of cellular mRNA turnover 112. The Tis11 family of proteins promote localization of ARE‐containing transcripts into P‐bodies. This is augmented when the availability of mRNA decay enzymes is limiting, suggesting that Tis11, Tis11b and Tis11d may sequester target mRNAs in P bodies when RNA decay is inefficient 113.

Tis11d knock‐out mice are viable for approximately 2 weeks after birth; however, they have significant defects in haematopoiesis, resulting in anaemia and thrombocytopenia 114. The phenotypical differences observed in the germline ablation of Tis11 family members suggests that although these proteins have highly conserved RNA binding domains, they have some non‐redundant functions during development. This difference could result from tissue specific expression or interactions with different effector proteins, although there is a multitude of overlapping functions between family members and clear evidence for redundancy in T cell development 115.

Young mice which have a double conditional deletion of Tis11b and Tis11d in lymphocytes using CD2cre have reduced thymic cellularity and an increased proportion of double‐negative (DN) and CD8 single‐positive thymocytes. Subsequently, they develop T cell acute lymphoblastic leukaemia (T‐ALL) 115. Tis11b‐ and Tis11d‐deficient DN thymocytes are able to bypass the β‐selection check‐point, which ensures that all T cells express the TCR‐β chain, resulting in the inappropriate proliferative expansion of TCR‐β‐negative T cells 115. The emergence of this aberrant population of TCR‐β‐negative cells requires significantly up‐regulated Notch‐1 protein, which is encoded by an mRNA that is a direct target of Tis11b and Tis11d 115. A role for Tis11 as a negative regulator of B cell development in ageing mice was proposed to occur via negative regulation of E2A mRNA 116. However, it is likely that the Tis11 family proteins play important roles in both early and late B cell development and function (unpublished data from R.N.).

RBP in disease

Disrupted ARE‐mediated processes can arise from a number of different mechanisms, including mutations in AREs, chromosomal deletions of AREs, changes in the abundance of differentially expressing ARE mRNA isoforms and changes in the function, localization or binding affinity of RBP 117. The majority of known RBP defects manifest as neurodegenerative disorders due to the high prevalence of alternative splicing in the brain, a major function of RBP 118, 119. However, RBP dysfunction can also result in a range of human cancers, as cell growth and proliferation is known to be modulated by a variety of RBP. The immune response involves a variety of inflammatory responses, which must be regulated tightly in part by RBP to prevent chronic inflammatory disease and cancer.

RBP in cancer

Genetic translocation of proto‐oncogenes, including Bcl2, Bcl6 and c‐Myc, are found in a variety of B cell tumours, including Burkitt lymphoma, follicular B cell lymphoma and ‘double‐hit’ (DH) mature B cell lymphomas that specifically involve the Myc and Bcl2 loci 120, 121. Enhanced expression of Bcl2 drives B cell survival and has been shown to be important for the survival and progression of B cell leukaemia 78, 122. AREs present within the Bcl2 3′UTR are required to promote Bcl2 mRNA stability and protein expression in mature B cells through binding of HuR 79. In addition to B cell leukaemias, enhanced expression of HuR has been associated with high‐grade malignant brain tumours, including glioblastoma multiforme and medulloblastoma, where it contributes to tumour progression by stabilizing various angiogenic factors such as VEGF 123. HuR is also implicated in colon cancer, where stabilization of the proinflammatory enzyme COX‐2 (cyclooxygenase‐2) results in enhanced growth and tumourogenicity of human colon cancer cells 124. Thus, therapeutically targeting HuR could be considered as a component of new cancer treatments, for example resulting in reduced expression of proto‐oncogenes such as Bcl2 and COX‐2. ARE dysregulation can also result in carcinogenesis. Removing AREs in the 3′UTR of fos mRNA resulted in increased oncogenic potential of this proto‐oncogene 125. Furthermore, genomic rearrangement of the CCND1 (cyclinD1) 3′UTR resulted in over‐expression of CCND1 mRNA in mantle cell lymphoma 126. The resulting perturbation of the G₁/S‐phase transition in the cell cycle contributed to augmented tumour development 126. AUF1 has been shown to decrease carcinogenesis in a number of malignancies by destabilizing the prosurvival factor Bcl2, or cyclinD1 127. However, it has also been shown to be elevated in various cancers, including lymphomas, sarcomas and carcinomas, where it may play a pathological role 127. Alternative splicing and splice factor mutations are found consistently in haematopoietic malignancies, implicating the importance of studying this RBP function in cancer 128. The Tis11 family proteins have been implicated as important tumour suppressors by destabilizing transcripts whose over‐expression is related to malignancy 82. Indeed, tumour formation induced by injection of v‐H‐Ras‐transformed mast cells was delayed when cells additionally over‐expressed Tis11 129. Recent evidence also suggests that Tis11 expression is decreased in human invasive breast cancer cell lines when compared to healthy breast cell lines 130. Tis11 has been shown further to regulate a subset of transcripts which may be involved in the growth, invasion and metastasis of cancer cells 130, 131. Deletion of Tis11b and Tis11d in lymphocytes results in the development of T‐ALL in young mice, in a Notch‐1 dependent manner 115. Despite this, over‐expression of Tis11b has been shown to contribute to leukaemogenesis in primary cells and cell lines, mediated by the fusion transcription factor AML1–MTG8 132. AML1–MTG8 is generated by a genetic translocation, resulting in the dysregulation of genes in haematopoietic progenitors, found in 40% of acute myeloid leukaemia subtype M2 132. Furthermore, increased expression of Tis11b has been found in primary breast cancer 133 and Tis11, Tis11b and Tis11d were found to be elevated in a number of human cancer cell lines when compared to healthy tissues 134. This suggests that the Tis11 family play complex and varied roles in a range of human cancers.

RBP in inflammatory pathology

Post‐transcriptional regulation of mRNA turnover plays an important role in cytokine expression, and many cytokine mRNAs contain AREs in their 3′UTRs. Deleting AREs in the 3′UTR of TNF‐α results in a spontaneous inflammatory syndrome which comprises chronic arthritis and Crohn's like intestinal inflammation 96. A similar autoimmune phenotype is exhibited by Tis11‐deficient mice, demonstrating a key role for Tis11 in restraining chronic TNF signalling 91. HuR has also been shown to stabilize proinflammatory cytokines in activated T cells 74. This results in augmented responses to inflammatory diseases such as experimental autoimmune encephalomyelitis (EAE) 72. These studies indicate that targeted ablation of HuR activity may help to resolve chronic inflammatory conditions by reducing the stabilization of a number of proinflammatory proteins. Despite this, HuR over‐expression in myeloid lineage cells has been shown to dampen inflammatory responses resulting from post‐transcriptional silencing of proinflammatory effectors 55. Indeed, mice lacking HuR in myeloid cells exhibited increased susceptibility to chemical‐induced colitis and colitis‐associated cancer 55. These seemingly contradictory results, between innate and adaptive cells, should be considered prior to investigating the therapeutic targeting of HuR in inflammatory pathologies.

Concluding remarks

The central dogma of molecular biology, a term first coined by Francis Crick, describes the transfer of genetic information from DNA to messenger RNA (mRNA), and from mRNA copies to produce proteins, which constitute the functional machinery of the cell 135. Gene expression, when it refers to the production of proteins, can be regulated at every stage in this process. This review has focused on the post‐transcriptional regulation of gene expression by RNA binding proteins (RBP). While gene expression can be regulated positively and negatively by transcription factor binding, mRNA decay represents an important mechanism by which the abundance of mRNA is controlled in the cytoplasm. The roles of some RBP as limiting factors for immune cell activation and inflammation are becoming clearer, but their role in lymphocyte development is less well characterized 5, 57. The most insightful results have come from the characterization of transgenic mice 57. In order to progress, the field must consider not only the target transcripts of RBP but how RBP are regulated, and their co‐operative interactions with each other and with microRNAs in the regulation of mRNA stability.

The immune response involves a variety of inflammatory responses, which must be regulated tightly to prevent chronic inflammatory disease and cancer. Post‐transcriptional mechanisms that control the stability of mRNA and/or transcription are particularly important in the resolution of inflammation. The half‐life of mRNAs encoding pro‐ or anti‐inflammatory proteins can be highly variable; therefore, blocking transcription may not provide sufficiently rapid changes in transcript abundance to alter the magnitude of inflammation 136. As such, regulation of mRNA stability constitutes an important regulatory mechanism by which inflammatory mediators are controlled. Evidence for the post‐transcriptional regulation of proinflammatory effector proteins by RBP demonstrates their critical involvement in mediating inflammatory homeostasis and cancer. Given the importance of RBP‐mediated regulation of a range of cellular processes, remarkably few RBP have been identified as oncogenes or tumour‐suppressors 118. While HuR has been implicated in a number of human malignancies, caution should be exercised when considering RBP as future therapeutic targets. RBP regulate diverse RNA targets, and few are specific to one tissue. It is therefore imperative to have a greater understanding of basic RBP biology before we can target them for therapeutic benefit.

The roles of RBP in inflammatory disease and cancer are becoming increasingly well characterized; however, little has been done to investigate their roles during ageing. As the process of ageing is associated commonly with an increasing inflammatory phenotype (inflammaging), it would be interesting to see whether some of this is due to a loss of the post‐transcriptional regulation of inflammatory mediators such as cytokines and chemokines.

Disclosure

The authors have no conflicting financial interests.