Synaptic P-Rex1 signaling regulates hippocampal long-term depression and autism-like social behavior

Jun Li; Anping Chai; Lifang Wang; Yuanlin Ma; Zhiliu Wu; Hao Yu; Liwei Mei; Lin Lu; Chen Zhang; Weihua Yue; Lin Xu; Yi Rao; Dai Zhang

doi:10.1073/pnas.1512913112

. 2015 Nov 30;112(50):E6964–E6972. doi: 10.1073/pnas.1512913112

Synaptic P-Rex1 signaling regulates hippocampal long-term depression and autism-like social behavior

Jun Li ^a,^b,^c, Anping Chai ^d,^e,^f, Lifang Wang ^a,^b,^c, Yuanlin Ma ^a,^b,^c, Zhiliu Wu ^a,^b,^c, Hao Yu ^a,^b,^c, Liwei Mei ^a,^b,^c, Lin Lu ^a,^b,^c, Chen Zhang ^g,^h, Weihua Yue ^a,^b,^c, Lin Xu ^d,^e,^f,¹, Yi Rao ^g,^h,ⁱ, Dai Zhang ^a,^b,^c,^h,^i,^j,¹

PMCID: PMC4687539 PMID: 26621702

Significance

Impairments in social behavior and behavioral flexibility have been found in autistic people. However, the genetic mechanism that may contribute to these symptoms is unknown. Here we identified a previously unreported autism-associated gene that regulates synaptic plasticity. The mice lacking this gene exhibit deficits in AMPA receptor endocytosis and synaptic depression because of the blockade of a postsynaptic signaling pathway, leading to autism-like social recognition deficit and behavioral inflexibility. These findings provide new insights into the mechanisms underlying social recognition behavior and suggest that the synaptic depression-related signaling pathway might represent a new therapeutic target for treatment of social recognition deficit disorders such as autism spectrum disorders.

Keywords: autism, social recognition, P-Rex1, long-term depression, AMPA receptor endocytosis

Abstract

Autism spectrum disorders (ASDs) are a group of highly inheritable mental disorders associated with synaptic dysfunction, but the underlying cellular and molecular mechanisms remain to be clarified. Here we report that autism in Chinese Han population is associated with genetic variations and copy number deletion of P-Rex1 (phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1). Genetic deletion or knockdown of P-Rex1 in the CA1 region of the hippocampus in mice resulted in autism-like social behavior that was specifically linked to the defect of long-term depression (LTD) in the CA1 region through alteration of AMPA receptor endocytosis mediated by the postsynaptic PP1α (protein phosphase 1α)–P-Rex1–Rac1 (Ras-related C3 botulinum toxin substrate 1) signaling pathway. Rescue of the LTD in the CA1 region markedly alleviated autism-like social behavior. Together, our findings suggest a vital role of P-Rex1 signaling in CA1 LTD that is critical for social behavior and cognitive function and offer new insight into the etiology of ASDs.

Deficits in social interaction and communication skills and repetitive behavior/restricted interests have been demonstrated in people diagnosed with autism spectrum disorders (ASDs) (1). Several studies have documented impairments of social recognition [e.g., such as deficits in recognizing unfamiliar faces (2)] and in behavioral flexibility [e.g., impaired reversal learning and difficulties in error correction (3, 4)] in autistic people. However, the neurobiological mechanism responsible for the symptoms of ASDs, and especially for the deficit in social recognition, is little known.

Recent genetic studies have identified a large number of candidate genes for ASDs (5, 6), including many that code for synaptic proteins. Synaptic dysfunction may play a critical role in ASDs (7).

Here we have identified a new autism-associated gene, Prex1, that codes for P-Rex1 (phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1), a Rac-specific Rho GTPase guanine nucleotide exchange factor (GEF). This gene is known to be highly expressed in neutrophils and in the mouse brain (8). Mice with the Prex1 gene deleted (Prex1^−/−) exhibited Rac-dependent mild neutrophilia (9) and melanoblast migration defects (10). P-Rex1 influences neuronal cell motility (11) and neurite elongation (12) by regulating actin dynamics specifically at the growth cone. However, the role of P-Rex1 in regulating synaptic function and related behaviors remains unknown.

In addition to identifying an association between PREX1 and autism in humans, we demonstrate that genetic disruption of P-Rex1 in mice leads to autism-like social behavior and to other features known to be associated with ASDs. Electrophysiological studies revealed a specific impairment of NMDA receptor (NMDAR)-dependent long-term depression (LTD) at Schaffer collateral– cornus ammonis region 1 (SC–CA1) synapses. Furthermore, these defects were associated with dysfunction in NMDA-induced AMPA receptor (AMPAR) endocytosis, because of defective PP1α (serine/threonine protein phosphase 1α)–P-Rex1–Rac1 (Ras-related C3 botulinum toxin substrate 1) signaling, and correcting the latter rectified the social recognition deficit of Prex1^−/− mice. Thus, we have elucidated a synaptic mechanism underlying the deficit in social recognition induced by P-Rex1 disruption and the cognitive dysfunction associated with ASDs.

Results

Association of PREX1 with Autism and Its Copy Number Deletion in Autistic People.

We analyzed 17 tag SNPs that could capture 70.5% of the common variations in PREX1. The allele frequencies and results of the family-based association test (FBAT) for single-SNP analysis are shown in Table S1. Six SNPs (rs6066779, rs3934721, rs4076292, rs4810845, rs4455220, and rs6066835) showed a preferential transmission after Bonferroni correction. Pairwise linkage disequilibrium (LD) analysis identified four LD blocks (Fig. 1A). The specific and global haplotype tests of association in the FABT are shown in Table S2. After permutation correction, 18 haplotypes in block 1, 3 haplotypes in block 2, and 1 haplotype in block 3 displayed either significant excess transmission (Z > 0) or under transmission (Z < 0).

Table S1.

FABT results of single marker association analysis for the SNPs in PREX1 in 239 trios

Marker	Allele	Afreq	Families	S	E(s)	Var(s)	Z	P	P^*
rs6066779	T	0.112	83	29	46.5	23.25	−3.629	0.0003	0.0048
	C	0.888	83	137	119.5	23.25	3.629	0.0003	0.0048
rs4810836	C	0.671	162	209	195.0	51.00	1.960	0.0500	0.8492
	T	0.329	162	115	129.0	51.00	−1.960	0.0500	0.8492
rs3934721	C	0.875	91	148	130.5	25.75	3.449	0.0006	0.0096
	T	0.125	91	34	51.5	25.75	−3.449	0.0006	0.0096
rs4076292	A	0.150	104	43	62.5	30.25	−3.545	0.0004	0.0067
	G	0.850	104	165	145.5	30.25	3.545	0.0004	0.0067
rs4810845	G	0.149	105	44	63.0	30.50	−3.440	0.0006	0.0099
	T	0.851	105	166	147.0	30.50	3.440	0.0006	0.0099
rs761270	G	0.906	66	92	95.0	18.00	−0.707	0.4795	8.1515
	C	0.094	66	40	37.0	18.00	0.707	0.4795	8.1515
rs4810860	G	0.714	166	205	213.0	51.00	−1.120	0.2626	4.4645
	A	0.286	166	127	119.0	51.00	1.120	0.2626	4.4645
rs6019374	G	0.426	169	143	150.0	56.50	−0.931	0.3517	5.9792
	A	0.574	169	195	188.0	56.50	0.931	0.3517	5.9792
rs6095248	T	0.601	179	204	201.5	59.25	0.325	0.7453	12.6708
	C	0.399	179	154	156.5	59.25	−0.325	0.7453	12.6708
rs6019384	A	0.152	110	72	65.5	31.25	1.163	0.2449	4.1638
	C	0.848	110	148	154.5	31.25	−1.163	0.2449	4.1638
rs4455220	A	0.866	99	158	141.0	28.50	3.184	0.0015	0.0247
	G	0.134	99	40	57.0	28.50	−3.184	0.0015	0.0247
rs2223684	A	0.826	115	173	156.0	35.00	2.874	0.0041	0.0690
	C	0.174	115	57	74.0	35.00	−2.874	0.0041	0.0690
rs6066835	T	0.885	82	137	118.0	22.50	4.006	0.0001	0.0011
	C	0.115	82	27	46.0	22.50	−4.006	0.0001	0.0011
rs13045364	G	0.759	147	205	196.5	45.25	1.264	0.2064	3.5084
	A	0.241	147	89	97.5	45.25	−1.264	0.2064	3.5084
rs2426101	T	0.299	155	102	113.0	48.50	−1.580	0.1142	1.9417
	C	0.701	155	208	197.0	48.50	1.580	0.1142	1.9417
rs2208589	G	0.785	133	185	181.0	38.50	0.645	0.5191	8.8255
	A	0.215	133	81	85.0	38.50	−0.645	0.5191	8.8255
rs6095314	C	0.131	86	55	52.5	24.25	0.508	0.6117	10.3986
	T	0.869	86	117	119.5	24.25	−0.508	0.6117	10.3986

Open in a new tab

Significant P values (P < 0.05) are in bold. Afreq, allelic frequency; E(S), expected value of S under the null hypothesis (i.e., no linkage or association); Families, number of informative families; S, test statistics for the observed number of transmitted alleles.

P values corrected by Bonferroni test.

Fig. 1. — The genetic association and the association of the down-regulated expression of P-Rex1 with autism in the Chinese Han population. (A) The LD structure of the region of *PREX1* in 239 trios according to Haploview (solid spine of LD, D′ >0.8). Markers with LD [D′ <1 and log of the odds (LOD) >2] are shown in red through pink with color intensity decreasing with decreasing D′ value. Regions of low LD and low LOD scores (D′ <1 and LOD <2) are shown in white. Variant alleles at six SNPs showed preferential transmission after Bonferroni correction (boxed in red). (B) Assays of copy number variation in the *PREX1* gene. The copy number states of *PREX1* promoter (*Upper*) and *PREX1* exon 1 (*Lower*) in 220 autistic people are shown. Each column indicates a patient. Four autism cases showed one copy of *PREX1* (red bars); others showed two copies (blue bars). (C and D) The *PREX1* mRNA level was decreased significantly in peripheral blood cells of autistic children as compared with healthy controls from the GEO profile database (control n = 69, autism n = 77) (C) and in our samples (control n = 24, autism n = 25) (D). *P < 0.05 by Mann–Whitney u test. Data are presented as mean ± SEM.

Table S2.

FABT results of haplotype association analysis for the SNPs in PREX1 in 239 trios

Marker	Haplotype	Freq	Z	P	Global haplotype test
Marker	Haplotype	Freq	Z	P	χ²	P	P^*
Block1
rs6066779-rs4810836	C-C	0.673	2.363	0.0181	14.900	0.0019	0.0170
rs6066779-rs4810836	C-T	0.216	0.236	0.8131	14.900	0.0019	0.8890
rs6066779-rs4810836	T-T	0.109	−3.669	0.0002	14.900	0.0019	0.0002
rs4810836-rs3934721	C-C	0.673	2.121	0.0339	13.202	0.0042	0.0236
rs4810836-rs3934721	T-C	0.204	0.397	0.6917	13.202	0.0042	0.7513
rs4810836-rs3934721	T-T	0.122	−3.470	0.0005	13.202	0.0042	0.0004
rs3934721-rs4076292	C-G	0.852	3.814	0.0001	14.581	0.0007	0.0004
rs3934721-rs4076292	T-A	0.123	−3.518	0.0004	14.581	0.0007	0.0002
rs4076292-rs4810845	G-T	0.850	3.637	0.0003	14.226	0.0008	0.0001
rs4076292-rs4810845	A-G	0.149	−3.528	0.0004	14.226	0.0008	0.0003
rs6066779-rs4810836-rs3934721	C-C-C	0.672	2.339	0.0193	13.679	0.0034	0.0156
rs6066779-rs4810836-rs3934721	C-T-C	0.202	0.241	0.8096	13.679	0.0034	0.8312
rs6066779-rs4810836-rs3934721	T-T-T	0.109	−3.498	0.0005	13.679	0.0034	0.0007
rs4810836-rs3934721-rs4076292	C-C-G	0.672	2.100	0.0357	14.733	0.0053	0.0284
rs4810836-rs3934721-rs4076292	T-C-G	0.180	0.758	0.4485	14.733	0.0053	0.5129
rs4810836-rs3934721-rs4076292	T-T-A	0.122	−3.470	0.0005	14.733	0.0053	0.0008
rs3934721-rs4076292-rs4810845	C-G-T	0.852	3.814	0.0001	15.733	0.0013	0.0005
rs3934721-rs4076292-rs4810845	T-A-G	0.123	−3.518	0.0004	15.733	0.0013	0.0011
rs6066779-rs4810836-rs3934721-rs4076292	C-C-C-G	0.671	2.316	0.0206	17.037	0.0044	0.0146
rs6066779-rs4810836-rs3934721-rs4076292	C-T-C-G	0.178	0.598	0.5498	17.037	0.0044	0.5737
rs6066779-rs4810836-rs3934721-rs4076292	T-T-T-A	0.109	−3.498	0.0005	17.037	0.0044	0.0010
rs4810836-rs3934721-rs4076292-rs4810845	C-C-G-T	0.672	2.100	0.0357	15.889	0.0032	0.0290
rs4810836-rs3934721-rs4076292-rs4810845	T-C-G-T	0.180	0.758	0.4485	15.889	0.0032	0.4972
rs4810836-rs3934721-rs4076292-rs4810845	T-T-A-G	0.122	−3.470	0.0005	15.889	0.0032	0.0014
Block2
rs6019374-rs6095248	A-T	0.576	1.074	0.2829	3.715	0.2940	0.3106
rs6019374-rs6095248	G-C	0.395	−0.605	0.5449	3.715	0.2940	0.5295
rs6095248-rs6019384	T-C	0.600	0.469	0.6392	4.199	0.2408	0.6753
rs6095248-rs6019384	C-C	0.249	−1.525	0.1273	4.199	0.2408	0.1443
rs6095248-rs6019384	C-A	0.150	1.278	0.2012	4.199	0.2408	0.2424
rs6019384-rs4455220	C-A	0.714	1.489	0.1366	10.098	0.0064	0.1428
rs6019384-rs4455220	A-A	0.151	1.192	0.2334	10.098	0.0064	0.2251
rs6019384-rs4455220	C-G	0.135	−3.104	0.0019	10.098	0.0064	0.0011
rs6019374-rs6095248-rs6019384	A-T-C	0.575	1.133	0.2574	5.698	0.2229	0.2704
rs6019374-rs6095248-rs6019384	G-C-C	0.248	−1.488	0.1367	5.698	0.2229	0.1566
rs6019374-rs6095248-rs6019384	G-C-A	0.148	0.839	0.4013	5.698	0.2229	0.4441
rs6095248-rs6019384-rs4455220	T-C-A	0.600	0.465	0.6422	12.753	0.0125	0.5916
rs6095248-rs6019384-rs4455220	C-A-A	0.150	1.268	0.2050	12.753	0.0125	0.2181
rs6095248-rs6019384-rs4455220	C-C-G	0.135	−3.157	0.0016	12.753	0.0125	0.0014
rs6095248-rs6019384-rs4455220	C-C-A	0.114	1.429	0.1530	12.753	0.0125	0.1514
rs6019374-rs6095248-rs6019384-rs4455220	A-T-C-A	0.575	1.165	0.2441	15.473	0.0085	0.2109
rs6019374-rs6095248-rs6019384-rs4455220	G-C-A-A	0.148	0.921	0.3573	15.473	0.0085	0.3482
rs6019374-rs6095248-rs6019384-rs4455220	G-C-C-G	0.135	−3.352	0.0008	15.473	0.0085	0.0012
rs6019374-rs6095248-rs6019384-rs4455220	G-C-C-A	0.113	1.590	0.1118	15.473	0.0085	0.1208
Block3
rs2223684-rs6066835	A-T	0.840	3.742	0.0002	17.574	0.0005	<0.0001
rs2223684-rs6066835	C-C	0.114	−4.013	0.0001	17.574	0.0005	<0.0001
Block4
rs13045364-rs2426101	G-C	0.698	1.622	0.1047	2.665	0.2638	0.0851
rs13045364-rs2426101	A-T	0.237	−1.308	0.1910	2.665	0.2638	0.2047

Open in a new tab

Global haplotype represents the haplotype using all possible variants. Significant P values (P < 0.05) are in bold. Freq, frequency of the haplotype.

P values corrected by permutation test of 10,000 rounds.

A copy number deletion of an approximate 1.4-kb region containing the PREX1 promoter and exon 1 was found in 4 of 220 autistic people (Fig. 1B) but was not detected in 291 unrelated healthy controls (Fig. S1). In addition, the level of PREX1 mRNA was significantly lower in the peripheral blood cells of autistic children than in those of healthy individuals in the Gene Expression Omnibus (GEO) profile database (Fig. 1C) (13) and in our study (Fig. 1D). These findings suggest that the gene dosage of PREX1 might be down-regulated in autism.

Fig. S1. — Assays of copy number variation in the *PREX1* gene in controls. The copy number states of *PREX1* promoter (*Upper*) and *PREX1* exon 1 (*Lower*) in 291 controls are shown. Each column indicates a control. All controls showed two copies (blue bars).

Prex1^−/− Mice Exhibit Autism-Like Behaviors.

As expected, P-Rex1 was completely absent in the brain of homozygous mutant mice (Fig. S2A). We tested the potential effect of the absence of P-Rex1 on behaviors related to autism (14). First, we used a three-chamber social interaction assay (15) to investigate animals’ voluntary initiation of social interaction and their ability to discriminate social novelty (Fig. 2A). In the initial trial, Prex1^−/− mice displayed normal sociability (Fig. 2 B and C). However, in the subsequent social novelty trial, WT mice displayed a preference for the novel animal (stranger 2), whereas Prex1^−/− mice spent almost identical amounts of time interacting with stranger 1 and with stranger 2 (Fig. 2 D and E). Because Prex1^−/− mice showed a normal interest in novelty in the novel-object recognition assay (Fig. S3A), we tested WT and Prex1^−/− mice for social novelty recognition using a stranger mouse and their familiar cohoused WT littermate (Fig. 2F) (16). We found that both genotypes demonstrated a significant preference for the novel animal (Fig. 2 G and H). This result indicated that Prex1^−/− mice showed selective impairment of social novelty recognition between stranger 1 and stranger 2.

Fig. 2. — *Prex1*^−/− mice exhibit deficits in social recognition and abnormal social communication. (A) Schematic representation of the sociability and social novelty preference trials (n = 10 WT mice; n = 11 KO mice). ITI, intertrial interval. (B and C) In the sociability trial (stranger 1 versus empty chamber), both WT and KO mice spent more time in the chamber containing the social partner (stranger 1) (B) and in close interaction with stranger 1 (C). (D and E) In the social novelty preference trial (stranger 1 versus stranger 2), KO mice did not display a preference for the novel social partner (stranger 2). (F) Representative paradigm of the stranger versus littermate trial. (G and H) Both WT and KO mice spent more time in the chamber containing the novel animal (stranger) (G) and preferred the novel animal to a littermate (H). (I and J) Abnormal social recognition memory in KO mice (n = 10 mice per genotype). (I) Representative protocol of the four-trial social memory assay. (J) WT but not KO mice habituated to the same mouse (trials 1–3) and dishabituated to a novel mouse (trial 4). The groups differed significantly (n = 10 mice per genotype). (K) Impaired social communication by USVs in KO pups (n = WT 30 mice; n = 31 KO mice). ***P < 0.001 (two-tailed Student’s t-test or two-way ANOVA). n.s., no significance. Data are presented as mean ± SEM.

Fig. S3. — Effects of *Prex1*^−/− on object recognition, olfaction, delayed nonmatching to place task, body weight, motor coordination, spontaneous locomotion, and anxiety-like and prepulse inhibition behaviors. (A) Normal novel object recognition of *Prex1*^−/− mice. After habituation to two identical novel objects for 20 min in an open field, one object was replaced by a different novel object, and the time spent in close interaction (within 1 cm) with objects was recorded during a 10-min period (n = 10 WT mice; n = 11 KO mice). (B) Normal olfaction in *Prex1*^−/− mice was assessed by the latency to find buried food (n = 10 WT mice; n = 11 KO mice). (C) The time spent sniffing in the olfactory habituation/dishabituation test (n = 10 or 11 mice per genotype). (D) Average number of correct choices from WT and *Prex1*^−/− mice in the delayed nonmatch to place T-maze task (n = 12 mice per genotype). (E) The body weight at different developmental stages of WT and *Prex1*^−/− male mice (n = 23 WT mice; n = 22 KO mice). (F) Normal motor coordination of *Prex1*^−/− mice was assessed by the accelerating rotarod task (n = 10 WT mice; n = 11 KO mice). (G and H) Normal locomotor activity of *Prex1*^−/− mice in an open field assay. Mice were allowed to explore an open field arena for 2 h (10 min per block), followed by quantification of the distance traveled during each block (G) and total distance moved in 2 h (H) (n = 10 WT mice; n = 11 KO mice). (I–K) *Prex1*^−/− mice showed normal levels of anxiety-like behaviors compared with WT mice as measured by an elevated plus-maze test (I), a light-dark box test (J), and the time spent in the center region during the first 10 min of an open field test (K) (n = 10 WT mice; n = 11 KO mice). (L) Normal prepulse inhibition in *Prex1*^−/− mice. Percentage of inhibition of the original startle when receiving 70 dB, 74 dB, or 82 dB sounds before the 110 dB startling sound was recorded (n = 8 mice per genotype). *P < 0.05, **P < 0.01 (two-tailed Student’s t-test or repeated-measures two-way ANOVA with genotype and treatment as independent variables). n.s., no significance. Data are presented as mean ± SEM.

Abnormal social novelty recognition usually results from a deficit in social memory (17, 18). We used a modified four-trial social memory assay (16, 19) to explore whether Prex1^−/− mice showed impaired social learning and memory in re-recognizing the first stranger (stranger 1) (Fig. 2I). We found that the WT mice displayed normal social memory, as demonstrated by a marked habituation (decreased close interaction) to a stimulus mouse (stranger 1) during the first three trials and a striking dishabituation (increased close interaction) upon the presentation of a novel animal (stranger 2) in the fourth trial. In contrast, Prex1^−/− mice showed no significant habituation to the stimulus mouse or dishabituation to the novel mouse (Fig. 2J), thus confirming that P-Rex1 is necessary for social memory of a stranger mouse (stranger 1).

Because olfaction is crucial for normal social behaviors in mice, we confirmed that odor recognition was normal in Prex1^−/− mice by using an olfaction test (Fig. S3B) and an olfactory habituation/dishabituation test (Fig. S3C). We therefore concluded that social memory of a familiar individual (littermate) was normal in Prex1^−/− mice and that the deficit in social novelty recognition between stranger 1 and stranger 2 was caused by the impaired social learning and memory of stranger 1, demonstrating that social learning and memory of a stranger mouse were deficient in Prex1^−/− mice.

Isolation-induced ultrasonic vocalizations (USVs) are an infant–mother vocal communicative behavior that is thought to be relevant to autism (14, 20). We found that Prex1^−/− pups emitted significantly fewer ultrasonic calls than did WT littermates (Fig. 2K), indicating the abnormality of social communication in Prex1^−/− mice.

We evaluated spatial learning and memory by using the Morris water maze (MWM) test. Prex1^−/− and WT mice showed similar learning curves (Fig. 3A) and probe performance (Fig. 3B). To assess behavioral flexibility, we first performed a classic reversal learning task using the MWM test. We found that Prex1^−/− mice showed impairment in learning the new platform location (Fig. 3C) and spent equivalent amounts of time in the new target and opposite quadrants (Fig. 3D). There was no difference between the two genotypes in latency in locating a visible platform (Fig. 3E). To study behavioral inflexibility in more detail, we examined contextual fear extinction. Prex1^−/− mice showed normal acquisition curves (Fig. 3F) similar to those of WT mice but a smaller reduction in freezing time during the extinction phase (Fig. 3G), confirming the behavioral inflexibility observed in reversal task on the MWM test. However, we found WT and Prex1^−/− mice did not differ significantly in the delayed nonmatch to place T-maze task (Fig. S3D). Repetitive behaviors also encompass motor stereotypes, and both tend to co-occur in autistic children. We found that Prex1^−/− mice spent significantly more time grooming themselves than did WT mice but showed normal jumping and digging behaviors (Fig. 3H).

Prex1^−/− mice weighed slightly less than WT mice at age 12 and 16 wk (Fig. S3E) (9). Although the motor behavior of Prex1^−/−/Prex2^−/− double-knockout mice is more impaired than that of Prex2^−/− mice (21), Prex1^−/− mice displayed normal motor coordination and balance with the rotarod (Fig. S3F) and normal locomotor activity in an open field test (Fig. S3 G and H). Prex1^−/− mice did not show any anxiety-like behaviors (Fig. S3 I–K). To characterize sensory deficits, we measured the degree of prepulse inhibition and found no significant differences between genotypes (Fig. S3L).

Down-Regulation of P-Rex1–Rac1 Signaling in the CA1 Region of the Hippocampus Impairs Social Recognition Behavior.

Social recognition (16, 22) and behavioral flexibility (23–25) have been shown to depend on hippocampal function. By using in situ hybridization (ISH), we found high expression of Prex1 mRNA in the CA1 region of the hippocampus (Fig. S2B), consistent with a previous report (11). Additionally, we verified the expression of P-Rex1 protein across the postnatal development of the cortex and hippocampus and the development of primary hippocampal neurons in vitro (Fig. S2 C–F). To characterize the P-Rex1⁺ cell types, double-labeling was performed; P-Rex1 protein was detected in calmodulin-dependent protein kinase II (CaMKII)-positive excitatory neurons but not in GFAP⁺ astrocytes (Fig. S2G).

We found no significant difference between 6-wk-old WT and Prex1^−/− mice in the quantity and distribution of cortical and hippocampal neurons (Fig. S4 A–N) or in the complexity of the dendrites in the neurons of the CA1 region (Fig. S4 O–S). Then we explored the possibility of a relationship between P-Rex1 deficiency in the CA1 region and impaired social recognition behavior in adolescent mice. We acutely down-regulated Prex1 expression in the neurons of the CA1 region in postnatal day 21 WT mice (Fig. 4 A and B). Three weeks after lentivirus (LV)-mediated shRNA injections, we performed a three-chamber social interaction test. As with Prex1^−/− mice, we found that mice injected with Prex1 shRNA, but not those injected with saline or control shRNA, showed a deficit in social recognition (Fig. 4 C and D). This result indicated that social recognition in Prex1^−/− mice may result from the deletion of P-Rex1 in the CA1 region. P-Rex1 knockdown also led to a mild deficit in behavioral flexibility but not to repetitive grooming (Fig. 5 A–G).

Fig. S4. — Normal gross morphology of the brain and the complexity of pyramidal neuron dendrites in the CAI1 region in *Prex1*^−/− mice. (*A–F*) Normal gross morphology and the number of neurons positive for NeuN (a marker of mature neurons) in neuronal cells in *Prex1*^−/− (KO) somatosensory cortex and hippocampal formation. (*G–J*) Normal number of neurons positive for parvalbumin (PV; a marker of an interneuron subtype) in *Prex1*^−/− somatosensory cortex and hippocampal formation. (K and L) Normal distribution of neurons positive for Cux1 (a marker of layer II–IV projection neurons) in the somatosensory cortex in the *Prex1*^−/−brain. (M and N) Normal distribution of neurons positive for FoxP2 (a marker of layer VI projection neurons) in the somatosensory cortex in the *Prex1*^−/−brain (n = 3 mice per genotype). (Scale bars, 500 μm in A and D; 200 μm in B, E, G, I, K, and M.) (O) Representative images and 2D projections of Neurolucida tracings of Golgi-stained pyramidal neurons from the CA1 region of the hippocampi of WT and *Prex1*^−/− (KO) mice. (*P–S*) Neurolucida tracings were used to quantify dendritic lengths (P), terminal branching points (Q), Sholl analysis for basal dendrites (R), and apical dendrites (S). (Scale bars, 20 μm.) n = 14 cells from four mice per group. Two-tailed Student’s t-test or repeated-measures two-way ANOVA with genotype and treatment as independent variables were used for statistical comparisons. n.s., no significance. Data are presented as mean ± SEM.

Fig. 4. — P-Rex1–Rac1 signaling in the CA1 region of the hippocampus plays a vital role in social recognition behavior. (A) LV carrying GFP was injected into the CA1 region of 3-wk-old mice and was observed after 3 wk. The GFP was expressed in different coronal sections of the hippocampus limited to the CA1 region. (B) Western blot showing knockdown of endogenous P-Rex1 by LV-mediated shRNA injection in the CA1 region. (C and D) The social recognition test was performed 3 wk after LV injection. (C) In the sociability trial, mice injected with saline, control shRNA, or P-Rex1 shRNA spent more time in close interaction with the social partner (stranger 1, S1) than in the empty cage (EM). (D) In the social novelty preference trial, mice injected with P-Rex1 shRNA did not display a preference for the novel social partner (stranger 2, S2) as compared with the saline or control shRNA group (n = 10 mice per group). (E and F) The level of Rac1 activity (GTP-Rac1 divided by total Rac1), but not Cdc42 or RhoA, was decreased significantly in the hippocampi of *Prex1*^−/− mice. (G and H) Mice were injected with vehicle or with the Rac1 inhibitor NSC23766. (G) Both groups performed normally in the sociability trial. (H) In the social novelty preference trial the mice injected with NSC23766 spent almost equal time in close interaction with stranger 1 and stranger 2 (n = 9 mice per group). *P < 0.05, **P < 0.01, ***P < 0.001 (two-tailed Student’s t test or two-way ANOVA). n.s., no significance. Data are presented as mean ± SEM.

Fig. 5. — Knockdown of P-Rex1 in the CA1 region of the hippocampus impairs reversal learning in the MWM (A–D) and fear extinction tests (E and F) but does not lead to repetitive grooming (G). (A–D) MWM test. (A and B) Learning. (A) Latency to locate a hidden platform (up to 60 s) decreased significantly across 7 d of training in the three groups of mice injected with saline, control shRNA, or P-Rex1 shRNA. (B) Probe test with the platform removed. Note that all three groups spent significantly more time in the target quadrant during a 60-s period. (C and D) Reversal learning. (C) Mice injected with P-Rex1 shRNA showed impairment in learning the new location of the platform across the subsequent 3 d of reversal training (the platform was switched to the opposite quadrant) as compared with the groups injected with saline or control shRNA. (D) Reversal probe test. Note that mice injected with saline or control shRNA, but not mice injected with P-Rex1 shRNA, spent significantly more time in the new target quadrant (n = 9 saline-injected mice; n = 8 control shRNA-injected mice; n = 9 P-Rex1 shRNA-injected mice). (E) Freezing time was increased significantly in the saline-, control shRNA-, and P-Rex1 shRNA-injected groups after one unconditional stimulus per 2-min block in a 12-min learning period consisting of six blocks. (F) Fear extinction was at least partially impaired in the group injected with P-Rex1 shRNA as compared with the groups injected with saline or control shRNA during a 30-min extinction period (5 min per block) 24 h after learning (n = 10 saline-injected mice; n = 10 control shRNA-injected mice; n = 11 P-Rex1 shRNA-injected mice). (G) Stereotypical grooming was similar in all three groups (n = 10 mice per group). (Two-tailed Student's t test, one-way ANOVA, or repeated-measures two-way ANOVA with genotype and treatment as independent variables). n.s., no significance. Data are presented as mean ± SEM.

Previous study reported that P-Rex1 regulates the activation level of Rac family members in peripheral neutrophils (8, 9). Therefore, we investigated whether abnormal activation of Rac1, which is highly expressed in the hippocampus, is involved in the social recognition deficit in Prex1^−/−mice. First, we found that the activation level of Rac1 (GTP-Rac1/total Rac1), but not that of Cdc42 or RhoA (Ras homolog gene family, member A), was significantly reduced in Prex1^−/− hippocampi (Fig. 4 E and F). Then we injected NSC23766, a Rac1 inhibitor, into the CA1 region of 6-wk-old WT mice 30 min before the three-chamber test to verify further the effects of low Rac1 activation level on social recognition behavior (Fig. S5A). Compared with the vehicle (saline)-injected group, the mice injected with NSC23766 spent significantly less time with stranger 2 (Fig. 4 G and H), a pattern that mimicked the social recognition impairment in Prex1^−/− mice and indicated that Rac1 activation in the hippocampus is involved in P-Rex1–mediated social recognition.

Fig. S5. — The inhibition or recovery of P-Rex1 or Rac1 activity and the hippocampal injection of Rac activator rescued social recognition inflexibility in *Prex1*^−/− mice. (A) The hippocampal Rac1 activity was reduced by NSC23766 injection compared with vehicle (saline) injection. (B) Overexpression of P-Rex1 protein by LV-mediated WT human P-Rex1 in the *Prex1*^−/− hippocampal CA1 region 7 d before analysis. (C) The activation level of Rac1 was restored by AAV-mediated overexpression of WT Rac1 protein in the *Prex1*^−/− hippocampal CA1 region 7 d before analysis. (D) Western blot showing the GTP-Rac1 level in the hippocampus 90 min after the injection of Rac activator or vehicle. (E–H) Three-chamber social interaction test. Two pipes were buried in the bilateral hippocampus of 4-wk-old *Prex1*^−/− mice, and the behavior tests were performed at age 6 wk. Ninety minutes before testing, hippocampi were injected with saline or Rac activator (0.1 μg/μL, 1 μL per unilateral site). (E and F) In the sociability trial, both the Rac activator and the vehicle groups spent more time in the chamber containing the social partner (stranger 1) or spent more time in close interaction with stranger 1. (G and H) In the social novelty preference trial, the mice in the Rac activator group displayed a preference for the novel social partner (stranger 2) and spent more time in close interaction with stranger 2 than did the mice in the vehicle group (n = 9 mice per group). **P < 0.01, ***P < 0.001 (two-tailed Student’s t-test and two-way ANOVA). n.s., no significance. Data are presented as mean ± SEM.

NMDAR-Dependent LTD Is Selectively Impaired in Prex1^−/− Mice.

To evaluate the synaptic localization of P-Rex1, we prepared subcellular fractions from the hippocampi of WT mice. P-Rex1 was detected not only in the synaptic vesicle (SV) fraction but also in the postsynaptic density (PSD) fraction, which was immunonegative for synaptophysin (Fig. S2H). This result indicates that P-Rex1 is enriched in the PSD fraction and may offer some clues as to its specific role in synaptic function.

To identify the cellular excitability and basal transmission features, we measured baseline synaptic properties at SC–CA1 synapses. We found that the intrinsic neuronal excitability did not differ between WT and Prex1^−/− mice (Fig. S6 A–H). The basal excitatory transmissions, such as input–output, paired-pulse ratio, and miniature excitatory postsynaptic currents (mEPSCs), were indistinguishable between WT and Prex1^−/− mice (Fig. 6 A–C), indicating that genetically deleting P-Rex1 did not affect AMPAR-mediated basal synaptic transmission and presynaptic transmitter release. We then probed the NMDAR/AMPAR ratio and found it was unaltered in Prex1^−/− mice (Fig. 6D), suggesting that P-Rex1 ablation did not affect the equilibrium between NMDAR and AMPAR components.

Fig. S6. — Other electrophysiological features in *Prex1*^−/− mice. (A–H) Basal excitability of dorsal hippocampal CA1 pyramidal neurons was normal in *Prex1*^−/− mice. (A) Normal membrane capacitance in *Prex1*^−/− (KO) neurons (WT, 129.5 ± 5.5 pF; n = 18 neurons from nine mice; KO, 127.9 ± 6.9 pF; n = 18 neurons from seven mice). (B) Normal series resistance in *Prex1*^−/− neurons (WT, 15.7 ± 0.6 MΩ; n = 18 neurons from nine mice; KO, 15.1 ± 0.6 MΩ, n = 19 neurons from seven mice). (C) Normal holding current in *Prex1*^−/− neurons (WT, −78.2 ± 9.6 pA; n = 18 neurons from nine mice; KO, −82.0 ± 8.0 pA; n = 19 neurons from seven mice). (D) Normal membrane potential responses with step current commands ranging from −200 to 0 pA in *Prex1*^−/− neurons (n = 22 neurons from nine WT mice; n = 23 neurons from seven KO mice). (E) Normal input resistance in *Prex1*^−/− neurons (WT: 137.4 ± 3.6 MΩ, n = 22 neurons from nine mice; KO: 134.9 ± 5.9 MΩ, n = 21 neurons from seven mice). (F) Normal resting membrane potential in *Prex1*^−/− neurons (WT: −62.7 ± 0.9 mV, n = 22 neurons from nine mice; KO: −63.9 ± 1.2 mV, n = 22 neurons from seven mice). (G) Normal voltage sag of *Prex1*^−/− neurons (WT: 1.121 ± 0.008, n = 22 neurons from nine mice; KO: 1.111 ± 0.009, n = 22 neurons from seven mice). (H) Normal action potential responses to fixed current injections in *Prex1*^−/− neurons (n = 8 neurons from five WT mice; n = 8 neurons from four KO mice). [Scale bars, 50 mV (vertical) and 500 ms (horizontal).] (I) The dependence of LTD on NMDA receptors. d-(-)-2-Amino-5-phosphonopentanoic acid (d-APV, 50 μM) blocked low-frequency stimulus-induced LTD in our study (99.06 ± 1.575%, n = 4) as compared to that without the drug (72.92 ± 4.492%, n = 4). [Scale bars, 0.5 mV (vertical) and 5 ms (horizontal).] (J) Normal NMDAR-dependent LTD in *Prex1*^−/− slices from the primary visual cortex (n = 6 slices from three WT mice and 6 slices from three KO mice). [Scale bars, 0.2 mV (vertical) and 5 ms (horizontal).] (K) Impairment of cerebellar LTD in *Prex1*^−/− slices (n = 6 neurons from four WT mice and 6 neurons from two KO mice). [Scale bars, 100 pA (vertical) and 50 ms (horizontal).] Two-tailed Student’s t-test or repeated-measures two-way ANOVA with genotype and treatment as independent variables was used for statistical comparisons. n.s., no significance. Data are presented as mean ± SEM.

Fig. 6. — Impaired NMDAR-dependent LTD in *Prex1*^−/− mice. (A) Normal input–output curve at hippocampal SC–CA1 synapses (n = 6 slices per genotype). Representative voltage traces are shown at the top of each panel. n.s., no significance. [Scale bars, 1 mV (vertical) and 20 ms (horizontal).] (B) Normal paired-pulse ratio (n = 6 slices per genotype). [Scale bars, 0.5 mV (vertical) and 100 ms (horizontal).] (C) Normal mESPCs (n = 18 cells per genotype). [Scale bars, 10 pA (vertical) and 1.0 s (horizontal).] (D) Normal NMDAR/AMPAR ratio (n = 16 WT cells; n = 17 KO cells). [Scale bars, 100 pA (vertical) and 20 ms (horizontal).] (E) Impaired NMDAR LTD (n = 13 slices per genotype). (F) Normal mGluR LTD (n = 11 slices per genotype). (G) Normal LTP (n = 15 WT slices; n = 14 KO slices). (H) Normal depotentiation (n = 7 slices per genotype). [Scale bars in E–H, 1 mV (vertical) and 20 ms (horizontal).] (Two-tailed Student's t test or repeated-measures two-way ANOVA.) Data are presented as mean ± SEM.

We sought to investigate the physiological role of P-Rex1 in hippocampal synaptic plasticity. We examined various synaptic plasticity models; most notably, NMDAR-dependent LTD, which can be blocked by d-(-)-2-Amino-5-phosphonopentanoic acid (d-APV) (Fig. S6I), was impaired in Prex1^−/− mice (Fig. 6E). We then examined other forms of synaptic depression and found that metabotropic glutamate receptor (mGluR)-dependent LTD, was normal in Prex1^−/− mice (Fig. 6F), suggesting that P-Rex1 is not associated with all forms of synaptic depression. We also found that long-term potentiation (LTP) (100 Hz, three strains) and depotentiation were intact in Prex1^−/− mice (Fig. 6 G and H). The NMDAR-dependent LTD in primary visual cortex is not impaired in Prex1^−/− mice (Fig. S6J), although the LTD in cerebellum is affected (Fig. S6K). These results indicate that P-Rex1 at SC–CA1 synapses is specifically necessary for NMDAR-dependent LTD.

PP1α Interaction with P-Rex1 and P-Rex1–Mediated Rac1 Activation Are Essential for NMDA-Induced AMPAR Endocytosis.

Because NMDAR- and AMPAR-associated signaling regulates various aspects of synaptic plasticity, we tested presynaptic and postsynaptic protein expression in the total lysate and crude synaptosomal fraction (P2) from WT and Prex1^−/− hippocampi but did not detect any significant differences (Fig. S7).

Fig. S7. — Analysis of cell type and presynaptic and postsynaptic protein expression in total lysate and crude synaptosomal fractions (P2) from hippocampi of 6-wk-old WT and *Prex1*^−/− (KO) mice. (A) Levels of the indicated cell type and presynaptic and postsynaptic markers in total hippocampal lysate were quantified after normalization to α-tubulin and after the average WT intensity was set to 1.0. (B) Levels of the indicated postsynaptic markers in hippocampal crude synaptosomal fractions (P2) were quantified after normalization to β-actin and after the average WT intensity was set to 1.0. Representative gels are shown. Two-tailed Student’s t-test was used for statistical comparisons. The graphs show the mean ± SEM for four independent pairs of WT and *Prex1*^−/− mice.

Rac1 was reported to be linked to NMDAR-dependent LTD (26–28). We found that Rac1 activity was increased in the slices from the CA1 region of the hippocampi s of WT mice but not in the slices from Prex1^−/− mice during NMDA-induced chemical LTD (Fig. S8A). In contrast, we did not detect any difference in GluR1 Ser845 dephosphorylation, which is involved in hippocampal NMDAR-dependent LTD (29), between WT and Prex1^−/− mice after NMDA treatment (Fig. S8B).

Fig. S8. — P-Rex1–mediated Rac1 activation in the CA1 region of the hippocampus is involved in NMDAR LTD. Representative samples of Western blots of the Rac1 activation assay and GluR1 (Ser845) phosphorylation without NMDA (0 min) and with NMDA (100 μM) treatment for 2, 5, and 10 min in hippocampal slices of WT and *Prex1*^−/− (KO) mice. A low level of Rac1 activity (GTP-Rac1 divided by total Rac1) (A) but a normal GluR1 (Ser845) phosphorylation level (phosphorylated divided by total) (B) was seen with the application of NMDA in *Prex1*^−/− slices (n = 6 mice per genotype). Repeated-measures two-way ANOVA with genotype and treatment as independent variables was used for statistical comparisons. Data are presented as mean ± SEM.

Endocytosis of AMPARs is thought to be important in the expression of LTD triggered by NMDAR activation (30). PP1 is a vital factor required for CA1 NMDAR-dependent LTD and AMPAR endocytosis (31, 32). Previous findings have suggested that PP1α, the catalytic subunit of PP1, binds to the RVxF motif in the C-terminal IP4P domain of P-Rex1 and dephosphorylates adjacent serine residues in nonneuronal cells. This effect releases steric inhibition of the DH/PH tandem domain of P-Rex1 by its IP4P domain, inducing higher basal activity of its N-terminal Rac1 guanine-nucleotide exchange function (33). Thus, we hypothesized that the NMDAR activation-induced association of PP1α with P-Rex1 is essential for NMDA-induced AMPAR endocytosis. First, we examined whether NMDA treatment induces the interaction of PP1α with P-Rex1 in slices from the CA1 region by using a coimmunoprecipitation assay. We found P-Rex1 coimmunoprecipitation with PP1α was increased with NMDA treatment (Fig. 7 A and B).

Fig. 7. — Interaction of PP1α with P-Rex1 and P-Rex1–mediated Rac1 activation are essential for NMDA-induced AMPAR endocytosis. (A) Coimmunoprecipitation of PP1α with P-Rex1 in hippocampal slices from the CA1 region treated acutely with 100 μM NMDA. (B) Quantification of the NMDA-induced interaction of P-Rex1 with PP1α from five independent experiments. The ratio in the WT group was defined as 1.0. (C–I) Hippocampal neurons expressing pCAGGS-IRES-EGFP (Veh) vector (C and D), WT P-Rex1 (P-Rex1-WT) (E), WT Rac1 (Rac1-WT) (F), P-Rex1 with the VAFA mutation (P-Rex1-VAFA) (G), and P-Rex1 with the GEF domain dead mutation (P-Rex1-DH dead) (H) were treated with 50 μM NMDA for 10 min and stained for surface HA-GluR2 (red). After Triton X-100 treatment, the neurons were stained for the total HA-GluR2 (blue). The dendritic regions marked by white squares are magnified in the bottom panels. (Scale bars, 10 μm.) (I) Quantification of the NMDA-induced endocytosis of surface GluR2. Data are presented as the ratio of the intensity of surface staining HA-GluR2 to the intensity of total HA-GluR2 staining. The ratio in control neurons was defined as 1.0. (WT+Veh: n = 12 in the control group and n = 12 in the NMDA group; KO+Veh: n = 12 in the control group and n = 14 in the NMDA group; KO+P-Rex1 WT: n = 10 in the control group and n = 11 in the NMDA group; KO+Rac1 WT: n = 11 in the control group and n = 12 in the NMDA group; KO+P-Rex1 VAFA: n = 10 in the control group and n = 11 in the NMDA group; KO+P-Rex1 DHdead: n = 12 in the control group and n = 13 in the NMDA group). *P < 0.05, **P < 0.01, ***P < 0.001 (two-tailed Student’s t-test ). n.s., no significance. Data are presented as mean ± SEM. (J) Proposed model for AMPAR endocytosis mediated by the PP1α–P-Rex1–Rac1 signaling pathway during NMDA-LTD induction. (1) Activity-induced Ca²⁺ influx through NMDAR dephosphorylates P-Rex1 by activating PP1α. (2) Dephosphorylated P-Rex1 is recruited to membrane and activated further. (3) Active P-Rex1 catalyzes guanine–nucleotide exchange on Rac1 for GTP activation. (4) Rac1-GTP participates in actin cytoskeletal remodeling, which is essential for AMPAR endocytosis.

Then we expressed the GluR2 subunit tagged with HA at its extracellular N terminus in cultured hippocampal neurons. In agreement with previous reports (30, 32), we found that the surface HA-GluR2 decreased rapidly following NMDA stimulation in WT but not in Prex1^−/− neurons (Fig. 7 C and D). When P-Rex1-WT was overexpressed in Prex1^−/− neurons, the NMDA-induced reduction of surface AMPARs was normalized (Fig. 7E). Similarly, the overexpression of Rac1-WT recovered AMPAR endocytosis (Fig. 7F). In contrast, overexpression of P-Rex1-VAFA, a mutated form of P-Rex1 with two amino acid substitutions (V1147A/F1149A) in the RVxF motif, the loss of the binding site with PP1α (33), or P-Rex1-DHdead, a mutant with two amino acid substitutions (E56A/N238A) in the DH domain of P-Rex1, and the loss of the GEF function (34) all failed to rescue the NMDA-induced AMPAR endocytosis (Fig. 7 G and H). These results suggest that interaction of PP1α with P-Rex1 and P-Rex1–mediated Rac1 activation play crucial roles in NMDA-induced AMPAR endocytosis in hippocampal neurons (Fig. 7I). A model for AMPAR endocytosis mediated by the PP1–P-Rex1–Rac1 signaling pathway during NMDAR-dependent LTD induction is shown in Fig. 7J.

Recovery of NMDAR-Dependent LTD Impairment and Social Recognition in Prex1^−/− Mice.

To substantiate further the involvement of P-Rex1 in NMDAR-dependent LTD and social recognition behavior, we determined whether overexpressing WT P-Rex1 protein in pyramidal neurons of the CA1 region at postnatal day 21 would be sufficient to prevent LTD impairment and social recognition disruption in Prex1^−/− mice. We found that P-Rex1 expression could be restored efficiently in the CA1 region of Prex1^−/− mice (Fig. S5B) and that NMDAR-dependent LTD was restored fully in the group overexpressing P-Rex1 (Fig. 8A). In addition, P-Rex1 overexpression in the CA1 region rescued social recognition (Fig. 8 B and C) and behavioral inflexibility but not repetitive grooming (Fig. 9 A–G) in Prex1^−/− mice.

Fig. 8. — Recovery of NMDAR-dependent LTD impairment and social recognition in *Prex1*^−/− mice. (A) Recovery of NMDAR-dependent LTD in *Prex1*^−/− (KO) mice by WT P-Rex1 overexpression in the pyramidal neurons of the CA1 region (n = 8 slices per group). (B and C) P-Rex1 overexpression clearly augmented social recognition in KO mice (n = 8 mice per group). (D) Overexpression of WT Rac1 restored the impaired NMDAR-dependent LTD in KO mice (n = 6 control slices; n = 8 WT Rac1slices). (E and F) Overexpression of WT Rac1 resulted in a clear augmentation of social recognition in KO mice (n = 10 control mice; n = 12 WT Rac1 mice). (G) d-serine (20 μM) restored the impaired NMDAR-dependent LTD in KO mice (n = 7 slices from vehicle-treated mice; n = 8 slices from d-serine–treated mice). (H and I) KO mice treated with d-serine (0.8 g/kg i.p.) showed improved social recognition in the three-chamber assay (n = 8 mice per group). [Scale bars, 1 mV (vertical) and 20 ms (horizontal) in A, D, and G.] **P < 0.01, ***P < 0.001 (two-tailed Student’s t-test and/or repeated-measures two-way ANOVA). n.s., no significance. Data are presented as mean ± SEM. CTL, control.

Fig. 9. — Recovery of reversal learning in the MWM and fear extinction but not repetitive grooming in *Prex1*^−/− mice. (A) Overexpression of WT P-Rex1 made no difference in the latency in locating a hidden platform across 7 d of training compared with control group. (B) Probe test. Note that overexpression of WT P-Rex1 resulted in almost identical time spent in the target quadrant compared with control group. (C) WT P-Rex1 overexpression resulted in a clear augmentation of reversal learning in KO mice because they required less time to reach the new location of the hidden platform. (D) Reversal probe test. Note that group with WT P-Rex1 overexpression spent significantly more time in the new target quadrant (n = 11 in the KO+CTL group; n = 10 in the KO+WT P-Rex1 group). (E) Freezing time was increased significantly after one unconditional stimulus per block in both WT P-Rex1 and control groups. (F) Freezing time was decreased more significantly in the group overexpressing WT P-Rex1 than in the control group 24 h after learning (n = 13 mice per group). (G) Stereotypical grooming was not significantly different between the group overexpressing WT P-Rex1 and the control group (n = 9 mice per group). (H) Overexpression of WT Rac1 made no difference in the latency in locating a hidden platform across 7 d of training compared with the control group. (I) Probe test. Note that overexpression of WT Rac1 led to almost identical time spent in the target quadrant compared with the control group. (J) WT Rac1 overexpression resulted in a clear augmentation of reversal learning in KO mice because they required less time to reach the new location of the platform. (K) Reversal probe test. Note that the group overexpressing WT Rac1 spent significantly more time than the control group in the new target quadrant (n = 12 for the KO+CTL group; n = 11 for the KO+WT Rac1 group). (L) Freezing time was increased significantly in both the WT Rac1 and control groups after one unconditional stimulus per block. (M) Freezing time was decreased more significantly in the group overexpressing WT Rac1 than in the control group 24 h after conditioning to the stimulus (n = 11 mice per group). (N) Stereotypical grooming was not significantly different between the group overexpressing WT Rac1 and the control group (n = 10 mice per group). *P < 0.05, **P < 0.01 (two-tailed Student’s t-test or repeated-measures two-way ANOVA with genotype and treatment as independent variables). n.s., no significance. Data are presented as mean ± SEM.

Because Rac1 activation in the CA1 region was involved in P-Rex1–mediated NMDAR-dependent LTD and social recognition behavior, we asked whether overexpressed WT Rac1 in pyramidal neurons of the CA1 region could normalize LTD impairment and social recognition (Fig. S5C). As with P-Rex1 overexpression, we observed that overexpression of WT Rac1 fully restored NMDAR-dependent LTD impairment (Fig. 8D) and at least partially augmented social recognition in Prex1^−/− mice (Fig. 8 E and F). Injection of Rac activator into the CA1 region also partially normalized social recognition in Prex1^−/− mice (Fig. S5 D–H). Moreover, the behavioral inflexibility (but not repetitive grooming) was restored by WT Rac1 overexpression (Fig. 9 H–N).

To explore further the association between NMDAR-dependent LTD impairment and the social recognition deficit in Prex1^−/− mice, we used d-serine, a coagonist of the glycine modulatory sites on the NMDAR. We wondered whether d-serine would affect Prex1^−/− NMDAR-dependent LTD impairment and the social recognition deficit. We found that d-serine fully rescued the NMDAR-dependent LTD impairment at Prex1^−/− SC–CA1 synapses (Fig. 8G) and significantly improved social recognition (Fig. 8 H and I). These results confirmed postsynaptic PP1α–P-Rex1–Rac1 signaling and its direct involvement in hippocampal NMDAR-dependent LTD and social recognition behavior.

Discussion

LTD is regarded as a critical form of synaptic plasticity involving the modification or elimination of previously learned information (35). Although pharmacological or genetic disruption of NMDAR-dependent LTD in the CA1 region is related to impairments in behavioral flexibility (23–25), the mechanism underlying the role of NMDAR-dependent synaptic plasticity in social recognition is not fully understood. Here we used Prex1^−/− mice and found a tight link between NMDAR-dependent LTD in the CA1 region and behavioral phenotypes including social recognition, reversal learning of spatial memory, and extinction training of contextual fear memory but found no correlation with repetitive grooming or with the delayed nonmatch to place T-maze task. Our findings may indicate that reversal learning of the memories (such as spatial memory and contextual fear memory) and correct choices in the delayed nonmatch to place T-maze task reflect different aspects of cognitive functions (23). We believed that not only social memory but also other cognitive functions are impaired in Prex1^−/− mice, possibly because of abnormal LTD, suggesting unique characteristics of cognitive dysfunction in Prex1^−/− mice.

In addition to the CA1 region of the hippocampus, P-Rex1 is highly expressed in the pyramidal neurons of the superficial layer of cortex. However, the NMDAR-dependent LTD in primary visual cortex was not affected in Prex1^−/− mice, indicating that, to some extent, P-Rex1 has a specific role in NMDAR-dependent LTD in the CA1 region.

The molecular mechanism for NMDAR-dependent LTD induction is not fully understood. We found that NMDA triggered the interaction between PP1α and P-Rex1 that activated Rac1, which is critical for AMPAR endocytosis and LTD expression. These results implicate an essential role of PP1α–P-Rex1–Rac1 signaling in NMDAR-dependent LTD in the CA1 region.

In conclusion, our results provide the first report, to our knowledge, of a genetic association of P-Rex1 and its copy number deletion with ASDs, the role of P-Rex1 in hippocampal synaptic plasticity and autism-like behaviors, a pivotal role in the induction of NMDAR-dependent LTD in the CA1 region, and AMPAR endocytosis via a postsynaptic PP1α–P-Rex1–Rac1 signaling pathway. Our findings suggested that P-Rex1 might be a previously unreported target for therapeutic approaches to treat disorders with symptoms of social deficit and/or cognitive dysfunction such as ASDs.

Materials and Methods

Further details are provided in SI Materials and Methods.

Subjects.

For the family-based genetic association study, 239 Chinese Han family trios (singleton autistic disorder patients and their unaffected biological parents) were recruited for the present study at the Institute of Mental Health, Peking University, Beijing. Of the 239 autistic child probands, 226 were male, and 13 were female. The mean age of the children at the time of testing was 7.5 y. Diagnoses of autism were established by two senior psychiatrists. All patients fulfilled the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for autistic disorder. To assess the cases, the Childhood Autism Rating Scale (36) and Autism Behavior Checklist (37) were used. Children with phenylketonuria, fragile X syndrome, tuberous sclerosis, or a previously identified chromosomal abnormality were excluded. To decrease the heterogeneity of the cases, children affected with Asperger disorder and Rett syndrome were excluded from our study. For analysis of copy number variants, 227 unrelated healthy controls were recruited from the community by advertisements during physical examinations. Psychiatrists performed a simple, nonstructured interview to exclude individuals with a history of mental health and neurological diseases. Similarly, for P-Rex1 mRNA analysis in peripheral blood cells, blood was collected from 24 male autistic patients and 25 age-matched healthy male controls. All participants in this study provided written informed consent. Written informed consents for children were obtained from their legal guardians. This study was approved by the Ethics Committee of the Institute of Mental Health, Peking University. Genetic association and copy number variants analysis protocols are provided in SI Materials and Methods.

Mouse Strains.

The Prex1^−/− mice in the C57BL6 background were a kind gift from Heidi Welch, The Babraham Institute, Cambridge, UK (10). Generation of this knockout line was described previously (9).

Animal Experiments.

Animals were housed at a constant temperature of 25 °C in a 12-h/12-h light/dark cycle (lights off at 20:00), with food and water available ad libitum. Three to five mice were housed per cage by genotype. Only aged-matched male mice were used for behavioral experiments. All animal experimental procedures were reviewed and approved by the Peking University Institutional Animal Care and Use Committee and the Peking University Committee on Animal Cares. Details on animal behavioral tests are provided in SI Materials and Methods.

Electrophysiology.

Animals were killed, and hippocampal coronal slices (350 μm) were obtained using a vibratome (Leica VT 1000S). Field excitatory postsynaptic potentials (fEPSPs) in the CA1 region of the hippocampus were recorded. The recording electrode was placed ∼400 μm away from the stimulating electrode in the stratum radium of the CA1 region. All data were recorded using pCLAMP 10 software (Molecular Devices). The fEPSPs, NMDA/AMPA ratio, and action potentials were analyzed by Clampfit 10 software (Molecular Devices). The mEPSCs were analyzed using Mini Analysis software (Synaptosoft).

Rac1, Cdc42, and RhoA-GTP Assays.

Individual 6-wk-old mouse hippocampi were homogenized with a glass homogenizer in 1 mL of cold 1× MLB lysis buffer [25 mM Hepes (pH 7.5), 150 mM NaCl, 1% (vol/vol) IGEPAL CA-630, 10 mM MgCl2, 1 mM EDTA, and 2% (vol/vol) glycerol] to which protease inhibitor mixture (Roche Diagnostics Ltd.) and phosphatase inhibitor mixture (Roche) were added. The lysate was centrifuged at 12,000 × g for 20 min at 4 °C. The supernatant was incubated with 10 μg of GST-PAK-BD (for Rac1 and Cdc42) (Millipore) or GST-Rhotekin (for RhoA) (Millipore) fusion protein bound to glutathione-coupled Sepharose beads for 45 min at 4 °C. Beads were washed three times in the lysis buffer, and bound proteins were eluted in loading buffer and subjected to SDS/PAGE gel. Proteins were transferred electrophoretically to nitrocellulose, and the filters were incubated with antibodies. In all cases, 5% of the initial homogenate input for the pull-down assay was electrophoresed and probed with antibody, and activated levels were normalized to the total input levels of Rac1, Cdc42, or RhoA.

Statistical Analysis.

Experimenters were blinded to the genotype during testing and scoring. All data are presented as mean ± SEM. Statistical analyses were performed using SPSS 16.0 (SPSS), and details of the results are summarized in Dataset S1. Statistical significance was set a priori at 0.05.

SI Materials and Methods

Genotyping and Genetic Statistical Analyses.

A set of tagging SNPs was selected according to the dbSNP (www.ncbi.nlm.nih.gov/SNP/) and the HapMap phase I and II Chinese Han in Beijing genotype (hapmap.ncbi.nlm.nih.gov/) datasets. SNPs across the PREX1 gene region ± 20 kb with minor allele frequency >0.1 were selected. Moreover, pairwise tagging in the Tagger module implemented in Haploview version 4.1 program was used to select SNPs that could capture the known common genetic variation across each gene (r² >0.8). The physical positions of the SNPs were considered also. A total of 17 SNPs that met three criteria—genotyping success rate >90%, Hardy–Weinberg equilibrium (P > 0.05), and Mendelian errors ≤10—were originally selected. Genomic DNA was extracted from the blood using a Qiagen QIAamp DNA Mini Kit. All 17 SNPs were successfully genotyped using the Sequenom (https://www.sequenom.com/) genotyping platform with standard protocols using the MALDI-TOF primer extension assay (38, 39). The iPLEX genotyping assay, which has increased plexing efficiency and flexibility for the MassARRAY system through the single-base primer extension with mass-modified terminators, was used for analysis of all 17 SNPs. The Hardy–Weinberg equilibrium for genotype frequency distributions was tested using the χ² goodness-of-fit test. Mendelian inconsistencies were checked using the PEDCHECK program, version 1.1 (40). The pairwise LD analysis was applied to detect the intermarker relationship with Haploview (www.broadinstitute.org/mpg/haploview/), using D′ values. The FBAT was performed with FBAT program v1.7.2 (www.hsph.harvard.edu/fbat/default.html.) (41), which uses generalized score statistics to perform a variety of transmission disequilibrium tests, including haplotype analyses. Moreover, the FBAT program provides estimates of haplotype frequencies and pairwise LD between the specified markers. We used a sliding window approach to test haplotypes of two, three, and four adjacent SNPs across each gene if the D′ value was >0.8.The global haplotype tests of association were performed under the multiallelic mode in haplotype FBAT. Meanwhile, the individual haplotype tests were conducted under the biallelic mode in haplotype FBAT. FBATs were performed under an additive model. The significance level for all statistical tests was two tailed (P < 0.05) after correction by a Bonferroni (single SNP) or permutation (haplotype, n = 10,000) test.

Detection of Copy Number.

The copy numbers of the PREX1 gene were measured by a custom-by-design Multiplex AccuCopy Kit (Genesky Biotechnologies Inc.) based on a multiplex fluorescence competitive PCR principle as previously described (42, 43). The reference genome sequences were obtained from the University of California, Santa Cruz Genome Browser (hg19; genome.ucsc.edu). Twelve reference segments (2p-1_1, 3p-3_2, 4q-3_1, 5p-2_1, 6p-3_1, 8p-1_2, 8q-3_1, 9p-2_2, 11p-1_1, 12q-1_1, 18p-1_1, and 20p-1_1) were used for normalization. Eight target genomic segments (promoter, exons 1–6, and 3′UTR) within PREX1 were chosen for the AccuCopy assay. Our data were produced according to the manufacturer's manual. Briefly, for each sample a 20-µL PCR was prepared containing 1× AccuCopy PCR Master Mix, 1× Fluorescence Primer Mix, 1× Competitive DNA mix, and ∼10 ng sample DNA. The PCR program was as followed: 95 °C for 10 min; 11 cycles at 94 °C for 20 s, 65 °C −0.5 °C per cycle for 40 s, 72 °C for 1.5 min; 24 cycles of 94 °C for 20 s, 59 °C for 30 s, 72 °C for 1.5 min; 60 °C for 60 min. PCR products were diluted 20-fold before being loaded on the ABI 3730XL sequencer. Raw data were analyzed by GeneMapper 4.0, and height/area data for all specific peaks were exported into an Excel file. The sample/competitive (S/C) peak ratio was calculated for the target segments and for 12 reference segments, and the S/C ratio for each target fragment was first normalized to that of the 12 reference segments, respectively. The 12 normalized S/C ratios were further normalized to the median value in all samples for each reference gene and then were averaged. The target sequences of eight segmentsinPREX1for copy number variants test were as follows: Promoter: TTCTTCTGGGAAAGGTGGAAAGGGCAGGGTCAGGGGGCAAAGAA; Exon 1: GATCTTGGGCACCGAGAGGGACTACGTGGGCACCTTGCGC; Exon 2: CGGACACTCACCTCTCTCTGCTTCTCTCCTCCAGGCATTCCTGCATCG; Exon 3: ACGCTGTCCTCTGGCCTCTCTTTTCCTCACAGGTCCTGTTCTCGAA; Exon 4: AGGCTCTGTCCTTGTCTTGCAGAAGGACAAGTTCTGCGTGTACGAGGA; Exon 5: TGGTGGGTTTCATGAAGGTCTCCTGTCCCTTTGCAGAGCTGCATG; Exon 6: CCATGAAGACCGTTTGCTCCAACATCAATGAGACCAAGCGGCA; 3′UTR: TCAAAGAAAGGTATGTTGTCTAACAGGGGACCAACAGAAGGTAGTATTGACAACTGTTCC.

ISH.

We examined the distribution of P-Rex1 mRNA in the postnatal C57BL6 mouse brain by using ISH. Mice were deeply anesthetized with sodium pentobarbital (40 mg/kg body weight) and were perfused intracardially with 4% (wt/vol) paraformaldehyde (PFA) in a phosphate-buffered solution (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na₂HPO₄, 1.4 mM KH₂PO₄, pH 7.4). Embryo, neonatal, and adult brains were removed, postfixed overnight in the same fixative at 4 °C, and cryoprotected by immersion in 30% (wt/vol) sucrose for 2–4 d. Then brains were embedded in optimum cutting temperature (OCT) compound, sectioned at a thickness of 35 μm on a cryostat, and used for ISH using standard methods. ISH labeling of brain sections was performed with a digoxigenin-labeled P-Rex1 anti-sense riboprobe complementary to the mouse P-Rex1 cDNA (NM_011416.2). Sequences of primers used for ISH probe preparation were 5′-CCAAAAACAAGTGGTTCGTGT-3′ and 5′-TTGCGAAGCTGTTTGTTCTTG-3′. A sense riboprobe was used as a negative control. All hybridizations were performed on sections from at least two separate mice brains at different developmental stages (postnatal days 14, 21, 30, and 60). Sense control showed no signal. ISH signals were imaged using an Olympus IX-71 microscope under brightfield illumination.

Antibodies.

A P-Rex1–specific mouse monoclonal antibody was generated to a peptide corresponding to a unique sequence (584ESQYFRFHAD593) within mouse P-Rex1 protein. We also used rabbit anti-GFP (Invitrogen), rabbit anti–α-tubulin (Epitomics), mouse anti-Rac1 (Millipore), mouse anti-Cdc42 (Millipore), mouse anti-RhoA (Millipore), rabbit anti–γ-CaMKII (Millipore), rabbit anti-GFAP (Promega), rabbit anti-PSD95 (Cell Signaling), rabbit anti-synaptophysin (Epitomics), rabbit anti-GAPDH (Cell Signaling), mouse anti-neuronal nuclear antigen (NeuN) (Millipore), mouse anti-parvalbumin (Swant), rabbit anti–cut-like homeobox 1 (Cux1) (Santa Cruz), rabbit anti-forkhead box protein P2 (FoxP2) (Sigma), rabbit anti–βIII-tubulin (Cell Signaling), mouse anti-GAD67 (Millipore), mouse anti-vGlut1 (Millipore), rabbit anti-NMDAR1 (Cell Signaling), rabbit anti-NMDAR2A (Millipore), rabbit anti-NMDAR2B (Cell Signaling), rabbit anti-GluR1 (Cell Signaling), mouse anti-GluR2 (Millipore), mouse anti–ß-actin (Santa Cruz), mouse anti-Myc (Santa Cruz), rabbit anti-HA (Cell Signaling), and mouse anti-PP1α (Sigma). For Western blot, HRP- or Alexa Fluor 680/IRDye 800- (Odyssey) conjugated secondary antibodies were used. For immunofluorescence, goat secondary antibodies labeled with Alexa Fluor 488, Alexa Fluor 555, and Alexa Fluor 647 (Invitrogen) were used.

Constructs.

The pcDNA3-Myc-P-Rex1-WT and pcDNA3-EE-P-Rex1-DHdead plasmids were a gift from Heidi Welch. pcDNA3-Myc-P-Rex1-VAFA was mutated by using the Quick Change Lighting Site-Directed Mutagenesis Kit (Stratagene) as previously described (33). Human Rac1 cDNA was amplified and cloned into the pcDNA3.1-Myc-6His plasmid. Then all four constructs were cloned into the pCAGGS-IRES-EGFP vector (a gift from Y. Q. Ding, Tongji University, Shanghai, People’s Republic of China), and expression efficiency was verified by transfection into the HEK293 cell line and immunoblotting with anti-Myc and anti–P-Rex1 antibodies. HA-GluR2 was a gift from Michisuke Yuzaki (Keio University, Tokyo).

Immunocytochemistry.

To determine the cell-type localization of P-Rex1 protein, we fixed dissociated primary neurons for 20 min in 4% (wt/vol) PFA prewarmed in PBS with 4% (wt/vol) sucrose at 37 °C and permeabilized and blocked with 0.3% Triton X-100 and 3% (wt/vol) BSA in PBS for 1 h. Cells then were incubated with antibodies to P-Rex1 (mouse; 1:100) and γ-CaMKII (rabbit; 1:500) or GFAP (rabbit; 1:200) overnight at 4 °C in a humidified chamber. After being washed three times with PBS, primary antibodies were visualized separately with secondary antibodies (antibody to rabbit Alexa Fluor 488 for γ-CaMKII or GFAP at 1:400, antibody to mouse Alexa Fluor 555 for P-Rex1 at 1:400). Images were taken under a Leica TCS SP5 confocal microscope.

Golgi Staining and Sholl Analysis.

Golgi–Cox impregnation was performed using the Hito Golgi–Cox OptimStain Kit (Hitobiotec Inc.). Briefly, brains of Prex1^−/− and WT control mice were immersed immediately in impregnation solution (equal volumes of solutions A and B, containing mercuric chloride, potassium dichromate, and potassium chromate) and were stored at room temperature. The impregnation solution was replaced after 24 h. After 2 wk, brains were transferred to solution C and were stored at 4 °C for 48 h, with the solution replaced after 24 h. The brain was sectioned coronally at 200 μm using a Leica VT1200S microtome, and sections were rinsed twice for 2 min each washing in distilled water and then were placed in a mixture of one part solution D, one part solution E, and two parts distilled water for 10 min. After rinsing with distilled water, sections were dehydrated in 50% (vol/vol), 75%, and 95% ethanol (4 min each) and then were dehydrated further in 100% ethanol two times (4 min each). Sections were cleared in xylene two times (4 min each) and mounted on gelatin-coated microscope slides coverslipped with Permount solution (Fisher Chemical). At least three neurons from the dorsal hippocampus CA1 region per animal were drawn using a camera lucida (Olympus Microscope) by a trained observer who was blinded to the experimental conditions. The total dendritic length and the number of dendritic tips (a measure of branching) were measured and quantified using MetaMorph software. Sholl analysis also was performed with MetaMorph to demonstrate the branching patterns of the neuronal dendritic trees. Briefly, concentric circles with gradually increasing radii centered at the centroid of the cell body were drawn, and the neuron intersects with the circumferences of these circles were counted and plotted.

Subcellular Fractionation and Western Blotting.

Synaptosomal membrane and PSD fractions were prepared from the hippocampus of 6-wk-old mice as previously described (44) with minor modifications. Briefly, the hippocampi from 20 mice were homogenized in 36 mL of homogenization buffer [4 mM Hepes (pH 7.4), 1 mM EGTA, 0.32 M sucrose, and 1 mM PMSF] in a glass Teflon homogenizer. The homogenate was centrifuged at 1,000 × g for 10 min. The supernatant (S1) was collected and centrifuged at 9,200 × g for 15 min, and the resulting crude synaptosomal pellet (P2) was washed twice by resuspension in 24 mL of homogenization buffer and was centrifuged at 10,200 × g for 15 min. The washed P2 pellet was lysed by osmotic shock with ice-cold distilled water, homogenized in a glass Teflon homogenizer, and centrifuged at 25,000 × g for 20 min to yield a supernatant (a crude SV fraction; S3) and a pellet (the lysed synaptosomal membrane fraction, P3). The P3 fraction was resuspended in an appropriate volume of homogenization buffer, loaded onto a discontinuous sucrose density gradient (1.2 M sucrose, 0.8 M sucrose), and centrifuged at 150,000 × g for 1 h. Thereafter the fraction was removed from the interface between 1.2 M sucrose and 0.8 M sucrose and was centrifuged at 150,000 × g for 30 min. The resulting pellet (synaptosomal membrane) was incubated for 15 min in ice-cold 0.5% Triton X-100 and then was centrifuged at 32,000 × g for 20 min to obtain the PSD pellet. The S3 fraction was centrifuged at 165,000 × g for 2 h; the resulting pellet was the SV fraction containing SV proteins. The membranes were incubated with antibodies to P-Rex1 (mouse, 1:1,000), PSD-95 (rabbit, 1:2,000), or synaptophysin (rabbit, 1:4,000) diluted in 5% milk (wt/vol) in PBS.

NMDAR Activation in Hippocampal Slices.

NMDAR activation was performed as previously described (24) with minor revisions. Hippocampal slices (400 μm) were incubated in artificial cerebrospinal fluid for 1 h before NMDA application (100 μM). To measure the change in Rac1 activation and the phosphorylation of GluR1 Ser845, we applied NMDA for 2, 5, and 10 min to slices from the CA1 region of the hippocampus. At the indicated times, slices were added to cold 1× MLB lysis buffer [25 mM Hepes (pH 7.5), 150 mM NaCl, 1% IGEPAL CA-630, 10 mM MgCl2, 1 mM EDTA, and 2% glycerol] to which protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Roche) were added. Slices were homogenized in a Dounce homogenizer before centrifugation at 12,000 × g for 20 min at 4 °C to remove unsolubilized cells and debris. The Rac1-GTP assay was performed as described above. Other samples were subjected directly to SDS/PAGE and Western blotting with antibodies to Rac1 (1:2,000; Millipore), phospho-GluR1 Ser845 (1:1,000; Cell Signaling), and GluR1 (1:1,000; Cell Signaling).

Recombinant LV and Adeno-Associated Virus Production.

For P-Rex1 shRNA knockdown, synthetic oligonucleotides containing the mouse P-Rex1 splice variant (National Center for Biotechnology Information accession no. NM_177782.3) RNA interference target 5′-AAGAACAAACAGCTTCGCAA-3′ was synthesized, annealed, and ligated into the GV118 lentiviral vector (GeneChem) following the U6 promoter. The P-Rex1 shRNA viral supernatant (Lenti-P-Rex1-RNAi) was harvested, filtered, and concentrated as described above. The lentiviral vector containing scrambled shRNA AAACGACTACAAAGTCGACA was used as a negative control. pcDNA-Myc-P-Rex1, used for P-Rex1 overexpression, was a gift from Heidi Welch. The P-Rex1 cDNA was cloned into the pSB1189-FhSyn-GFP plasmid (a gift from Z. L. Qiu, Chinese Academy of Sciences, Shanghai, China) and then was cotransfected with packaging helper plasmids (Invitrogen) into 293T cells. The P-Rex1 viral supernatant was harvested, filtered, and concentrated by OBiotech. The mock viral supernatant (lentivector), without the insert, was prepared similarly. Similarly, for WT Rac1 overexpression, the synthesis of recombinant adeno-associated virus (AAV) vector particles involved inserting the human WT Rac1 cDNA (a gift from Z. Q. Xiong, Chinese Academy of Sciences, Shanghai, China) in the plasmid pAOV-CaMKIIα-EGFP (Neuron Biotech). The pAOV-CaMKIIα-EGFP or pAOV-CaMKIIα-EGFP-WT Rac1 plasmid and the helper plasmid pAAV-RC were propagated in HEK293 cells by calcium phosphate. The details of LV production procedure and titers are as follows. Part 1: Plasmid transfection: (i) 293T cells were cultured at 37 °C and 5% CO₂ in a 15-cm dish by DMEM containing 10% (vol/vol) serum. 293T cells were plated so they were 70–80% confluent at the time of transfection. The health of the cells is very important for transfection and virus production. (ii) The medium was changed to serum-free medium 2 h before transfection. (iii) DNA was diluted (for shRNA LV: 20 μg pGC-LV and 15 μg pHelper) in Opti-MEM medium to a final volume of 2.5 mL and was incubated for 5 min at room temperature. (iv) One hundred microliters of Lipofectamine 2000 was diluted in 2.4 mL Opti-MEM medium and was incubated for 5 min at room temperature. (v) Diluted DNA was added to diluted Lipofectamine 2000 reagent in a 1:1 ratio and was blended gently and incubated for 5 min at room temperature for plasmid DNA–lipid complexes. (vi) DNA–lipid complexes were added to cells. (vii) The culture medium was removed after incubation for 8 h at 37 °C. Cells were washed in 20 mL PBS. (viii) Twenty-five milliliters of culture medium was added and incubated for an additional 48 h. Part 2: virus harvest and concentration. (i) The medium was collected 48 h after transfection. (ii) The medium was filtered using a 0.45-μm filter into a 40-mL centrifugal tube. (iii) The filtrate was centrifuged at 4,000 × g and 4 °C for 10 min to remove the cell debris. (iv) The solution (maximum of 20 mL) was added to a sample filter cup that then was sealed with the supplied cap. The sample filter cup was placed in the filtrate collection cup. (v) The Centricon Plus-20 (Millipore) assembly was placed in the centrifuge bucket and was spun at up to 4,000 × g until the desired concentration was achieved. A typical spin time was 15–40 min, depending on solute type and concentration. The flow rate graph and table give spin-time guidelines. (vi) After the concentration step, the Centricon Plus-20 device was removed from the centrifuge, and the sample filter cup was separated from the filtrate collection cup. If the filtrate was to be retained, the filtrate collection cup was capped and stored appropriately. (vii) The concentrate cup was turned upside down and placed on top of the sample filter cup. (viii) The device was inverted carefully, placed in the centrifuge, and counterbalanced with a similar device. It was spun at no more than 1,000 × g for up to 2 min. (ix) The cup containing the concentrated virus was removed from the sample filter cup. The filter cup was kept inverted during this process. The concentrated virus was removed with a pipette and stored at −80 °C. Part 3: The titer of concentrated virus was tested by the hole dilution method. The titers of concentrated LV in our experiment can reach 2E+9 transducing units/mL.

Electrophysiology.

For input–output recordings, fEPSP slopes were recorded by increasing the stimulation intensity (0.1-ms pulse width) from 0 to 100 μA in 20-μA increments. For the paired pulse ratio, LTP, LTD, and depotentiation, the stimulation intensity was adjusted to give an fEPSP slope of 50% of the maximum. Whole-cell patch-clamp recordings were obtained from pyramidal neurons from the CA1 region of the hippocampus using borosilicate glass pipettes (1.5-mm outer diameter, 0.84-mm inner diameter; World Precision Instruments) pulled with a Brown–Flaming micropipette puller (P-97; Sutter Instruments Company). Pyramidal neurons in the CA1 region were identified under a 600-FN infrared-differential interference contrast microscope (Nikon). For mEPSCs and the NMDA/AMPA ratio, the recording pipettes (3–6 MΩ) were filled with the internal solution containing (in mmol/L): 130 CsMeSO₃, 2.8 NaCl, 5 tetraethylammonium chloride (TEA-Cl), 20 Hepes, 0.4 EGTA, 2.5 MgATP, 0.25 Na₃GTP, and 5 QX-314 (pH 7.2–7.4 with CsOH, 285–295 mOsm). The excitatory mEPSCs were recorded in the presence of 1 μM tetrodotoxin (TTX) and 100 μM picrotoxin (PTX). Pyramidal neurons were voltage-clamped at −60 mV. The mEPSC amplitude and frequency were determined from a 15-min time window. The NMDAR- and AMPAR-mediated current ratio (NMDA/AMPA ratio) was recorded at +40 mV and −60 mV, respectively, in the presence of 100 μM PTX. Each response was repeated 20–30 times with an ITI of 30 s. The AMPAR-mediated EPSCs were estimated by measuring the peak amplitude of the averaged EPSC at −60 mV. The NMDAR-mediated EPSCs were estimated at +40 mV by measuring the amplitude of the averaged EPSC with a 40-ms window beginning 40 ms after the stimulus artifact. For action potential recording, the recording pipettes (3–6 MΩ) were filled with an internal solution containing (in mmol/L) 130 potassium gluconate, 6 NaCl, 20 Hepes, 0.2 EGTA, 1 MgCl2, 2 MgATP, 0.3 Na₃GTP (pH 7.2–7.4 with KOH, 285–295 mOsm). Spikes were induced by current injection from 0 to 400 pA for 1 s in 40-pA increments. The liquid junction potential was not corrected. Series resistance (not compensated) was 10–22 MΩ and was monitored constantly. Neurons with less than 20% change in series resistance were included in the analysis. Experimenters were blinded to the genotype. For whole-cell patch-clamp recording of basal excitability, the recording pipettes (3–6 MΩ) were filled with an internal solution containing (in mmol/L) 130 potassium gluconate, 6 NaCl, 20 Hepes, 0.2 EGTA, 1 MgCl₂, 2 MgATP, 0.3 Na₃GTP (pH 7.2–7.4 with KOH, 285–295 mOsm). All data were recorded using pCLAMP 10 software (Molecular Devices Corp.) and were analyzed by Clampfit 10 software (Molecular Devices). Membrane capacitance, series resistance, and holding current were determined from the pCLAMP 10 readout during recording. Input resistance was measured by the slope of the linear fit of the I–V curve from −200 to 0 pA current injection for 1 s in 40-pA increments. The sag ratio was measured as the ratio of the maximum voltage change to the steady-state voltage change caused by hyperpolarizing current injection (−200 pA for 1 s). Neurons with a <20% change in series resistance were included in the analysis. For the LTD in cerebellum, Parallel Fibers (PFs) were stimulated in the molecular layer by a stimulating electrode made from a pair of twisted Teflon-coated 90% platinum/10% iridium wires. Stimulation was given by using paired-pulse stimuli with a 100-ms interval at 0.033 Hz. The electrodes for Purkinje cell recording (3–6 MΩ resistance) were filled with an internal solution containing (in mmol/L) 130 CsMeSO₃, 2.8 NaCl, 5 TEA-Cl, 20 Hepes, 0.4 EGTA, 2.5 MgATP, 0.25 Na₃GTP, and 5 QX-314 (pH 7.2–7.4 with CsOH, 285–295 mOsm). For Parallel Fiber-Purkinje Cell LTD, while the Purkinje cell was depolarized from −60 to 0 mV for a 60-ms time window, PFs were stimulated at 100 Hz. These paired stimuli were given 30 times at 2-s intervals. Data are presented as mean ± SEM. Unpaired two-tailed Student’s t-tests were used. Signals were acquired with Multiclamp 700B and Digidata 1440A (Molecular Devices). Data were filtered at 2 kHz and sampled at 10–20 kHz.

Primary Neuron Culture and AMPAR Endocytosis.

Hippocampi from embryonic day 16–17 (E16–17) WT or Prex1^−/− mice were cut into small pieces with scissors, treated with 0.25% trypsin-EDTA for 8 min at 37 °C, and dissociated into single cells by gentle trituration. Cells were suspended in DMEM with 20% (vol/vol) FBS and plated on dishes for immunoblotting or on coverslips coated with 1 mg/mL poly-d-lysine (Sigma) for immunocytochemical analyses. Four hours after plating, the medium was changed to Neurobasal medium (Invitrogen) supplemented with B27 (Invitrogen) and l-GlutaMAX (Invitrogen). Subsequently, half of the medium was changed every 3 d. At day in vitro (DIV)18 hippocampal neurons cotransfected with plasmids for HA-GluR2 and either the pCAGGS-IRES-EGFP vector or P-Rex1-WT, P-Rex1-DHdead, P-Rex1-VAFA, or Rac1-WT in the pCAGGS-IRES-EGFP vector were stimulated with 50 μM NMDA for 10 min and fixed in 4% (wt/vol) PFA without permeabilization for 20 min at room temperature. After neurons were washed with PBS and incubated with a blocking solution (3% BSA in PBS), the surface HA-GluR2 was visualized with the anti-HA antibody (1:1,000) and Alexa 555 secondary antibody (1:1,000; Invitrogen). To label the total HA-GluR2, we then permeabilized the neurons, blocked them with a blocking solution containing 0.3% Triton X-100, and incubated them with the anti-HA antibody (1:1,000) and Alexa 647 secondary antibodies (1:1,000). The expression of GFP proteins also was detected by anti-GFP (1:3,000) and Alexa 488 secondary antibody (1:1,000). Fluorescence images were captured by a fluorescence confocal microscope (FV1000; Olympus) and analyzed using FLUOVIEW software (Olympus). Only the transfected neurons with well-developed spines were analyzed. At least two 20-μm segments starting 30–150 μm from the soma were analyzed for each neuron. For statistical analysis of the surface expression level of HA-GluR2, we measured the intensity of Alexa 555 for the surface HA-GluR2 and normalized it to the intensity of Alexa 647 for the total HA-tagged GluR2.

Immunoprecipitation and Western Blotting.

To investigate the NMDA-dependent interaction of endogenous PP1α with P-Rex1, we stimulated hippocampal slices with 100 mM NMDA for 10 min and solubilized them in a lysis buffer [25 mM Hepes (pH 7.5), 150 mM NaCl, 0.1% Triton X-100, 10 mM MgCl2, 1 mM EDTA, and 2% (vol/vol) glycerol] supplemented with protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Roche). PP1α was immunoprecipitated with an anti-PP1α antibody conjugated to Dynabeads Protein G (Life Technologies). Proteins in the immunoprecipitate were blotted with anti-PP1α (1:2,000; Sigma) and anti–P-Rex1 (1:1,000) antibodies.

Virus Injection and Drug Infusion into the CA1 Region.

WT or Prex1^−/− mice were randomly allocated to experimental groups and processed. For virus injection, the mouse was anesthetized with an i.p. injection of pelltobarbitalum natricum (70 mg/kg of body weight), and its head was placed in a stereotactic apparatus. A small craniotomy was performed, and the virus was delivered using a 5-µL syringe with a thin 34-gauge metal needle (Hamilton Instruments). The flow rate (0.1 mL/min) was controlled by an injection pump (KD Scientific). After injection, the needle was left in place for an additional 5 min and then was withdrawn slowly. Virus was microinjected into two sites in the CA1 region (2 µL per site) on the left and right hippocampus [site 1: anterior–posterior (AP) 1.5 mm, medio-lateral (ML) ± 1 mm, dorso-ventral (DV) 1.5 mm from the bregma; site 2: AP 2.5 mm, ML ± 2 mm, DV 1.5 mm from the bregma]. For drug infusion, mice were anesthetized and two cannulae (length: 1 cm, outer diameter: 0.8 mm, internal diameter: 0.5 mm) were placed bilaterally. The stereotactic coordinates for the CA1 region of the dorsal hippocampus were 2 mm (AP), 1.5 mm (ML), and 1.4 mm (DV) from the bregma. After 1 wk of recovery, mice were anesthetized with ethyl ether, and NSC23766 (25 μg/μL, 1 μL per unilateral site) (Tocris), Rac activator (0.1 μg/μL, 1 μL per unilateral site) (Cytoskeleton), and vehicle (0.9% saline) were infused via bilateral cannulae (30-gauge infusion needle) at the indicated time before the mice were placed in the three chambers for the social novelty recognition test.

I.p. Drug Administration.

d-serine at the indicated concentrations (80 mg/mL) (Sigma) diluted in the vehicle solution (0.9% saline) was administered by an i.p. injection in a volume of 0.01 mL/g body weight 30 min before the behavioral tests.

Three-Chamber Sociability and Social Novelty Preference Test.

The three-chamber test for sociability and response to social novelty was performed as previously described (17) with minor modifications. Briefly, 6- to 7-wk-old male animals were used across all tests. Target subjects (stranger 1 and stranger 2) were 6- to 7-wk-old males that had been habituated by being placed inside the grid enclosure for 3 d before the beginning of testing. The social testing arena was a white rectangular, three-chambered box. Each chamber was 20 × 40 × 22 cm in size. Dividing walls were made from Plexiglas, with rectangular openings (5 cm × 8 cm) allowing access into each chamber. The chambers of the arena were cleaned by ethanol between trials. Test mice were habituated to the testing room for at least 30 min before the start of behavioral tasks. The enclosures have an internal diameter of 7 cm and a height of 15 cm; the grid bars are 5 mm in diameter and are 10 mm apart, allowing nose contact through the bars but preventing fighting. During a 5-min habituation period, the test mouse was placed in the middle chamber, the sliding doors were opened, and the mouse was given free access to the entire arena. Each of the two outside chambers contained a grid enclosure. The mouse was recognized by the Ethovision 7.0 video-tracking system (Nodules). The amount of time spent in each chamber and the number of entries into each chamber were recorded. After the habituation period, an unfamiliar mouse (stranger 1) that had had no prior contact with the test mouse was placed in one of the enclosures. The sliding doors were opened, and the test mouse was allowed to explore the entire social test arena for a 10-min session. The amount of time spent in each chamber and the time spent in close interaction (with the nose point within 2 cm of the enclosure) were recorded. Beginning 1 min after the end of the first 10-min session, each mouse was tested in a second 10-min session to quantify social preference for a different stranger. Another unfamiliar mouse (stranger 2) was placed into the previously empty enclosure. The test mouse had a choice between the first, already-investigated mouse (familiar stranger 1), and the novel, unfamiliar mouse (new stranger 2). As described above, the amount of time spent in each chamber and the time spent in close interaction during the second 10-min session were recorded.

Social Recognition Memory Assay in the Three-Chamber Apparatus.

In a 10-min social recognition memory test a littermate was placed in the left or right grid enclosure, and a novel 6-wk-old, male C57BL/6 mouse was placed in the other grid enclosure. The test subject was placed in the center compartment. The amount of time the test mouse spent in each chamber and the time it spent in close interaction were recorded.

Four-Trial Social Memory Assay in the Three-Chamber Apparatus.

The four-trial social memory test described in ref. 16 was modified. In brief, as in the sociability and social novelty preference assays in the three-chamber apparatus, a 6- to 7-wk-old WT or P-Rex1^−/− male mouse was placed in the middle chamber after a 5-min habituation period and was allowed social interaction with an unfamiliar mouse (stranger 1), which was placed in either the left or right grid enclosure for a 10-min trial. After the initial session, the subject mouse was allowed two additional successive 1-min trials of social interaction with the familiar mouse (stranger 1). On the fourth trial, the stranger 1 mouse was replaced by a novel stimulus mouse (stranger 2), and the test mouse was allowed another 10-min trial. The percentage of time spent in close interaction with the stranger was calculated as the time of close interaction with stranger 1/2 divided by total time spent in close interaction with stranger 1/2 and the empty enclosure.

USV.

Each pup was isolated from its dam and littermates and was placed in a small enclosure with a soft plastic surface in a soundproof chamber (temperature, 25 ± 1 °C). Audio recordings lasted 5 min and were conducted every 3 d on postnatal days 3, 6, 9, and 12. Recording hardware (Avisoft UltraSound Gate 116 Hm with a high-quality condenser microphone) and software (Avisoft SASLab Pro Recorder) were from Avisoft Bioacoustics (sampling frequency, 300 kHz; fast Fourier transform length, 1,024 points; 16-bit format).

MWM Assay.

As previously described (45), the MWM consisted of a circular white plastic tank 120 cm in diameter filed with water (21–22 °C) containing nontoxic titanium pigment to obscure the submerged platform. Mice were trained to find the hidden platform (10 cm in diameter). Mice were given four trials per day. At the start of each trial, the mouse was placed gently into the water with its head facing the wall of the pool. The start location varied semirandomly between trials (four different starting locations spaced evenly around the pool). If a mouse did not find the platform within a 60-s trial, it was placed on the platform by the experimenter, remained there for 15 s, and then was removed to a warmed home cage. Training was performed for seven consecutive days, and the latency to the platform was evaluated by EthoVision 8.0 program (Noldus).The probe test with the platform removed from the pool was given for 1 min on day 8 (24 h after the last training session). The percentage of time spent in the four quadrants of the pool and swimming speed were recorded. The next day (day 9), the hidden platform was moved to the opposite quadrant, and the reversal task of the test was started. Mice again received four training trials per day for three additional consecutive days to learn the new location of the platform. A probe test was performed on day 12. During the visible platform training (day 13), the platform location was indicated by a flag rising above the water line that was visible from all areas within the pool.

Contextual Fear Conditioning and Extinction.

The procedures for contextual fear conditioning were similar to those previously described (46). After habituation, the mouse was placed in the box and allowed to explore freely for 2 min before receiving five foot shocks (0.8 mA, 2 s) with intershock intervals of 2 min (MED Associates). The mouse was returned to its home cage 2 min after the final foot shock. Freezing behavior was measured as the amount of time the mouse exhibited freezing behavior during each intershock interval. To study the extinction of contextual fear memory, the mouse was placed in the conditioned fear context 24 h after fear conditioning, and its contextual freezing behavior was measured for 30 min (5 min per block for six blocks) without the administration of any foot shocks.

Repetitive Behaviors.

After 10 min habituation, mice in their home cages with fresh bedding were used to measure the time spent in repetitive behaviors including grooming, digging, and jumping during 10-min intervals (47). Grooming behavior was defined as stroking or scratching of face, head, or body with the two forelimbs or licking body parts. Digging behavior was defined as the behavior in which a mouse coordinately uses two fore legs or hind legs to dig out or displace bedding materials. Jumping was defined as the behavior in which a mouse rears on its hind legs at the corner of the cage or along the side walls and jumps so that the two hind legs are off the ground simultaneously.

Rotarod Test.

Motor coordination was assessed in an accelerating rotarod test (4–40 rpm within 5 min). Briefly, animals were introduced to the apparatus, and the latency to falling was determined. Animals were tested for three trials in a single day with an ITI of 30 min.

Olfaction Test.

As previously described (48), after 24 h food deprivation, the mouse was allowed to acclimate for 5 min to a empty clean cage (30 cm L ×20 cm W ×20 cm H) containing a 3-cm layer of bedding. Then the animal was transferred to another empty clean cage in which a food stimulus (a peanut) was buried ∼1 cm beneath the surface in a random corner. The latency to finding the food was recorded. If the subject failed to find the buried food after 15 min had elapsed, the test was stopped, and the animal’s latency score was recorded as 900 s.

Olfactory Habituation/Dishabituation Test.

The olfactory habitation/dishabituation test was performed as described previously (14). Each test session was conducted in a clean mouse cage containing fresh litter. Odor stimulants were delivered with a cotton-tipped swab through a hole in the center of the cage top positioned 7 cm above the bedding. After 2 min of habituation to a cotton-tipped swab without odor stimulant, subjects were tested individually for the time spent sniffing cotton-tipped swabs. The olfactory cues were designed to present familiar and unfamiliar odors, with and without social valence. Sequences of three identical swabs assayed habituation to the same smell. Switching to different smells on the swabs assayed dishabituation, i.e., recognition that an odor is new. Swabs were dipped in (i) tap water, (ii) almond extract (1:100 dilution; McCormick), (iii) urine of an unfamiliar mouse of the same strain and sex, and (iv) urine of another unfamiliar mouse of the same strain and sex. The order of swab presentation was water, water, water, almond, almond, almond, unfamiliar urine 1, unfamiliar urine 1, unfamiliar urine 1, unfamiliar urine 2, unfamiliar urine 2, unfamiliar urine 2. The time spent sniffing the swab was quantitated with a stopwatch by an observer uninformed about the genotype of the subject mouse. Sniffing was scored when the mouse’s nose was within 2 cm of the cotton swab. Each swab was presented for a 2-min period, with a 1-min interval following the last swab presentation, for a total session length of ∼40 min per mouse.

Open Field Assay.

A clear Plexiglas box (27.5 cm L × 27.5 cm W × 20 cm H; MED Associates) was used for the open field assay. Mice were placed in the center of the chamber at the start of the assay. The distance traveled within 2 h and the time spent in the central and peripheral zones of the open field for first 10 min were recorded as indices of anxiety-like behaviors.

Novel Object Recognition Assay.

The object recognition test was performed in an open field apparatus (60 cm L × 40 cm W × 60 cm H). During the sample phase, the mouse was allowed to explore two identical objects for 20 min. The test phase, in which one of the two objects was replaced with a new one, was performed 1 min later, and the time spent exploring each of the two objects during the next 10 min was measured. Object exploration was defined as each instance in which a mouse’s nose touched the object or was oriented toward the object and came within 2 cm of it.

Dark/Light Box Test.

Mice were habituated in an adjacent room to low-light conditions (∼5 lx), and the test room initially was under similar illumination. Testing was conducted in a two-chamber test apparatus (27.5 cm L × 27.5 cm W × 20 cm H; MED Associates), with one side (the dark chamber) draped in black cloth and the other (the light chamber) illuminated at ∼50 lx with a high-intensity house light. The mouse was placed in the dark chamber, the light chamber was illuminated, and the door between the two chambers was opened. The mouse was allowed to explore the apparatus freely for 5 min. The latency to emerge from the darkened into the lighted chamber and the percentage of time spent in the illuminated chamber were used as indices of anxiety-like behaviors.

Elevated Plus Maze Test.

Individual animals were placed on the central platform facing an open arm of the plus-maze (made of gray Perspex with a central 5 × 5 cm central platform, two open arms of 30 × 5 cm, and two enclosed arms of 30 × 5 × 15 cm, elevated to a height of 60 cm above the floor, with overall illumination at ∼200 lux). Behavior was recorded by an overhead video camera and a computer equipped with the EthoVision 7.1 video-tracking system (Nodules) to calculate the time each animal spent in the open or closed arms. The proportion of time spent in open arms was used for the estimation of anxiety-like behaviors.

Prepulse Inhibition Tests.

A startle reflex measurement system (MED Associate) was used in the prepulse inhibition test. A test session began by placing a mouse in a Plexiglas cylinder where it was left undisturbed for 3 min. White noise with a duration of 40 ms was used as the startle stimulus for all trial types. The startle response was recorded for 300 ms (measuring the response every 1 ms) starting with the onset of the prepulse stimulus. The background noise level in each chamber was 66 dB. The peak startle amplitude recorded during the 180-ms sampling window was used as the dependent variable. A test session consisted of four trial types (i.e., one type for startle stimulus only trials, and three types for prepulse inhibition trials). The intensity of startle stimulus was 110 dB. The prepulse sound was presented 120 ms before the startle stimulus, and its intensity was 70, 74, or 82 dB. Three combinations of prepulse and startle stimuli were used: 70 and 110 dB, 74 and 110 dB, and 82 and 110 dB. Four blocks of the four trial types were presented in pseudorandom order so that each trial type was presented once within a block. The average ITI was 15 s (range: 7–23 s).

Delayed Non-Match to Place T-Maze Task.

The delayed non-match to place T-maze task was performed as previously described (23) with minor modifications. Mice were group housed and food deprived with food provided 2 h/d after the task was completed. The Plexiglas delayed non-match to place T-maze (MED Associates) had a long arm of 63.5 × 10 cm and short left and right arms of 55 × 10 cm. Mice were habituated to the maze with three trials in which they had to collect food pellets from the maze. Mice were tested on four trials per day, each trial consisting of two runs—a forced run and a choice run. At the beginning of the trial both arms were baited. In the forced run the randomly chosen right or left arm was open, and entrance to the other arm was blocked. To start the run the mouse was placed at the long end of the T, and a door was opened. After the mouse collected the pellet from the opened arm, it was placed in a dark transfer cage. The block was removed from the other arm so that both arms were open. To start the choice run the mouse was placed at the long end of the T, and the door was opened again. The choice run was terminated as soon as the mouse reached the end of one arm. A correct choice was scored when in the choice run the mouse visited the alternate arm to the forced run. The delay between forced and choice run was 5 s. The intertrial delay was at least 15 min to avoid proactive interference from the previous trial.

Supplementary Material

Supplementary File

pnas.1512913112.sd01.xls^{(88.5KB, xls)}

Acknowledgments

We thank Prof. Heidi Welch for providing the mouse model and P-Rex1 plasmids and Prof. Michisuke Yuzaki for providing the HA-GluR2 plasmid. This work was supported by Grants 2010CB833905 and 2013CB835103 from Program 973 of the Ministry of Science and Technology of China; by Grants 91232305, 81471360, 81222017, 81471383, 81221002, and 81501183 from the National Natural Science Foundation of China; and by Shenzhen Basic Research Grant JC201104220331A.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1512913112/-/DCSupplemental.

References

1.Volkmar FR, Pauls D. Autism. Lancet. 2003;362(9390):1133–1141. doi: 10.1016/S0140-6736(03)14471-6. [DOI] [PubMed] [Google Scholar]
2.O’Hearn K, Schroer E, Minshew N, Luna B. Lack of developmental improvement on a face memory task during adolescence in autism. Neuropsychologia. 2010;48(13):3955–3960. doi: 10.1016/j.neuropsychologia.2010.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.D’Cruz AM, et al. Reduced behavioral flexibility in autism spectrum disorders. Neuropsychology. 2013;27(2):152–160. doi: 10.1037/a0031721. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Yasuda Y, et al. Cognitive inflexibility in Japanese adolescents and adults with autism spectrum disorders. World J Psychiatry. 2014;4(2):42–48. doi: 10.5498/wjp.v4.i2.42. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Abrahams BS, Geschwind DH. Advances in autism genetics: On the threshold of a new neurobiology. Nat Rev Genet. 2008;9(5):341–355. doi: 10.1038/nrg2346. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Shishido E, Aleksic B, Ozaki N. Copy-number variation in the pathogenesis of autism spectrum disorder. Psychiatry Clin Neurosci. 2014;68(2):85–95. doi: 10.1111/pcn.12128. [DOI] [PubMed] [Google Scholar]
7.Bourgeron T. A synaptic trek to autism. Curr Opin Neurobiol. 2009;19(2):231–234. doi: 10.1016/j.conb.2009.06.003. [DOI] [PubMed] [Google Scholar]
8.Welch HCE, et al. P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Cell. 2002;108(6):809–821. doi: 10.1016/s0092-8674(02)00663-3. [DOI] [PubMed] [Google Scholar]
9.Welch HCE, et al. P-Rex1 regulates neutrophil function. Curr Biol. 2005;15(20):1867–1873. doi: 10.1016/j.cub.2005.09.050. [DOI] [PubMed] [Google Scholar]
10.Lindsay CR, et al. P-Rex1 is required for efficient melanoblast migration and melanoma metastasis. Nat Commun. 2011;2:555. doi: 10.1038/ncomms1560. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Yoshizawa M, et al. Involvement of a Rac activator,P-Rex1, in neurotrophin-derived signaling and neuronal migration. J Neurosci. 2005;25(17):4406–4419. doi: 10.1523/JNEUROSCI.4955-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Waters JE, et al. P-Rex1 - a multidomain protein that regulates neurite differentiation. J Cell Sci. 2008;121(Pt 17):2892–2903. doi: 10.1242/jcs.030353. [DOI] [PubMed] [Google Scholar]
13.Alter MD, et al. Autism and increased paternal age related changes in global levels of gene expression regulation. PLoS One. 2011;6(2):e16715. doi: 10.1371/journal.pone.0016715. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Silverman JL, Yang M, Lord C, Crawley JN. Behavioural phenotyping assays for mouse models of autism. Nat Rev Neurosci. 2010;11(7):490–502. doi: 10.1038/nrn2851. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Moy SS, et al. Sociability and preference for social novelty in five inbred strains: An approach to assess autistic-like behavior in mice. Genes Brain Behav. 2004;3(5):287–302. doi: 10.1111/j.1601-1848.2004.00076.x. [DOI] [PubMed] [Google Scholar]
16.Hitti FL, Siegelbaum SA. The hippocampal CA2 region is essential for social memory. Nature. 2014;508(7494):88–92. doi: 10.1038/nature13028. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Yang L, et al. Hypocretin/orexin neurons contribute to hippocampus-dependent social memory and synaptic plasticity in mice. J Neurosci. 2013;33(12):5275–5284. doi: 10.1523/JNEUROSCI.3200-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Thor DH, Holloway WR. Social memory of the male laboratory rat. J Comp Physiol Psychol. 1982;96(6):1000–1006. [Google Scholar]
19.Ferguson JN, et al. Social amnesia in mice lacking the oxytocin gene. Nat Genet. 2000;25(3):284–288. doi: 10.1038/77040. [DOI] [PubMed] [Google Scholar]
20.Crawley JN. Mouse behavioral assays relevant to the symptoms of autism. Brain Pathol. 2007;17(4):448–459. doi: 10.1111/j.1750-3639.2007.00096.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Donald S, et al. P-Rex2 regulates Purkinje cell dendrite morphology and motor coordination. Proc Natl Acad Sci USA. 2008;105(11):4483–4488. doi: 10.1073/pnas.0712324105. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Kogan JH, Frankland PW, Silva AJ. Long-term memory underlying hippocampus-dependent social recognition in mice. Hippocampus. 2000;10(1):47–56. doi: 10.1002/(SICI)1098-1063(2000)10:1<47::AID-HIPO5>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
23.Nicholls RE, et al. Transgenic mice lacking NMDAR-dependent LTD exhibit deficits in behavioral flexibility. Neuron. 2008;58(1):104–117. doi: 10.1016/j.neuron.2008.01.039. [DOI] [PubMed] [Google Scholar]
24.Kim JI, et al. PI3Kγ is required for NMDA receptor-dependent long-term depression and behavioral flexibility. Nat Neurosci. 2011;14(11):1447–1454. doi: 10.1038/nn.2937. [DOI] [PubMed] [Google Scholar]
25.Dong Z, et al. Hippocampal long-term depression mediates spatial reversal learning in the Morris water maze. Neuropharmacology. 2013;64:65–73. doi: 10.1016/j.neuropharm.2012.06.027. [DOI] [PubMed] [Google Scholar]
26.Bongmba OYN, Martinez LA, Elhardt ME, Butler K, Tejada-Simon MV. Modulation of dendritic spines and synaptic function by Rac1: A possible link to Fragile X syndrome pathology. Brain Res. 2011;1399:79–95. doi: 10.1016/j.brainres.2011.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Martinez LA, Tejada-Simon MV. Pharmacological inactivation of the small GTPase Rac1 impairs long-term plasticity in the mouse hippocampus. Neuropharmacology. 2011;61(1-2):305–312. doi: 10.1016/j.neuropharm.2011.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Benoist M, et al. MAP1B-dependent Rac activation is required for AMPA receptor endocytosis during long-term depression. EMBO J. 2013;32(16):2287–2299. doi: 10.1038/emboj.2013.166. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Lee HK, Kameyama K, Huganir RL, Bear MF. NMDA induces long-term synaptic depression and dephosphorylation of the GluR1 subunit of AMPA receptors in hippocampus. Neuron. 1998;21(5):1151–1162. doi: 10.1016/s0896-6273(00)80632-7. [DOI] [PubMed] [Google Scholar]
30.Beattie EC, et al. Regulation of AMPA receptor endocytosis by a signaling mechanism shared with LTD. Nat Neurosci. 2000;3(12):1291–1300. doi: 10.1038/81823. [DOI] [PubMed] [Google Scholar]
31.Morishita W, et al. Regulation of synaptic strength by protein phosphatase 1. Neuron. 2001;32(6):1133–1148. doi: 10.1016/s0896-6273(01)00554-2. [DOI] [PubMed] [Google Scholar]
32.Unoki T, et al. NMDA receptor-mediated PIP5K activation to produce PI(4,5)P2 is essential for AMPA receptor endocytosis during LTD. Neuron. 2012;73(1):135–148. doi: 10.1016/j.neuron.2011.09.034. [DOI] [PubMed] [Google Scholar]
33.Barber MA, et al. The guanine-nucleotide-exchange factor P-Rex1 is activated by protein phosphatase 1α. Biochem J. 2012;443(1):173–183. doi: 10.1042/BJ20112078. [DOI] [PubMed] [Google Scholar]
34.Hill K, et al. Regulation of P-Rex1 by phosphatidylinositol (3,4,5)-trisphosphate and Gbetagamma subunits. J Biol Chem. 2005;280(6):4166–4173. doi: 10.1074/jbc.M411262200. [DOI] [PubMed] [Google Scholar]
35.Collingridge GL, Peineau S, Howland JG, Wang YT. Long-term depression in the CNS. Nat Rev Neurosci. 2010;11(7):459–473. doi: 10.1038/nrn2867. [DOI] [PubMed] [Google Scholar]
36.Schopler E, Reichler RJ, DeVellis RF, Daly K. Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS) J Autism Dev Disord. 1980;10(1):91–103. doi: 10.1007/BF02408436. [DOI] [PubMed] [Google Scholar]
37.Krug DA, Arick J, Almond P. Behavior checklist for identifying severely handicapped individuals with high levels of autistic behavior. J Child Psychol Psychiatry. 1980;21(3):221–229. doi: 10.1111/j.1469-7610.1980.tb01797.x. [DOI] [PubMed] [Google Scholar]
38.Jurinke C, van den Boom D, Cantor CR, Köster H. The use of MassARRAY technology for high throughput genotyping. Adv Biochem Eng Biotechnol. 2002;77:57–74. doi: 10.1007/3-540-45713-5_4. [DOI] [PubMed] [Google Scholar]
39.Storm N, Darnhofer-Patel B, van den Boom D, Rodi CP. MALDI-TOF mass spectrometry-based SNP genotyping. Methods Mol Biol. 2003;212:241–262. doi: 10.1385/1-59259-327-5:241. [DOI] [PubMed] [Google Scholar]
40.O’Connell JR, Weeks DE. PedCheck: A program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet. 1998;63(1):259–266. doi: 10.1086/301904. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Rabinowitz D, Laird N. A unified approach to adjusting association tests for population admixture with arbitrary pedigree structure and arbitrary missing marker information. Hum Hered. 2000;50(4):211–223. doi: 10.1159/000022918. [DOI] [PubMed] [Google Scholar]
42.Du R, et al. Efficient typing of copy number variations in a segmental duplication-mediated rearrangement hotspot using multiplex competitive amplification. J Hum Genet. 2012;57(8):545–551. doi: 10.1038/jhg.2012.66. [DOI] [PubMed] [Google Scholar]
43.Liu Y, et al. Lack of association between NLGN3, NLGN4, SHANK2 and SHANK3 gene variants and autism spectrum disorder in a Chinese population. PLoS One. 2013;8(2):e56639. doi: 10.1371/journal.pone.0056639. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Inagaki S, et al. Sema4c, a transmembrane semaphorin, interacts with a post-synaptic density protein, PSD-95. J Biol Chem. 2001;276(12):9174–9181. doi: 10.1074/jbc.M009051200. [DOI] [PubMed] [Google Scholar]
45.Vorhees CV, Williams MT. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat Protoc. 2006;1(2):848–858. doi: 10.1038/nprot.2006.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Dai JX, et al. Enhanced contextual fear memory in central serotonin-deficient mice. Proc Natl Acad Sci USA. 2008;105(33):11981–11986. doi: 10.1073/pnas.0801329105. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Ryan BC, Young NB, Crawley JN, Bodfish JW, Moy SS. Social deficits, stereotypy and early emergence of repetitive behavior in the C58/J inbred mouse strain. Behav Brain Res. 2010;208(1):178–188. doi: 10.1016/j.bbr.2009.11.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Yang M, Crawley JN. 2009. Simple behavioral assessment of mouse olfaction. Curr Protoc Neurosci Chapter 8:Unit 8:24.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File

pnas.1512913112.sd01.xls^{(88.5KB, xls)}

[r1] 1.Volkmar FR, Pauls D. Autism. Lancet. 2003;362(9390):1133–1141. doi: 10.1016/S0140-6736(03)14471-6. [DOI] [PubMed] [Google Scholar]

[r2] 2.O’Hearn K, Schroer E, Minshew N, Luna B. Lack of developmental improvement on a face memory task during adolescence in autism. Neuropsychologia. 2010;48(13):3955–3960. doi: 10.1016/j.neuropsychologia.2010.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r3] 3.D’Cruz AM, et al. Reduced behavioral flexibility in autism spectrum disorders. Neuropsychology. 2013;27(2):152–160. doi: 10.1037/a0031721. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r4] 4.Yasuda Y, et al. Cognitive inflexibility in Japanese adolescents and adults with autism spectrum disorders. World J Psychiatry. 2014;4(2):42–48. doi: 10.5498/wjp.v4.i2.42. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r5] 5.Abrahams BS, Geschwind DH. Advances in autism genetics: On the threshold of a new neurobiology. Nat Rev Genet. 2008;9(5):341–355. doi: 10.1038/nrg2346. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r6] 6.Shishido E, Aleksic B, Ozaki N. Copy-number variation in the pathogenesis of autism spectrum disorder. Psychiatry Clin Neurosci. 2014;68(2):85–95. doi: 10.1111/pcn.12128. [DOI] [PubMed] [Google Scholar]

[r7] 7.Bourgeron T. A synaptic trek to autism. Curr Opin Neurobiol. 2009;19(2):231–234. doi: 10.1016/j.conb.2009.06.003. [DOI] [PubMed] [Google Scholar]

[r8] 8.Welch HCE, et al. P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Cell. 2002;108(6):809–821. doi: 10.1016/s0092-8674(02)00663-3. [DOI] [PubMed] [Google Scholar]

[r9] 9.Welch HCE, et al. P-Rex1 regulates neutrophil function. Curr Biol. 2005;15(20):1867–1873. doi: 10.1016/j.cub.2005.09.050. [DOI] [PubMed] [Google Scholar]

[r10] 10.Lindsay CR, et al. P-Rex1 is required for efficient melanoblast migration and melanoma metastasis. Nat Commun. 2011;2:555. doi: 10.1038/ncomms1560. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r11] 11.Yoshizawa M, et al. Involvement of a Rac activator,P-Rex1, in neurotrophin-derived signaling and neuronal migration. J Neurosci. 2005;25(17):4406–4419. doi: 10.1523/JNEUROSCI.4955-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r12] 12.Waters JE, et al. P-Rex1 - a multidomain protein that regulates neurite differentiation. J Cell Sci. 2008;121(Pt 17):2892–2903. doi: 10.1242/jcs.030353. [DOI] [PubMed] [Google Scholar]

[r13] 13.Alter MD, et al. Autism and increased paternal age related changes in global levels of gene expression regulation. PLoS One. 2011;6(2):e16715. doi: 10.1371/journal.pone.0016715. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r14] 14.Silverman JL, Yang M, Lord C, Crawley JN. Behavioural phenotyping assays for mouse models of autism. Nat Rev Neurosci. 2010;11(7):490–502. doi: 10.1038/nrn2851. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r15] 15.Moy SS, et al. Sociability and preference for social novelty in five inbred strains: An approach to assess autistic-like behavior in mice. Genes Brain Behav. 2004;3(5):287–302. doi: 10.1111/j.1601-1848.2004.00076.x. [DOI] [PubMed] [Google Scholar]

[r16] 16.Hitti FL, Siegelbaum SA. The hippocampal CA2 region is essential for social memory. Nature. 2014;508(7494):88–92. doi: 10.1038/nature13028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] 17.Yang L, et al. Hypocretin/orexin neurons contribute to hippocampus-dependent social memory and synaptic plasticity in mice. J Neurosci. 2013;33(12):5275–5284. doi: 10.1523/JNEUROSCI.3200-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r18] 18.Thor DH, Holloway WR. Social memory of the male laboratory rat. J Comp Physiol Psychol. 1982;96(6):1000–1006. [Google Scholar]

[r19] 19.Ferguson JN, et al. Social amnesia in mice lacking the oxytocin gene. Nat Genet. 2000;25(3):284–288. doi: 10.1038/77040. [DOI] [PubMed] [Google Scholar]

[r20] 20.Crawley JN. Mouse behavioral assays relevant to the symptoms of autism. Brain Pathol. 2007;17(4):448–459. doi: 10.1111/j.1750-3639.2007.00096.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r21] 21.Donald S, et al. P-Rex2 regulates Purkinje cell dendrite morphology and motor coordination. Proc Natl Acad Sci USA. 2008;105(11):4483–4488. doi: 10.1073/pnas.0712324105. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r22] 22.Kogan JH, Frankland PW, Silva AJ. Long-term memory underlying hippocampus-dependent social recognition in mice. Hippocampus. 2000;10(1):47–56. doi: 10.1002/(SICI)1098-1063(2000)10:1<47::AID-HIPO5>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]

[r23] 23.Nicholls RE, et al. Transgenic mice lacking NMDAR-dependent LTD exhibit deficits in behavioral flexibility. Neuron. 2008;58(1):104–117. doi: 10.1016/j.neuron.2008.01.039. [DOI] [PubMed] [Google Scholar]

[r24] 24.Kim JI, et al. PI3Kγ is required for NMDA receptor-dependent long-term depression and behavioral flexibility. Nat Neurosci. 2011;14(11):1447–1454. doi: 10.1038/nn.2937. [DOI] [PubMed] [Google Scholar]

[r25] 25.Dong Z, et al. Hippocampal long-term depression mediates spatial reversal learning in the Morris water maze. Neuropharmacology. 2013;64:65–73. doi: 10.1016/j.neuropharm.2012.06.027. [DOI] [PubMed] [Google Scholar]

[r26] 26.Bongmba OYN, Martinez LA, Elhardt ME, Butler K, Tejada-Simon MV. Modulation of dendritic spines and synaptic function by Rac1: A possible link to Fragile X syndrome pathology. Brain Res. 2011;1399:79–95. doi: 10.1016/j.brainres.2011.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r27] 27.Martinez LA, Tejada-Simon MV. Pharmacological inactivation of the small GTPase Rac1 impairs long-term plasticity in the mouse hippocampus. Neuropharmacology. 2011;61(1-2):305–312. doi: 10.1016/j.neuropharm.2011.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r28] 28.Benoist M, et al. MAP1B-dependent Rac activation is required for AMPA receptor endocytosis during long-term depression. EMBO J. 2013;32(16):2287–2299. doi: 10.1038/emboj.2013.166. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r29] 29.Lee HK, Kameyama K, Huganir RL, Bear MF. NMDA induces long-term synaptic depression and dephosphorylation of the GluR1 subunit of AMPA receptors in hippocampus. Neuron. 1998;21(5):1151–1162. doi: 10.1016/s0896-6273(00)80632-7. [DOI] [PubMed] [Google Scholar]

[r30] 30.Beattie EC, et al. Regulation of AMPA receptor endocytosis by a signaling mechanism shared with LTD. Nat Neurosci. 2000;3(12):1291–1300. doi: 10.1038/81823. [DOI] [PubMed] [Google Scholar]

[r31] 31.Morishita W, et al. Regulation of synaptic strength by protein phosphatase 1. Neuron. 2001;32(6):1133–1148. doi: 10.1016/s0896-6273(01)00554-2. [DOI] [PubMed] [Google Scholar]

[r32] 32.Unoki T, et al. NMDA receptor-mediated PIP5K activation to produce PI(4,5)P2 is essential for AMPA receptor endocytosis during LTD. Neuron. 2012;73(1):135–148. doi: 10.1016/j.neuron.2011.09.034. [DOI] [PubMed] [Google Scholar]

[r33] 33.Barber MA, et al. The guanine-nucleotide-exchange factor P-Rex1 is activated by protein phosphatase 1α. Biochem J. 2012;443(1):173–183. doi: 10.1042/BJ20112078. [DOI] [PubMed] [Google Scholar]

[r34] 34.Hill K, et al. Regulation of P-Rex1 by phosphatidylinositol (3,4,5)-trisphosphate and Gbetagamma subunits. J Biol Chem. 2005;280(6):4166–4173. doi: 10.1074/jbc.M411262200. [DOI] [PubMed] [Google Scholar]

[r35] 35.Collingridge GL, Peineau S, Howland JG, Wang YT. Long-term depression in the CNS. Nat Rev Neurosci. 2010;11(7):459–473. doi: 10.1038/nrn2867. [DOI] [PubMed] [Google Scholar]

[r36] 36.Schopler E, Reichler RJ, DeVellis RF, Daly K. Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS) J Autism Dev Disord. 1980;10(1):91–103. doi: 10.1007/BF02408436. [DOI] [PubMed] [Google Scholar]

[r37] 37.Krug DA, Arick J, Almond P. Behavior checklist for identifying severely handicapped individuals with high levels of autistic behavior. J Child Psychol Psychiatry. 1980;21(3):221–229. doi: 10.1111/j.1469-7610.1980.tb01797.x. [DOI] [PubMed] [Google Scholar]

[r38] 38.Jurinke C, van den Boom D, Cantor CR, Köster H. The use of MassARRAY technology for high throughput genotyping. Adv Biochem Eng Biotechnol. 2002;77:57–74. doi: 10.1007/3-540-45713-5_4. [DOI] [PubMed] [Google Scholar]

[r39] 39.Storm N, Darnhofer-Patel B, van den Boom D, Rodi CP. MALDI-TOF mass spectrometry-based SNP genotyping. Methods Mol Biol. 2003;212:241–262. doi: 10.1385/1-59259-327-5:241. [DOI] [PubMed] [Google Scholar]

[r40] 40.O’Connell JR, Weeks DE. PedCheck: A program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet. 1998;63(1):259–266. doi: 10.1086/301904. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r41] 41.Rabinowitz D, Laird N. A unified approach to adjusting association tests for population admixture with arbitrary pedigree structure and arbitrary missing marker information. Hum Hered. 2000;50(4):211–223. doi: 10.1159/000022918. [DOI] [PubMed] [Google Scholar]

[r42] 42.Du R, et al. Efficient typing of copy number variations in a segmental duplication-mediated rearrangement hotspot using multiplex competitive amplification. J Hum Genet. 2012;57(8):545–551. doi: 10.1038/jhg.2012.66. [DOI] [PubMed] [Google Scholar]

[r43] 43.Liu Y, et al. Lack of association between NLGN3, NLGN4, SHANK2 and SHANK3 gene variants and autism spectrum disorder in a Chinese population. PLoS One. 2013;8(2):e56639. doi: 10.1371/journal.pone.0056639. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r44] 44.Inagaki S, et al. Sema4c, a transmembrane semaphorin, interacts with a post-synaptic density protein, PSD-95. J Biol Chem. 2001;276(12):9174–9181. doi: 10.1074/jbc.M009051200. [DOI] [PubMed] [Google Scholar]

[r45] 45.Vorhees CV, Williams MT. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat Protoc. 2006;1(2):848–858. doi: 10.1038/nprot.2006.116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r46] 46.Dai JX, et al. Enhanced contextual fear memory in central serotonin-deficient mice. Proc Natl Acad Sci USA. 2008;105(33):11981–11986. doi: 10.1073/pnas.0801329105. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r47] 47.Ryan BC, Young NB, Crawley JN, Bodfish JW, Moy SS. Social deficits, stereotypy and early emergence of repetitive behavior in the C58/J inbred mouse strain. Behav Brain Res. 2010;208(1):178–188. doi: 10.1016/j.bbr.2009.11.031. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r48] 48.Yang M, Crawley JN. 2009. Simple behavioral assessment of mouse olfaction. Curr Protoc Neurosci Chapter 8:Unit 8:24.

PERMALINK

Synaptic P-Rex1 signaling regulates hippocampal long-term depression and autism-like social behavior

Jun Li

Anping Chai

Lifang Wang

Yuanlin Ma

Zhiliu Wu

Hao Yu

Liwei Mei

Lin Lu

Chen Zhang

Weihua Yue

Lin Xu

Yi Rao

Dai Zhang

Series information

Significance

Abstract

Results

Association of PREX1 with Autism and Its Copy Number Deletion in Autistic People.

Table S1.

Fig. 1.

Table S2.

Fig. S1.

Prex1−/− Mice Exhibit Autism-Like Behaviors.

Fig. S2.

Fig. 2.

Fig. S3.

Fig. 3.

Down-Regulation of P-Rex1–Rac1 Signaling in the CA1 Region of the Hippocampus Impairs Social Recognition Behavior.

Fig. S4.

Fig. 4.

Fig. 5.

Fig. S5.

NMDAR-Dependent LTD Is Selectively Impaired in Prex1−/− Mice.

Fig. S6.

Fig. 6.

PP1α Interaction with P-Rex1 and P-Rex1–Mediated Rac1 Activation Are Essential for NMDA-Induced AMPAR Endocytosis.

Fig. S7.

Fig. S8.

Fig. 7.

Recovery of NMDAR-Dependent LTD Impairment and Social Recognition in Prex1−/− Mice.

Fig. 8.

Fig. 9.

Discussion

Materials and Methods

Subjects.

Mouse Strains.

Animal Experiments.

Electrophysiology.

Rac1, Cdc42, and RhoA-GTP Assays.

Statistical Analysis.

SI Materials and Methods

Genotyping and Genetic Statistical Analyses.

Detection of Copy Number.

ISH.

Antibodies.

Constructs.

Immunocytochemistry.

Golgi Staining and Sholl Analysis.

Subcellular Fractionation and Western Blotting.

NMDAR Activation in Hippocampal Slices.

Recombinant LV and Adeno-Associated Virus Production.

Electrophysiology.

Primary Neuron Culture and AMPAR Endocytosis.

Immunoprecipitation and Western Blotting.

Virus Injection and Drug Infusion into the CA1 Region.

I.p. Drug Administration.

Three-Chamber Sociability and Social Novelty Preference Test.

Social Recognition Memory Assay in the Three-Chamber Apparatus.

Four-Trial Social Memory Assay in the Three-Chamber Apparatus.

USV.

MWM Assay.

Contextual Fear Conditioning and Extinction.

Repetitive Behaviors.

Rotarod Test.

Olfaction Test.

Olfactory Habituation/Dishabituation Test.

Open Field Assay.

Novel Object Recognition Assay.

Prex1^−/− Mice Exhibit Autism-Like Behaviors.

NMDAR-Dependent LTD Is Selectively Impaired in Prex1^−/− Mice.

Recovery of NMDAR-Dependent LTD Impairment and Social Recognition in Prex1^−/− Mice.