Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Dec 14;112(52):15988–15993. doi: 10.1073/pnas.1521740112

Ezh2 regulates differentiation and function of natural killer cells through histone methyltransferase activity

Jie Yin a,1, Jianmei W Leavenworth b,c,1,2, Yang Li a, Qi Luo a,d, Huafeng Xie e,f,g, Xinhua Liu h, Shan Huang a, Han Yan a, Zheng Fu i, Liyun Y Zhang j, Litao Zhang k, Junwei Hao l, Xudong Wu m, Xianming Deng n, Charles W M Roberts f,g,o, Stuart H Orkin e,f,g,o,p, Harvey Cantor b,c,2, Xi Wang a,2
PMCID: PMC4702963  PMID: 26668377

Significance

How NK cell development diverges from T/B cell commitment at the common lymphoid progenitor stage is poorly understood. Histone modification near critical gene loci often influences lineage determination. Ezh2 is a histone methyltransferase frequently associated with gene repression. Here we observed that Ezh2-null hematopoietic stem and progenitor cells (HSPCs) or HSPCs treated with Ezh2 inhibitors gave rise to increased NK precursors and mature progeny that display enhanced cytotoxicity against tumor cells. The latter effects were associated with up-regulation of IL-15R (CD122) and the NKG2D-activating receptor. These findings may provide insight into the contribution of epigenetic regulation to the genesis of NK cells and suggest that Ezh2 inhibitors may inhibit tumor growth directly and indirectly through mobilization of NK cells.

Keywords: epigenetic regulation, NKG2D, hematopoietic stem and progenitor cells, histone modification, innate immunity

Abstract

Changes of histone modification status at critical lineage-specifying gene loci in multipotent precursors can influence cell fate commitment. The contribution of these epigenetic mechanisms to natural killer (NK) cell lineage determination from common lymphoid precursors is not understood. Here we investigate the impact of histone methylation repressive marks (H3 Lys27 trimethylation; H3K27me3) on early NK cell differentiation. We demonstrate that selective loss of the histone-lysine N-methyltransferase Ezh2 (enhancer of zeste homolog 2) or inhibition of its enzymatic activity with small molecules unexpectedly increased generation of the IL-15 receptor (IL-15R) CD122+ NK precursors and mature NK progeny from both mouse and human hematopoietic stem and progenitor cells. Mechanistic studies revealed that enhanced NK cell expansion and cytotoxicity against tumor cells were associated with up-regulation of CD122 and the C-type lectin receptor NKG2D. Moreover, NKG2D deficiency diminished the positive effects of Ezh2 inhibitors on NK cell commitment. Identification of the contribution of Ezh2 to NK lineage specification and function reveals an epigenetic-based mechanism that regulates NK cell development and provides insight into the clinical application of Ezh2 inhibitors in NK-based cancer immunotherapies.


Natural killer (NK) cells play a critical role in immune surveillance against infection and transformation (1–4) and express germ-line–encoded receptors that interact with “stressed” or “missing-self” ligands on target cells upon cellular stress (5). Altered NK cell numbers or function have a profound impact on overall immune status and often correlate with cancer prognosis (6, 7). NK cell-based immunotherapy against both hematopoietic and solid tumors (8, 9) is under active clinical study and has shown reduced relapse and improved prognosis in many aggressive cancers (10, 11). Increased understanding of NK cell biology is required to improve the efficacy of these therapeutic approaches.

NK cells in bone marrow (BM) develop from NK precursors (NKp) from common lymphoid progenitors (CLP) (12). Functionally mature NK cells must undergo an education process that requires signals from germ-line–encoded and cytokine receptors, often leading to regulation of multiple transcription factors (TFs) (13). Evidence from IL-15 or IL-15 receptor (R) knockout mice has underscored the critical role of the IL-15R signaling pathway in NK cell development (14), which regulates the transcriptional activity of Id2, Tox, and Ets-1 for generation of NK cell precursors; E4bp4, T-bet, and Eomes for development of immature NK cells from NKp; and Helios, Runx3, and Blimp1 for NK cell maturation (15). Although the action of a single TF in regulation of NK cell development is well understood, the genetic and epigenetic regulatory networks that coordinate the action of multiple TFs in NK cell-fate determination and function remain largely unexplored.

Cell commitment from a multipotent precursor requires activation of lineage-specifying regulatory genes and repression of genes leading to alternative fates. This process depends on lineage-specific TFs and epigenetic regulators that coordinately determine genome-wide expression patterns in precursors. It is hypothesized that the simultaneous presence of bivalent methylation of histone H3, active modification (H3K4me3) and suppressive modification (H3K27me3), at regulatory elements keeps lineage-specific gene expression poised to switch on or off during lineage commitment (16). Removal of H3K27me3 leads to transcriptional activation.

The H3K27 methyltransferase Ezh2 (enhancer of zeste homolog 2) is a crucial regulator of cell-fate determination and plays an essential role in many biological processes and immune regulation (17). Ezh2 may regulate early B-cell development (18) and differentiative plasticity of CD4+ Th1 and Th2 cells, as well as maintenance of Treg cell identity (19). Whether Ezh2 expression influences lineage commitment of lymphocyte subsets from their common progenitors is unclear. Here, we have investigated its contribution to NK cell lineage commitment and function to dissect regulatory mechanisms of NK cell development. We found that inactivation of Ezh2 or inhibition of Ezh2 enzymatic activity through conditional knockout mice and small molecule inhibitors, respectively, enhanced NK cell lineage commitment and promoted increased NK cell survival and NKG2D-mediated cytotoxicity.

Results

Increased NK Lineage Cells in Ezh2-Deficient Mice.

To investigate the contribution of Ezh2 to regulation of de novo lymphocyte development, we crossed Ezh2fl/fl mice with transgenic Vav-Cre mice to delete Ezh2 from hematopoietic stem and progenitor cells (HSPCs) and downstream progeny (Fig. S1A). Consistent with previous studies (18, 19), substantially reduced frequency and numbers of T and B cells in spleens from Vav1-Cre, Ezh2fl/fl (hereafter Ezh2−/−) mice were observed compared with control Ezh2+/+ mice (hereafter “WT”) (Fig. 1 A and B). In contrast, the numbers and frequency of NK cells [T-cell receptor beta (TCRβ)− natural cytotoxicity-triggering receptor (NKp46+)] (20) increased more than twofold in spleen, liver, and BM of Ezh2−/− mice (Fig. 1 A and C), suggesting that loss of Ezh2 may be associated with improved NK cell development.

Fig. S1.

Fig. S1.

Ezh2 expression during NK cell development. (A) Schematic presentation of the developmental stages of mouse NK cells, marked by a series of surface receptors as indicated: “+”, “−”, “high,” and “low” indicate expression levels of each receptor. CLP, common lymphoid progenitor; iNK, immature NK cells; mNK, mature NK cells; NKp, NK cell precursor. The Vav-Cre transgene is expressed starting from the HSPC stage. (B) qRT-PCR analysis of Ezh2 mRNA levels expressed by the indicated subsets sorted from C57BL/6 BM. Ezh2 expression was normalized to that of the Hprt control and results are presented relative to that of HSPC, set as 1.

Fig. 1.

Fig. 1.

Increased NK lineage cells in Ezh2-deficient mice. (A) Flow cytometry of cells from each organ of WT and Ezh2−/− mice. Gated numbers indicate percent T cells (TCRβ+NKp46–), NK cells (TCRβ−NKp46+) and B cells (B220+). Frequency and numbers of splenic T and B cells (B) and NK cells (C) from the indicated organs in A. (D) Frequency and numbers of NKp cells (Lin−CD122+) in spleen and BM of WT and Ezh2−/− mice. (E) CD122 expression on Lin− cells from spleen and BM of WT and Ezh2−/− mice. n = 3–4 mice per group. *P < 0.05, **P < 0.01, and ***P < 0.001 (error bars, mean ± SEM). Data are representative of at least three independent experiments. LV, liver; SP, spleen.

The occurrence of NKp cells during NK cell development reflects the fate decision of the NK cell lineage, but not T or B cells from CLPs (Fig. S1A). Analysis of Ezh2 mRNA expression in HSPC, CLP, NKp, and mature NK cells isolated from WT C57BL/6 mice showed substantial down-regulation of Ezh2 upon NK cell maturation (Fig. S1B). Robust Ezh2 expression in NKp cells suggests possible involvement of Ezh2 in regulation of NK cell lineage commitment.

Analysis of NKp (Lin− CD122+) cells revealed substantially increased numbers and frequency in BM and spleens from Ezh2−/−compared with WT mice (Fig. 1D). Moreover, Ezh2 deficiency greatly enhanced CD122 expression at the single-cell level (Fig. 1E), suggesting that Ezh2 deletion from HSPCs and downstream progeny enhanced NK cell commitment, possibly accounting for increased NK cell numbers as shown above. Although Ezh2 deletion also led to phenotypic changes in NK cells (Fig. S2), our analysis focused on the impact of Ezh2 expression on early NK cell fate.

Fig. S2.

Fig. S2.

Phenotypic analysis of NK cells from Ezh2+/+ and Vav-Cre, Ezh2fl/fl mice. Flow cytometry of NK cells (NKp46+TCRβ−CD19−) from spleen and BM of indicated strains. Histogram overlays of DX5, CD11b, KLRG1, and CD27 levels are shown. Data represent three independent experiments.

Increased NKp cell numbers in Ezh2−/− mice may reflect enhanced proliferation, diminished apoptosis, or both. Ezh2 deletion did not affect proliferation of NK subsets at various developmental stages (Fig. S3 A–C). However, Ezh2−/− NKp cells and committed NK subsets expressed significantly lower levels of Annexin V (Fig. S3D). We failed to observe a survival defect before the NKp stage in the absence of Ezh2 (Fig. S3D). Taken together, these results suggest that Ezh2 loss enhances NK cell lineage commitment and further development, at least in part, by promoting NKp cell survival.

Fig. S3.

Fig. S3.

Ezh2 deletion attenuates apoptosis of NKp cells and their NK progeny. (A) Gating strategy for HSPC (a, Lin−Sca-1+CD117hi), CLP (b, Lin−Sca-1+CD117medCD127+CD135+), Prepro NKa (c, Lin−Sca-1+CD117medCD127+CD135−), Prepro NKb (d, Lin−Sca-1+CD117−CD127+CD135−). (B) Gating strategy for NKp (e, Lin−CD122+NK1.1−DX5−) and other NK subsets at different developmental stages (f, Lin−CD122+NK1.1+DX5−; g, Lin−CD122+NK1.1+DX5−NKp46+; h, Lin−CD122+NK1.1+DX5+). (C) Flow cytometry of BM NK subsets from WT and Ezh2−/− mice. Histogram overlays of Ki67 expression and frequency of Ki67+ cells (Right) in each NK subset in A and B. (D) Histogram overlays of Annexin V expression and frequency of Annexin V+ cells (Right) in each NK subset in A and B. The gating bars define the Ki67+ (C) or Annexin V+ (D) cells, respectively. Definition of CLP, prepro NKa, and prepro NKb subsets was described previously (40).

Ezh2-Deficiency Enhances NK Lineage Commitment Intrinsically.

Loss of Ezh2 perturbs many aspects of hematopoiesis (Fig. 1 A and B), which may indirectly influence NK cell development. To determine whether the effects on NK development reflect a cell-intrinsic role of Ezh2, we used a stromal cell-free culture system that supports NK cell development from HSPCs (21). We transduced FACS-sorted Lin−Sca-1+c-Kit+ BM HSPCs from Ezh2fl/fl mice with retrovirus-expressing YFP-Cre or YFP only, followed by induction of NK cell development in vitro (Fig. 2A). Analysis of NK cell development showed that Ezh2 deletion in YFP+ cells because of Cre-mediated recombination induced ∼12% of cells to express CD122 and NKp46 at day 5, earlier than expected for normal NKp induction, as shown for YFP− and control cells expressing YFP alone (<2.5%) (Fig. 2B). Earlier NK lineage commitment subsequently led to production of ∼fivefold more DX5+ mature NK cells at day 9 (Fig. 2B). Thus, these results recapitulated the in vivo phenotype of Ezh2−/− mice, supporting an intrinsic role of Ezh2 loss in regulation of NK cell development.

Fig. 2.

Fig. 2.

Ezh2 deletion promotes NK cell development in vitro. (A) Schematic of in vitro mouse NK cell differentiation using a two-step cell culture system described in Materials and Methods. Ezh2fl/fl HSPCs were infected with retrovirus expressing YFP-Cre to delete Ezh2 or control virus expressing YFP only. (B) Flow cytometry of developing NK cells in A. Gated numbers indicate percent CD3−NKp46+CD122+ cells at day 5 (Left) or CD3−NKp46+DX5+ cells at day 9 (Right). YFP+: Ezh2-deleted; YFP−: Ezh2-intact control. Data represent three independent experiments.

Selective Inhibition of Ezh2 Activity Promotes NK Cell Development.

Polycomb repressive complexes (PRCs), including PRC1 and PRC2, are composed of polycomb group proteins that contribute to epigenetic silencing by modifying histones and other proteins (22). Ezh2 lies within the PRC1/2 complex and confers gene silencing by trimethylating histone H3 at lysine 27. To directly analyze the contribution of Ezh2 methyltransferase activity to regulation of NK cell development, we used small-molecule inhibitors UNC1999 and EPZ005687 (23, 24) to examine the effect of inhibitors on mouse NK cell development by treatment of HSPCs at the start of cellular differentiation (Fig. 3A). Both inhibitors decreased H3K27me3 levels at 5 μM (Fig. 3B). Surprisingly, induction of CD122+NKp46+ cells was observed at day 3 in inhibitor-treated cultures compared with controls (Fig. 3C) and this accelerated NKp induction led to ∼twofold more mature NK cells (NK1.1+DX5+) after 6 d of cell differentiation (Fig. 3C).

Fig. 3.

Fig. 3.

Inhibition of Ezh2 activity enhances mouse and human NK cell development. (A) Schematic of in vitro mouse NK cell differentiation, as in Fig. 2A, followed by addition of Ezh2 inhibitors or DMSO (control). (B) Immunoblot analysis of H3K27me3 and total H3 in mouse HSPCs at day 3 posttreatment with DMSO, UNC1999 (UNC), or EPZ005687 (EPZ) (5 μM). Densitometric levels of H3K27me3 normalized to H3 levels are presented relative to those of DMSO-treated cells, set as 1 (Lower). (C) Flow cytometry of developing mouse NK cells in A. Gated numbers indicate CD3−NKp46+CD122+ cells at day 3 (Upper) or CD3−NK1.1+DX5+ cells at day 6 (Lower) in each group. (D) Schematic of in vitro human NK cell differentiation using a two-step cell culture system followed by addition of Ezh2 inhibitors or DMSO (control). (E) Immunoblot analysis of H3K27me3 and total H3 in human HSPCs at day 21 posttreatment with DMSO or Ezh2 inhibitors (2.5 μM). Densitometric levels of H3K27me3 normalized to H3 levels are presented relative to those of DMSO-treated cells, set as 1 (Lower). (F) Flow cytometry of developing human NK cells in D. Gated numbers indicate CD3−NKp46+CD56+ cells at day 14 (Upper) or at day 21 (Lower) in each group. Data are representative of three independent experiments.

Human NK cells produced in vitro from hematopoietic progenitor cell antigen CD34+ HSPCs using a similar cell culture system as murine NK cells, albeit at longer incubation time (Fig. 3D) (25), were used to evaluate the effects of inhibitors on human NK cell development using concentrations to reduce H3K27me3 levels (2.5 μM) (Fig. 3E). After 2 wk of differentiation, we observed an increased frequency of cells expressing adhesion molecule CD56 and NKp46, and further expansion after 3 wk of culture following addition of Ezh2 inhibitors compared with controls (Fig. 3F). Increased human NK cell production was more evident when UNC1999 was used.

Taken together, these data suggest that selective inhibition of Ezh2 methyltransferase activity promotes both mouse and human NK cell development in vitro. The impact of Ezh2 deficiency on NK cell development, therefore, likely results, in large part, from loss of its enzymatic activity.

Ezh2 Deletion Alters the Genetic Program in NKp Cells.

To understand how Ezh2 loss enhances NK cell development, we performed microarray analysis of NKp cells produced from in vitro cultures of Ezh2fl/fl HSPCs infected with YFP-Cre retrovirus compared with control virus-infected cells (Fig. 2A). In Ezh2-depleted NKp cells, 532 genes were up-regulated and 302 were down-regulated (Fig. 4A). Two-way hierarchical cluster analysis revealed that Ezh2−/− NKp cells displayed different gene expression patterns from WT NKp cells (Fig. 4B). Functional analysis of 532 up-regulated genes revealed that Ezh2 deficiency was involved in pathways for hematopoietic lineage development and immune regulation (Table S1). Furthermore, 24 differentially-expressed genes overlapped with a cluster of genes identified within the GLAD4U database (26), which may play critical roles in NK cell development and function (Fig. 4C). These 24 genes were categorized into encoding receptors, enzymes, cytokines, and DNA binding proteins (Fig. 4D). Expression of the Klrk1 (killer cell lectin-like receptor subfamily K, 1) gene, encoding the activating NKG2D receptor, was elevated ∼eightfold after Ezh2 deletion. Genes encoding cytokine receptors IL2ra and IL7r, important in NK cell expansion and survival (27, 28), were also increased in Ezh2-deficient NKp cells. Moreover, the abundance of mRNAs encoding chemokine receptors (Cxcr3, Ccr7, Xcr1), costimulatory and activating receptors (Slamf7, Tnfrsf9), Toll-like receptors (Tlr3, Tlr8), TFs (Tox, Blimp1) (29), and cytotoxicity-related proteases (Gzma, Gzmb) were also elevated following deletion of Ezh2 (Fig. 4D). Therefore, Ezh2 deletion in mouse NKp cells increased expression of a series of genes critical for NK cell development and function.

Fig. 4.

Fig. 4.

Altered genetic program in NKp cells by Ezh2 deletion. (A) Microarray analysis of NKp cells (CD122+Lin−) differentiated from Ezh2fl/fl HSPCs infected with retrovirus expressing YFP-Cre (Ezh2−/−) or control virus expressing YFP only (WT), as in Fig. 2A. Scatterplot of gene expression in sorted YFP+ Ezh2−/− NKp cells (triplicates) relative to WT NKp cells (n = 6): 532 (red) genes up-regulated and 302 (blue) down-regulated in Ezh2−/− NKp cells (cut-off > twofold and *P < 0.05). (B) Two-way hierarchical cluster heatmap of a total of 834 differentially expressed genes in each individual sample in A. (C) Heatmap displays 24 of the total 834 differentially expressed genes identified using the GLAD4U database, which highly correlate with regulation of NK cell development and function. Genes with the highest significance scores related to their functional importance are listed at the top. Scales (B and C) indicate values of the log2 robust multiarray signal intensity. (D) Twenty-four transcripts in C in Ezh2−/− NKp cells relative to their expression in WT NKp cells are listed.

Table S1.

Genes upregulated in Ezh2−/− NKp cells

Pathway name Gene no. P value
Cytokine-cytokine receptor interaction 36 1.10E-12
Primary immunodeficiency 9 3.40E-05
Hematopoietic cell lineage 12 2.06E-04
Chemokine signaling pathway 17 8.94E-04
Complement and coagulation cascades 9 0.0056
Gap junction 9 0.0125
Intestinal immune network for IgA production 7 0.0130
Vascular smooth muscle contraction 10 0.0302
Prion diseases 5 0.0371
Chondroitin sulfate biosynthesis 4 0.0441
Sulfur metabolism 3 0.0490

Deletion or Inhibition of Ezh2 Activity Up-Regulates NKG2D Expression.

Among those genes up-regulated after Ezh2 deletion, Klrk1 was restricted to the NK cell lineage. Committed NKp cells already express the NKG2D receptor (Figs. S1A and S4). However, except for the role of NKG2D in mediating NK cell activation, little is known about its contribution to NK cell-fate decision and development. This prompted us to investigate how NKG2D up-regulation contributes to NK cell development.

Fig. S4.

Fig. S4.

NKG2D expression during NK cell development. Flow cytometry analysis of NKG2D levels in indicated subsets (as in Fig. S3) during NK cell development from C57BL/6 BM. Data represent three independent experiments.

To confirm NKG2D up-regulation at the protein level, we determined that YFP-Cre–mediated deletion of Ezh2 in Ezh2fl/fl HSPCs greatly increased surface NKG2D expression on day 5 differentiated cells (Fig. 5A). We then investigated whether this effect depended on Ezh2 enzymatic activity using Ezh2-selective small-molecule inhibitors UNC1999 and EPZ005687. Consistent with observations noted in Fig. 3C, addition of inhibitors accelerated CD122 expression after 3 d of culture and was accompanied by significantly increased NKG2D expression (Fig. 5B). Enhanced induction of CD122 and NKG2D expression in HSPCs from Rag2−/− mice was also observed (Fig. 5C). These data support the notion that increased NKp induction and NKG2D expression is restricted to NK cells and not influenced by deficiency in other lymphoid compartments (Fig. 1 A and B). Moreover, significant NKG2D up-regulation was observed in in vitro-differentiated human NK cells after treatment with inhibitors (Fig. 5D).

Fig. 5.

Fig. 5.

Ezh2 deletion or inhibition of its activity up-regulates NKG2D expression. (A) Expression of NKG2D on in vitro differentiated mouse NKp cells at day 6 postculture of Ezh2fl/fl HSPCs following by infection with retrovirus expressing YFP-Cre or YFP only, as in Fig. 2A. YFP+: Ezh2-deleted; YFP−: Ezh2-intact control. Flow cytometry of developing mouse NK cells day 3 postculture of HSPCs from C57BL/6 mice (B) or Rag2−/− mice (C), followed by treatment with DMSO or Ezh2 inhibitors, as in Fig. 3A. Gated numbers represent CD3−NKG2D+CD122+ cells. Expression of NKG2D (Center) and quantitation of NKG2D MFI (Right) are shown. (D) Flow cytometry of developing human NK cells at day 21 postculture of CD34+ cells, and treatment with the indicated reagents, as in Fig. 3C. Gated numbers represent CD3−NKG2D+CD56+ cells. Expression of NKG2D (Center) and quantitation of NKG2D mean fluorescence intensity (MFI) (Right) are shown. Data represent three independent experiments. (E) Schematic diagram of the hKLRK1 locus. Arrowheads, PCR primer pairs for ChIP analysis. (F) ChIP analysis of DNA precipitated with anti-H3K27me3 or anti-IgG isotype control from in vitro differentiated NK cells at day 14 postculture of human CD34+ cells and treatment with DMSO or UNC1999, followed by amplification with the indicated primers in E or GAPDH primer as negative control. No detectable or very low levels of signals with anti-IgG at all amplified regions. Percent of input DNA is shown in triplicates. *P < 0.05 and **P < 0.01 (error bars, mean ± SD).

To determine whether chromatin marks at the hKLRK1 locus following Ezh2 loss correlate with transcription, we performed ChIP-quantitative PCR (qPCR) analysis of in vitro-cultured human umbilical cord blood (hUCB) HSPCs treated with UNC1999 or DMSO. Four pairs of primers located sequentially along the proximal promoter, first intron, and exon 2 of hKLRK1 to quantify H3K27me3 in ChIP-enriched DNA by real-time PCR (Fig. 5E) showed a significant decrease in H3K27me3 mark at the KLRK1 promoter and gene body in UNC1999 treated cells compared with DMSO controls (Fig. 5F). Thus, decreased H3K27me3 deposition was associated with up-regulation of NKG2D expression (Fig. 5D).

Enhanced NK Cell Development by Inhibition of Ezh2 Activity Requires NKG2D Expression.

Previous studies of conventional Klrk1−/− mice showed that absence of NKG2D adversely affected transition from immature to mature NK subsets, leading to reduced NK cell numbers (30). This ex vivo analysis using complete gene knockout mice may have overlooked the role of NKG2D during the early stages of NK cell differentiation. To determine whether NKG2D up-regulation mediated by Ezh2 inhibition contributed to NK cell development, we differentiated NK cells from B6 WT and Klrk1−/− HSPCs treated with Ezh2 inhibitors. Consistent with findings in Fig. 3C, increased CD122+NK1.1+ populations and elevated CD122 levels were detected at day 5 in culture in UNC1999-treated WT cells (Fig. S5A). CD122+NK1.1+ cells were diminished in Klrk1−/− cell cultures compared with WT in DMSO- and UNC1999-treated groups (Fig. S5A). The impact of NKG2D deficiency on NK cell development was greater after 9 d of in vitro differentiation and substantially increased NK cell differentiation was observed after treatment of WT HSPCs with Ezh2 inhibitors (Fig. 6), indicating that NKG2D deficiency blunts the effects of Ezh2 inhibitors. These results suggest that increased NK cell commitment and development following inhibition of Ezh2 requires expression of NKG2D as an intermediary.

Fig. S5.

Fig. S5.

NKG2D expression is required for enhanced NK cell development upon Ezh2 inhibition. Flow cytometry of developing NK cells at day 5 postculture of HSPC from C57BL/6 (WT) or Klrk1−/− mice, and treated with indicated reagents. (A) Numbers in outlined gates indicate Lin−NK1.1+CD122+ NK cells. Histogram overlays of CD122 expression in cells treated with DMSO compared with UNC1999 are shown (Right). (B) Histogram overlays of Annexin V levels in Lin−7AAD−CD122+NK1.1+ cells from WT compared with Klrk1−/− mice (Left) or in these cells treated with DMSO compared with UNC1999 (Right) are shown.

Fig. 6.

Fig. 6.

Enhanced NK cell development by inhibition of Ezh2 activity requires NKG2D expression. Flow cytometry of developing NK cells at day 9 postculture of HSPCs from C57BL/6 or Klrk1−/− mice, and treatment with the indicated reagents. Gated numbers indicate CD3−NK1.1+CD122+ NK cells. (Right) Frequency of CD3–NK1.1+CD122+ mature NK cells is shown. *P < 0.05 and **P < 0.01 (error bars, mean ± SEM). Data are representative of at least three independent experiments.

We found that Ezh2 deficiency promoted NK cell survival at the NKp and post-NKp stages (Fig. S3D). Consistent with previous studies showing increased susceptibility of Klrk1−/− NK cells to apoptosis (30), we found that Klrk1−/− NKp cells expressed higher basal levels of Annexin V than WT NKp cells, and UNC1999 treatment slightly reduced Annexin V expression in WT NKp cells but further aggravated Klrk1−/− NKp cell apoptosis (Fig. S5B).

Preconditioning HSPCs with Ezh2 Inhibitors Enhances NKG2D-Dependent NK Cell Cytotoxicity.

Adoptive immunotherapy based on transfer of autologous cell subsets to eradicate tumor cells is a current therapeutic approach to induce tumor regression in patients with metastatic cancer or hematopoietic tumors. Our findings of improved NK cell commitment and development from HSPCs following Ezh2 inhibitor treatment open the possibility that NK cell output may be augmented by preconditioning patients’ cells with Ezh2 inhibitors. Moreover, inhibition of Ezh2 increased expression of NKG2D, the most well-characterized NK activating receptor that senses stressed cells expressing up-regulated NKG2D ligands, including tumor cells (31). To test the feasibility of this approach, isolated HSPCs from donor CD45.1 mice were cultured in the presence of cytokine mixture and Ezh2 inhibitors for 2 d before washing and injection into sublethally irradiated (CD45.2) congenic Rag2−/−γc−/− hosts, devoid of T, B, and NK cells (Fig. 7A). Following 7 d of reconstitution, we observed increased expression of CD122, NKG2D on emerging CD45.1+ NK cells, and more CD122+NKG2D+ NK cells in peripheral blood and spleen of hosts infused with UNC1999- or EPZ005687-pretreated HSPCs compared with DMSO control HSPCs (Fig. S6 A and B). To test the functional activity of newly generated NK cells, NK cells from spleens of hosts were enriched, expanded in vitro with IL-2 and subject to an NK killing assay against Yac-1 lymphoma cells, which are sensitive to NKG2D-mediated lysis (Fig. 7A). Both UNC1999- and EPZ005687-treated NK cells enhanced lytic activity against Yac-1 cells compared with DMSO-treated controls (Fig. 7B and Fig. S6C). Moreover, anti-NKG2D–mediated blockade impaired lytic activity in both control and Ezh2 inhibitor-treated cells (Fig. 7B and Fig. S6C), indicating that NK cell functional activity is NKG2D-dependent. We also observed that UNC1999- and EPZ005687-treated human NK cells differentiated from hUCB HSPCs were more potent in killing K562 target cells than DMSO-treated cells in an NKG2D-dependent manner (Fig. 7 C and D).

Fig. 7.

Fig. 7.

NK cells differentiated from HSPCs treated with Ezh2 inhibitors exhibit increased cytotoxicity against tumor cell lines. (A) Schematic of in vitro NK cell differentiation from CD45.1+ HSPCs treated with inhibitors, followed by adoptive transfer, donor NK cell enrichment, and analysis of in vitro cytotoxicity against Yac-1 target cells, as described in Materials and Methods. (B) Cytotoxicity of IL-2–expanded donor NK cells enriched in A against CFSE (carboxyfluorescein diacetate, succinimidyl ester)-labeled Yac-1 cells at the indicated effector-to-target (E:T) ratio in the presence of anti-NKG2D or isotype IgG1 control antibody, shown as percent Annexin V+CFSE+ cells. (C) Schematic of in vitro NK cell differentiation from hUCB CD34+ cells treated with inhibitors, followed by cytotoxicity assay against K562 cells. (D) Cytotoxicity of developed NK cells at day 21, postculture in C against CFSE-labeled K562 cells at the indicated E:T ratio in the presence of anti-NKG2D or isotype IgG1 control antibody, shown as percent 7AAD+CFSE+ cells. *P < 0.05, **P < 0.01, and ***P < 0.001 (error bars, mean ± SEM of triplicate wells). Results are representative of three experiments.

Fig. S6.

Fig. S6.

NK cells differentiated from HSC treated with Ezh2 inhibitors display increased cytotoxicity. (A) Flow cytometry of donor NK cells differentiated from HSPCs pretreated with indicated Ezh2 inhibitors and transfer into Rag2−/−γc−/− recipient mice, as in Fig. 7. Expression of CD122 and NKG2D on these NK cells from blood at day 9 posttransfer is shown. Quantification of NKG2D MFI (Right). (B) Numbers in outlined gates indicate CD3−NKG2D+CD122+ splenic NK cells in A. (C) Cytotoxicity of donor NK cells enriched in A against Yac-1 cells at the indicated E:T ratios in the presence of anti-NKG2D or its isotype IgG1 control antibody, as shown by percent Annexin-V+CD122−CD3−CD19−NK1.1−cells (Yac-1) cells. NK cells were expanded with IL-2 (1,000 U/mL) for 5 d before cytotoxicity assays. *P < 0.05 and **P < 0.01 (error bars, mean ± SEM of triplicate wells).

Taken together, the feasibility of de novo generation of NK cells with increased numbers and potency after inhibition of Ezh2 activity suggests new adoptive immunotherapeutic strategies to treat cancer using Ezh2 inhibitors, which are currently used only to directly target tumor cells.

Discussion

Bivalent H3 methylation status at lineage-specifying gene loci may regulate cell fate determination from multipotent precursors. Deliberate alteration of the chromatin state during NK cell lineage commitment from HSPCs was assessed by manipulating Ezh2, an essential component of PRC2, which deposits histone mark H3K27me3. Here we show that Ezh2 deficiency by gene knockout or small-molecule inhibition enhances generation of NK cells and improves NK-mediated cell lysis.

Ezh2 exerts cell-intrinsic effects on NK lineage development. Genetic deletion of Ezh2 or inhibition of its enzymatic activity by small molecules substantially increased expression of the IL-15R CD122 and NKG2D activating receptor, resulting in enhanced NK cell generation from HSPCs. IL-15 is an essential factor in regulation of NK cell survival and development. Mice that lack or fail to respond to IL-15 (e.g., Il15−/−, Il15ra−/−, and Rag2−/−γC−/−) harbor no peripheral NK cells (32–34). Although the mechanism of Ezh2-mediated regulation of CD122 expression remains to be defined, increased and accelerated expression of CD122 upon Ezh2 inhibition may enhance IL-15 responsiveness of NKp cells and promote NKp survival and commitment.

Enhanced NK cell generation from Ezh2-deficient HSPCs may also depend in part on elevated NKG2D expression. Although the role of NKG2D in NK cell commitment remains unclear, the finding that inhibition of Ezh2 activity enhanced survival of both NKp and its progeny and that this positive effect was diminished by NKG2D deficiency may partially explain the contribution of NKG2D expression to early NK cell differentiation. Failure of Ezh2 inhibition to promote generation of Klrk1−/− NK cells from HSPCs further supports NKG2D as an important intermediary downstream of Ezh2-mediated regulation of NK cell commitment. De-coupling of the signaling events triggered by NKG2D and its adaptor DAP10 from those initiated by IL-15R–Jak3 renders NK cells unresponsive to IL-15, resulting in lower numbers of NK cells (35). Possibly, signals emanating from these two receptors, which are both enhanced by Ezh2 inhibition, synergistically regulate NK cell differentiation.

Our data show that Ezh2 inhibition not only enhances NK cell commitment but also improves mature NK cell function. Continuous down-regulation of Ezh2 after the NKp stage may ensure maintenance of a chromatin state adjacent to NK-specific genes, including Klrk1 and genes encoding granzymes, which are crucial for mature NK cell effector activity. Stabilized NKG2D expression throughout NK cell maturation after its initial up-regulation before NKp generation is compatible with this hypothesis and also suggests that regulation of Ezh2 activity determines the quantity and quality of NK cells.

Histone modifications correlate with transcriptional activity in normal tissues and are often altered in pathological conditions. Histone modifications are reversible, making them suitable targets for therapeutic intervention. Alterations in histone lysine methyltranferases are frequently associated with physiological and pathological processes, including cancer (36, 37) and autoimmune disease (38). Increased expression of Ezh2 or Ezh2 mutations that enhance methyltransferase activity are observed in cancer and often correlate with poor prognosis (36). Several small-molecule inhibitors of Ezh2 under preclinical development suggest in vivo activity in cancer (39). Our observations that Ezh2 inhibitors increase NK cell numbers and activity against tumor cell lines suggest an additional potential role of these inhibitors in mobilizing antitumor activity of NK cells. Thus, the therapeutic effects of Ezh2 inhibitors on tumor growth should also include analysis of their impact on immune responses, which may suggest new strategies that synergize with the use of Ezh2 inhibitors.

Epigenetic machinery, which lies at the interface between environmental stimulation and transcriptional regulation, actively shapes the gene-expression pattern of a cell and decides its functional outcome. Our findings provide new insight into the contribution of epigenetic modifiers to NK cell biology and suggest new therapeutic strategies in cancer immunotherapy.

Materials and Methods

Mice.

C57BL/6J (B6) mice, Ezh2fl/fl mice, Klrk1−/− mice, Rag2−/−γc−/− mice, Vav1-Cre mice (Jackson Laboratories) and B6SJL (CD45.1+) mice (Taconic Farms) were housed in specific pathogen-free conditions and were used at 7–12 wk of age. Deletion of loxP-flanked Ezh2 in hematopoietic cells was achieved by crossing Ezh2fl/fl mice with Vav1-Cre mice that express recombinase Cre under the proto-oncogene Vav1 promoter. Animal handling and experimental procedures were performed in compliance with federal laws and institutional guidelines as approved by the Animal Care and Use Committee of Dana-Farber Cancer Institute.

Flow Cytometry, Cell Isolation, Retroviral Transduction, and in Vitro Culture.

Details of flow cytometry analysis, cell isolation, retroviral transduction and in vitro culture are provided in SI Materials and Methods.

Adoptive Cell Transfer, NK Cell Enrichment, and in Vitro NK Cell Killing Assay.

Details of adoptive cell transfer, NK cell enrichment and in vitro NK cell killing assay are provided in SI Materials and Methods.

Microarray, ChIP, qRT-PCR, and Immunoblot.

Details of microarray, ChIP, qRT-PCR and immunoblot analysis are provided in SI Materials and Methods.

Statistical Analysis.

Analyses were performed with a two-tailed, unpaired Student’s t test with GraphPad Prism software. A P value < 0.05 was considered statistically significant. No exclusion of data points was used.

SI Materials and Methods

Flow Cytometry.

Cells were preincubated with anti-Fc block (2.4G2, BD Biosciences) before being stained with conjugate antibodies to NKp46 (29A1.4, BD Biosciences), NK1.1 (PK136, BD Biosciences), CD4 (H129.19, BD Biosciences), B220 (RA3-6B2, BD Biosciences), Sca1 (E13-161.7, BD Biosciences), NKG2D (CX5, eBioscience), CD122 (TM-b1, eBioscience), DX5 (DX5, eBioscience), CD8a (53-6.7, eBioscience), CD19 (eBio1D3, eBioscience), CD11b (M1/70, Biolegend), KLRG1 (2F1/KLRG1, Biolegend), CD27 (LG.3A10, Biolegend), TCRβ (H57-597, Biolegend), CD117 (2B8, Biolegend), TER119 (TER-119, Biolegend), Gr1 (RB6-8C5, Biolegend), and human NKp46 (9E2, Biolegend), CD56 (HCD56, Biolegend), NKG2D (1D11, Biolegend), CD3 (HIT3a, Biolegend), CD19 (HIB19, Biolegend). For all flow cytometric analyses, dead cells were excluded with staining of 7AAD. To define lineage-negative cells, we excluded cells positive for Ter119, TCRβ, CD8α, NK1.1, DX5, Gr1, CD11b, CD19, and CD4. Cell apoptosis and proliferation were indicated with staining of Annexin V and intracellular Ki67 (16A8, Biolegend), respectively. Flow cytometric analyses were performed on FACSCanto (BD Biosciences) and Accuri C6 (BD Biosciences). FACS sorting was performed on FACSAria II (BD Biosciences). Data were analyzed by FlowJo software (TreeStar).

Cell Isolation, Retroviral Transducation, and in Vitro Culture.

For mouse HSPCs isolation, retroviral transduction, and in vitro culture, mouse lineage-negative cells were purified from BM by magnetic depletion of cells with Lineage Cell Depletion Kit (Miltenyi) on MACS columns (Miltenyi). 7AAD−Lin−Sca1+CD117+ HSPCs were then sorted and cultured in DMEM supplemented with 20% (vol/vol) FBS (Gibco), 1% of penicillin and streptomycin antibiotic mixture (Gibco), 25 μg/mL Gentamicin (Gibco), IL-7 (0.5 ng/mL; R&D systems), SCF (30 ng/mL; R&D systems), and Flt3L (100 μ/mL; R&D systems). After 24 h of culture, HSPCs were infected with retrovirus expressing YFP alone or YFP-Cre in the presence of 8 μg/mL of polybrene, before 1 h of centrifugation at 2,000 rpm (Eppendorf 5810R; rotor A-4-81), followed by 6–8 h of incubation at 37 °C and subsequent replacement of three quarters of fresh medium containing indicated cytokines. After 6 d of culture, medium was switch into DMEM supplemented with 20% (vol/vol) FBS (Gibco) and IL-15 (30 ng/mL; R&D systems) alone. Using this two-step stromal cell-free cell culture system, CD122+ NKp cells are induced after 6 d of culture and they further develop into NK1.1+DX5+ mature NK cells after 6 d of exposure to IL-15 (21).

Human UCB CD34+ cells isolation and in vitro culture were performed as described previously (20). In brief, leukocytes were isolated from the hUCB by density gradient centrifugation. CD34+ cells were obtained by positive selection with CD34 Progenitor cell Isolation kit (Miltenyi). Cells were routinely >99% pure according to FACS analysis. Purified CD34+ cells were then cultured in GMP Serum-free Stem Cell Growth Medium (CellGenix) supplemented with 10% (vol/vol) FBS, 1% of penicillin and streptomycin antibiotic mixture (Gibco), 25 μg/mL Gentamicin (Gibco), SCF (20 ng/mL; Peprotech), Flt3L (20 ng/mL; Peprotech), IL-7 (20 ng/mL; Peprotech), IL-15 (20 ng/mL; Peprotech), and IL-21 (20 ng/mL; Peprotech).

Adoptive Cell Transfer and NK Cell Enrichment.

Rag2−/−γc−/− (CD45.2+) recipients were irradiated (600 rads) and injected intravenously with pretreated in vitro cultured HSPCs from B6SJL (CD45.1+) donors. Seven days after transfer, recipient mice were killed and reconstituted CD45.1+ NK cells were isolated from spleens with NK enrichment kit (Miltenyi). Enriched NK cells were then cultured in DMEM supplemented with 20% (vol/vol) FBS (Gibco), 1% of penicillin and streptomycin antibiotic mixture (Gibco), 25 μg/mL Gentamicin (Gibco), and IL-2 (1,000 U/mL; Peprotech).

In Vitro NK Cell Killing Assay.

In vitro differentiated mouse and human NK cells, or purified reconstituted NK cells were used as effector cells. Target Yac-1 cells or K562 cells [cultured in RPMI1640 supplemented with 10% (vol/vol) FBS] were labeled with CFSE (Biolegend) at a concentration of 1 μM for 10 min at 37 °C, and washed three times with PBS before mixing (1 × 104 per well) with effector cells in U-bottomed 96-well plates at different E:T ratios as indicated, in triplicate. After 4 h of incubation, cells were harvested and analyzed for percentage of CFSE+ target cell death with staining of Annexin V or 7AAD.

Microarray.

In vitro differentiated Ezh2fl/fl Lin−CD122+ NKp cells infected with YFP-Cre retrovirus or YFP only control virus were sorted according to YFP expression before RNA isolation and microarray analysis. RNA was prepared using RNeasy Plus Micro kit (Qiagen) before amplifying, labeling, and hybridizing to MOA430 2.0 chips (Affymetrix) at the Dana-Farber Cancer Institute Microarray Core Facility.

Immunoblot.

Cells were collected and lysed with RIPA buffer (20 mmol/L Tris⋅HCl, pH 7.5, 150 mmol/L NaCl, 0.5 mmol/L EDTA, 1% Triton X-100, 1 mmol/L PMSF, 1× Protease Inhibitor Mixture) at 4 °C. Protein concentration was determined with BCA kit (Thermo Scientific). Equal amounts of protein from each cell lysate were subjected to SDS/PAGE and transferred to PVDF membranes. The following antibodies were used: anti-Histone H3 (D1H2, Cell Signaling Technology), anti–Tri-Methyl-Histone H3 (C36B11, Cell Signaling Technology).

ChIP.

In vitro-differentiated human NK cells pretreated with indicated reagents were harvested after 20 d of culture. Cells were cross-linked with 1% formaldehyde at room temperature for 10 min and stopped with 1.25 M Glycine. Cells were then rinsed with ice-cold PBS twice and suspended in Lysis buffer (50 mM Tris⋅HCl, pH8.0, 10 mM EDTA, 1% SDS, 1 mM PMSF, 1× Protease Inhibitor Mixture) and incubated for 10 min on ice. Cells were sonicated (Bioruptor, Diagenode) and subsequently centrifuged for 10 min. Supernatants were collected and diluted in Dilution buffer (20 mM Tris⋅HCl, pH8.0, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100, 1× Protease Inhibitor Mixture). Immunoprecipitation was performed overnight at 4 °C with specific antibodies followed by the addition of Dynabeads-protein G (Life Technologies) for an additional 2 h of incubation. Precipitates were washed sequentially for 10 min each in low salt buffer (20 mM Tris⋅HCl, pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), high salt buffer (20 mM Tris⋅HCl, pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), LiCl buffer (10 mM Tris⋅HCl, pH 8.0, 0.25 M LiCl, 1% Nonidet P-40, 1% deoxycholate, 1 mM EDTA). Precipitates were then washed three times with TE buffer and extracted with Elution buffer (20 mM Tris⋅HCl, pH 7.5, 5 mM EDTA, 50 mM NaCl, 1% SDS) and heated at 65 °C for at least 2 h to reverse the cross-linking. DNA fragments were purified with a PCR Purification kit (Qiagen).

Quantitative RT-PCR.

For analysis of Ezh2 expression, RNA was extracted with an RNeasy Plus Micro kit (Qiagen), followed by quantitative real-time PCR with TaqMan gene-expression assays (probes: Ezh2, Mm00468464_m1 and Hprt, Mm03024075_m1) and an RNA-to-CT 1-Step Kit (Life Technologies). All results were first normalized to those of the control gene Hprt and are presented as normalized expression for the sample relative to the appropriate comparison condition.

For real-time PCR detection of hKLRK1 and control hGAPDH promoters after ChIP, primers were used as followed: TCCACACTCTGTCAGTTGGT (hKLRK1-a forward primer), GGGAAGTCCCCACACATACC (hKLRK1-a reverse primer), AGGCCAGTGTGATAGTAACCC (hKLRK1-b forward primer), AAAGTGGCATGTGGGGCATA (hKLRK1-b reverse primer), TTTCTGATGCTGTAGGGGGC (hKLRK1-c forward primer), CAATGCACAGCAGAGCTTCC (hKLRK1-c reverse primer), TAAAGGCATGCACAGGGGAA (hKLRK1-d forward primer), CCACGAATCCACCCCATCAA (hKLRK1-d reverse primer), TGCTGAGTCACCTTCGAACC (hGAPDH forward primer), ACTGTCTTCTCCCCGCAAAG (hGAPDH reverse primer). The ABI 7500Fast detector and FastStart Universal SYBR Green Master (Roche) were used.

Acknowledgments

We thank Dr. J. D. Leavenworth for editing; A. Angel for manuscript and figure preparation; Y. Shao (Dana-Farber Cancer Institute Microarray Facility) and Z. Zhu for flow cytometry; and Drs. Y. Shang, Z. Yao, Y. Wang, Z. Liu, and members of the laboratories of X. Wang., H.C., C.W.M.R., and S.H.O. for technical help, discussion, critical comments, and support. This work was supported in part by Ministry of Science and Technology of China Grant 2014CB910100 (to X. Wang and J.Y.); National Natural Science Foundation of China Grants 81171899 and 81372230 (to X. Wang), 81422045 and 21272195 (to X.D.), and 81322018 (to J.H.); National Institutes of Health Grants AI048125 (to H.C.), T32 CA070083 (to J.W.L.), U01 CA105423 (to S.H.O.), and R01CA172152 and R01CA113794 and a U01NCI Mouse Models of Cancer Consortium award (to C.W.M.R.); a gift from The LeRoy Schecter Research Foundation (to H.C.); the Benacerraf Fellowship and the Claudia Adams Barr Program for Innovative Cancer Research (J.W.L.); Shanxi Scholarship Council of China Grant 2012-089 and International Cooperation Project of Shan Xi Science and Technology Department Grant 2012081049 (to L.Y.Z.); and Tianjin Natural Science Foundation Grant 12JCYBJC17200 (to L.Z.). S.H.O. is a Howard Hughes Medical Institute investigator. H.X. was a Leukemia and Lymphoma Society fellow.

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1521740112/-/DCSupplemental.

References

  • 1.Artis D, Spits H. The biology of innate lymphoid cells. Nature. 2015;517(7534):293–301. doi: 10.1038/nature14189. [DOI] [PubMed] [Google Scholar]
  • 2.Vivier E, Tomasello E, Baratin M, Walzer T, Ugolini S. Functions of natural killer cells. Nat Immunol. 2008;9(5):503–510. doi: 10.1038/ni1582. [DOI] [PubMed] [Google Scholar]
  • 3.Jost S, Altfeld M. Control of human viral infections by natural killer cells. Annu Rev Immunol. 2013;31:163–194. doi: 10.1146/annurev-immunol-032712-100001. [DOI] [PubMed] [Google Scholar]
  • 4.Waldhauer I, Steinle A. NK cells and cancer immunosurveillance. Oncogene. 2008;27(45):5932–5943. doi: 10.1038/onc.2008.267. [DOI] [PubMed] [Google Scholar]
  • 5.Long EO, Kim HS, Liu D, Peterson ME, Rajagopalan S. Controlling natural killer cell responses: Integration of signals for activation and inhibition. Annu Rev Immunol. 2013;31:227–258. doi: 10.1146/annurev-immunol-020711-075005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Imai K, Matsuyama S, Miyake S, Suga K, Nakachi K. Natural cytotoxic activity of peripheral-blood lymphocytes and cancer incidence: An 11-year follow-up study of a general population. Lancet. 2000;356(9244):1795–1799. doi: 10.1016/S0140-6736(00)03231-1. [DOI] [PubMed] [Google Scholar]
  • 7.Jin J, et al. CD11b(-)CD27(-) NK cells are associated with the progression of lung carcinoma. PLoS One. 2013;8(4):e61024. doi: 10.1371/journal.pone.0061024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vivier E, Ugolini S, Blaise D, Chabannon C, Brossay L. Targeting natural killer cells and natural killer T cells in cancer. Nat Rev Immunol. 2012;12(4):239–252. doi: 10.1038/nri3174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cheng M, Zhang J, Jiang W, Chen Y, Tian Z. Natural killer cell lines in tumor immunotherapy. Front Med. 2012;6(1):56–66. doi: 10.1007/s11684-012-0177-7. [DOI] [PubMed] [Google Scholar]
  • 10.Yoon SR, et al. Generation of donor natural killer cells from CD34(+) progenitor cells and subsequent infusion after HLA-mismatched allogeneic hematopoietic cell transplantation: A feasibility study. Bone Marrow Transplant. 2010;45(6):1038–1046. doi: 10.1038/bmt.2009.304. [DOI] [PubMed] [Google Scholar]
  • 11.Bachanova V, et al. Clearance of acute myeloid leukemia by haploidentical natural killer cells is improved using IL-2 diphtheria toxin fusion protein. Blood. 2014;123(25):3855–3863. doi: 10.1182/blood-2013-10-532531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yu J, Freud AG, Caligiuri MA. Location and cellular stages of natural killer cell development. Trends Immunol. 2013;34(12):573–582. doi: 10.1016/j.it.2013.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Vosshenrich CA, Di Santo JP. Developmental programming of natural killer and innate lymphoid cells. Curr Opin Immunol. 2013;25(2):130–138. doi: 10.1016/j.coi.2013.02.002. [DOI] [PubMed] [Google Scholar]
  • 14.Marcais A, et al. The metabolic checkpoint kinase mTOR is essential for IL-15 signaling during the development and activation of NK cells. Nat Immunol. 2014;15(8):749–757. doi: 10.1038/ni.2936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hesslein DG, Lanier LL. Transcriptional control of natural killer cell development and function. Adv Immunol. 2011;109:45–85. doi: 10.1016/B978-0-12-387664-5.00002-9. [DOI] [PubMed] [Google Scholar]
  • 16.Surface LE, Thornton SR, Boyer LA. Polycomb group proteins set the stage for early lineage commitment. Cell Stem Cell. 2010;7(3):288–298. doi: 10.1016/j.stem.2010.08.004. [DOI] [PubMed] [Google Scholar]
  • 17.Chou RH, Yu YL, Hung MC. The roles of EZH2 in cell lineage commitment. Am J Transl Res. 2011;3(3):243–250. [PMC free article] [PubMed] [Google Scholar]
  • 18.Su IH, et al. Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement. Nat Immunol. 2003;4(2):124–131. doi: 10.1038/ni876. [DOI] [PubMed] [Google Scholar]
  • 19.Tumes DJ, et al. The polycomb protein Ezh2 regulates differentiation and plasticity of CD4(+) T helper type 1 and type 2 cells. Immunity. 2013;39(5):819–832. doi: 10.1016/j.immuni.2013.09.012. [DOI] [PubMed] [Google Scholar]
  • 20.Narni-Mancinelli E, et al. Fate mapping analysis of lymphoid cells expressing the NKp46 cell surface receptor. Proc Natl Acad Sci USA. 2011;108(45):18324–18329. doi: 10.1073/pnas.1112064108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Williams NS, et al. Generation of lytic natural killer 1.1+, Ly-49- cells from multipotential murine bone marrow progenitors in a stroma-free culture: Definition of cytokine requirements and developmental intermediates. J Exp Med. 1997;186(9):1609–1614. doi: 10.1084/jem.186.9.1609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Di Croce L, Helin K. Transcriptional regulation by Polycomb group proteins. Nat Struct Mol Biol. 2013;20(10):1147–1155. doi: 10.1038/nsmb.2669. [DOI] [PubMed] [Google Scholar]
  • 23.Konze KD, et al. An orally bioavailable chemical probe of the lysine methyltransferases EZH2 and EZH1. ACS Chem Biol. 2013;8(6):1324–1334. doi: 10.1021/cb400133j. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Knutson SK, et al. A selective inhibitor of EZH2 blocks H3K27 methylation and kills mutant lymphoma cells. Nat Chem Biol. 2012;8(11):890–896. doi: 10.1038/nchembio.1084. [DOI] [PubMed] [Google Scholar]
  • 25.Montaldo E, et al. Human NK cells at early stages of differentiation produce CXCL8 and express CD161 molecule that functions as an activating receptor. Blood. 2012;119(17):3987–3996. doi: 10.1182/blood-2011-09-379693. [DOI] [PubMed] [Google Scholar]
  • 26.Jourquin J, Duncan D, Shi Z, Zhang B. GLAD4U: Deriving and prioritizing gene lists from PubMed literature. BMC Genomics. 2012;13(Suppl 8):S20. doi: 10.1186/1471-2164-13-S8-S20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gasteiger G, Hemmers S, Bos PD, Sun JC, Rudensky AY. IL-2–dependent adaptive control of NK cell homeostasis. J Exp Med. 2013;210(6):1179–1187. doi: 10.1084/jem.20122571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Puel A, Ziegler SF, Buckley RH, Leonard WJ. Defective IL7R expression in T(-)B(+)NK(+) severe combined immunodeficiency. Nat Genet. 1998;20(4):394–397. doi: 10.1038/3877. [DOI] [PubMed] [Google Scholar]
  • 29.Aliahmad P, de la Torre B, Kaye J. Shared dependence on the DNA-binding factor TOX for the development of lymphoid tissue-inducer cell and NK cell lineages. Nat Immunol. 2010;11(10):945–952. doi: 10.1038/ni.1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zafirova B, et al. Altered NK cell development and enhanced NK cell-mediated resistance to mouse cytomegalovirus in NKG2D-deficient mice. Immunity. 2009;31(2):270–282. doi: 10.1016/j.immuni.2009.06.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Raulet DH. Roles of the NKG2D immunoreceptor and its ligands. Nat Rev Immunol. 2003;3(10):781–790. doi: 10.1038/nri1199. [DOI] [PubMed] [Google Scholar]
  • 32.Cooper MA, et al. In vivo evidence for a dependence on interleukin 15 for survival of natural killer cells. Blood. 2002;100(10):3633–3638. doi: 10.1182/blood-2001-12-0293. [DOI] [PubMed] [Google Scholar]
  • 33.Kennedy MK, et al. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med. 2000;191(5):771–780. doi: 10.1084/jem.191.5.771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Leavenworth JW, Verbinnen B, Wang Q, Shen E, Cantor H. Intracellular osteopontin regulates homeostasis and function of natural killer cells. Proc Natl Acad Sci USA. 2015;112(2):494–499. doi: 10.1073/pnas.1423011112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Horng T, Bezbradica JS, Medzhitov R. NKG2D signaling is coupled to the interleukin 15 receptor signaling pathway. Nat Immunol. 2007;8(12):1345–1352. doi: 10.1038/ni1524. [DOI] [PubMed] [Google Scholar]
  • 36.Chang CJ, Hung MC. The role of EZH2 in tumour progression. Br J Cancer. 2012;106(2):243–247. doi: 10.1038/bjc.2011.551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hock H. A complex Polycomb issue: The two faces of EZH2 in cancer. Genes Dev. 2012;26(8):751–755. doi: 10.1101/gad.191163.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tong Q, et al. Ezh2 regulates transcriptional and posttranslational expression of T-bet and promotes Th1 cell responses mediating aplastic anemia in mice. J Immunol. 2014;192(11):5012–5022. doi: 10.4049/jimmunol.1302943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Verma SK. Recent progress in the discovery of epigenetic inhibitors for the treatment of cancer. Methods Mol Biol. 2015;1238:677–688. doi: 10.1007/978-1-4939-1804-1_35. [DOI] [PubMed] [Google Scholar]
  • 40.Carotta S, Pang SH, Nutt SL, Belz GT. Identification of the earliest NK-cell precursor in the mouse BM. Blood. 2011;117(20):5449–5452. doi: 10.1182/blood-2010-11-318956. [DOI] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES