Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2015 Oct 29;291(2):640–651. doi: 10.1074/jbc.M115.654392

Selective Activation of Nociceptor TRPV1 Channel and Reversal of Inflammatory Pain in Mice by a Novel Coumarin Derivative Muralatin L from Murraya alata*

Ning-Ning Wei ‡,1, Hai-Ning Lv §,1, Yang Wu , Shi-Long Yang ‖, Xiao-Ying Sun **, Ren Lai ‖, Yong Jiang §,2, KeWei Wang ‡,¶,**,3
PMCID: PMC4705384  PMID: 26515068

Abstract

Coumarin and its derivatives are fragrant natural compounds isolated from the genus Murraya that are flowering plants widely distributed in East Asia, Australia, and the Pacific Islands. Murraya plants have been widely used as medicinal herbs for relief of pain, such as headache, rheumatic pain, toothache, and snake bites. However, little is known about their analgesic components and the molecular mechanism underlying pain relief. Here, we report the bioassay-guided fractionation and identification of a novel coumarin derivative, named muralatin L, that can specifically activate the nociceptor transient receptor potential vanilloid 1 (TRPV1) channel and reverse the inflammatory pain in mice through channel desensitization. Muralatin L was identified from the active extract of Murraya alata against TRPV1 transiently expressed in HEK-293T cells in fluorescent calcium FlexStation assay. Activation of TRPV1 current by muralatin L and its selectivity were further confirmed by whole-cell patch clamp recordings of TRPV1-expressing HEK-293T cells and dorsal root ganglion neurons isolated from mice. Furthermore, muralatin L could reverse inflammatory pain induced by formalin and acetic acid in mice but not in TRPV1 knock-out mice. Taken together, our findings show that muralatin L specifically activates TRPV1 and reverses inflammatory pain, thus highlighting the potential of coumarin derivatives from Murraya plants for pharmaceutical and medicinal applications such as pain therapy.

Keywords: calcium, calcium imaging, drug discovery, drug screening, ion channel, neuron, pain, transient receptor potential channels (TRP channels)

Introduction

Murraya is a popular genus of flowering plants in the Rutaceae family known for their specific fragrance. Most plants from this genus have been used as traditional Chinese medicines for treating psychogenic pain or somatoform pain disorders, including toothache, gastralgia, lumbago, rheumatic pain, etc. (1). Previous phytochemical and pharmacological investigations have shown that coumarins isolated from Murraya plants are the main bioactive agents responsible for analgesic properties of these medicinal herbs (2). However, the bioactive ingredients have always been a riddle, and their mechanisms of action remain largely unknown.

The transient receptor potential vanilloid member 1 (TRPV1) channel, also known as capsaicin receptor, is a nonselective cation and heat-activated channel with a temperature threshold above 43 °C (3). In addition to chili pepper and temperature, TRPV1 is also activated by acidic pH, and a plethora of other chemicals from plants and toxins (3–7). TRPV1 belongs to the TRPV4 subfamily that is composed of six members divided into two groups as follows: TRPV1–4 channels that are modestly permeable to Ca2+, and TRPV5–6 channels that are only highly Ca2+-selective, based on their homology and biophysical properties (8, 9). The expression of TRPV1 has been primarily demonstrated in pain pathways, including small diameter primary sensory neurons (10) and keratinocytes in the skin where it plays a key role in nociception induced by capsaicin or noxious thermal stimuli (11, 12). Mice lacking Trpv1 show dramatic reduction of pain hypersensitivity, demonstrating TRPV1 as a potential drug target for inflammatory, neuropathic, and cancer-related pain (13, 14). It has been shown that the capsaicin 8% patch, clinically known as Qutenza, is effective in alleviating neuropathic pain associated with postherpetic neuralgia by reducing TRPV1 expression and decreasing the density of epidermal nerve fibers in the application area (15). Thus, targeting TRPV1 by desensitizing the channel function can serve as an attractive strategy for pain therapy, and screening of natural compounds may lead to discovery of novel and specific modulators for TRPV1 (16).

In this study, we adopted a target-based strategy to screen extracts and individually purified compounds derived from Murraya plants against TRP channels. Using a combination of fluorescent calcium assay and electrophysiology as a primary screen and further fractionation of the active extract, we identified a novel coumarin derivative, named muralatin L that can specifically activate TRPV1 and reverse inflammatory pain. Our findings provide a mechanistic explanation for medical use of Murraya plants in pain therapy and also a potential for identifying more novel TRPV channel modulators from medicinal herbs.

Experimental Procedures

Isolation of Compound Muralatin L

The leaves of Murraya alata (8.5 kg) were extracted three times with 95% aqueous EtOH (80 liters × 2 h). The extract was evaporated under reduced pressure, and the residual (1.8 kg) was suspended in H2O, and first degreased with petroleum ether, and then partitioned with CHCl3. The CHCl3 extract (fraction A, 500 g) was fractionated by silica gel column chromatography and eluted with a stepwise gradient of petroleum ether/acetone (9:1, 8:2, 7:3, 6:4, and 5:5, v/v) to afford 10 fractions (F1–F10). F4 (3 g) was separated by silica gel column chromatography eluting with CH2Cl2 to afford fractions F4a–F4d. F4b (1 g) was further chromatographed over silica gel column chromatography eluting with CHCl3/MeOH (95:5, v/v) to yield muralatin L (420 mg).

Cell Culture and Transient Transfection of Cells

HEK-293T cells were maintained at 37 °C in media containing 90% Dulbecco's modified Eagle's medium and 10% fetal bovine serum in 5% CO2. HEK-293T cells were plated onto glass coverslips for subsequent patch clamp recordings. Cells were transiently transfected using Lipofectamine 2000 (Invitrogen) with human TRPV1 cDNA. The accession number of TRPV1 cDNA is NM_080704.3. TRPV1 was constructed by primers ATCGATGAAGAAATGGAGCAGCA (forward) and ACTGTCACTTCTCCCCGGAAGC (reverse) using LA Taq (TAKARA) and subcloned into BglΙΙ and SalΙ restriction sites of the pIRES2-EGFP vector. TRPV1-Y511A and TRPV1-Y550A mutants were generated by site-directed mutagenesis using the QuikChange ΙΙ XL kit (Agilent Technologies). 4 μg of individual cDNA were used. All restriction enzymes were purchased either from Invitrogen or Takara, and inserts of all cDNA clones were verified by sequencing. Electrophysiological experiments were performed between 18 and 36 h after transfection.

Intracellular Calcium Measurement by FlexStation 3 Multimode Microplate Reader Assay

Changes in intracellular calcium level ([Ca2+]i) in a population of cells were measured by fluorescent calcium-sensitive dyes using the Calcium5 assay kit in FlexStation 3 Microplate Reader (Molecular Devices). HEK-293T cells were seeded at a density of ∼30,000 cells/well in 96-well black-walled plates (Thermo) covered with poly-d-lysine. Cells were loaded with dyes from the FLIPR Calcium5 assay kit for 1 h at 37 °C in the presence of 2.5 mm probenecid. Loading and imaging were performed in Hanks' balanced salt solution (137 mm NaCl, 5.4 mm KCl, 0.4 mm KH2PO4, 0.1 mm Na2HPO4, 1.3 mm CaCl2, 0.8 mm MgSO4, 5.5 mm glucose, 4 mm NaHCO3, and 20 mm HEPES, pH 7.4). Fluorescence intensity at 525 nm was measured at an interval of 1.6 s, using an excitation wavelength at 485 nm and an emission wavelength at 515 nm (17).

Calcium Imaging

HEK-293T cells were loaded with the fluorescent dye 5 μm Fura-2 AM (Beyotime) and 0.02% pluronic for 15 min and washed with a solution containing 145 mm NaCl, 5 mm KCl, 1.25 mm CaCl2, 1 mm MgCl2, 10 mm glucose, and 10 mm HEPES. Cells were incubated in the wash buffer for 30 min to allow ester hydrolysis. Ca2+ influx was detected by Fura-2 excitation at 340 and 380 nm. 5 μm capsaicin and 500 μm muralatin L were added at the indicated time points. Data were averaged from capsaicin-sensitive cells in the field (18, 19). Cells were imaged under Olympus IX81 microscope. Ca2+ influx was observed with MetaFluor software.

Electrophysiology

Whole-cell recordings were performed using a HEKA EPC10 amplifier with PatchMaster software (HEKA). Patch pipettes were pulled with borosilicate glass using a puller (DMZ-Universal) and fire-polished to a resistance of 3–5 megohms. For ramp recordings of HEK-293T cells, the bath solution contained 140 mm NaCl, 1 mm MgCl2, 1 mm CaCl2, 10 mm glucose, and 10 mm HEPES, pH 7.3. The pipette solution contained 140 mm cesium aspartate, 3.5 mm NaCl, 0.3 mm CaCl2, 0.3 mm Na2GTP, 0.5 mm EGTA, 10 mm HEPES, and 4 mm Mg-ATP, pH 7.3. Membrane potential was held at 0 mV and current in response to 400-ms voltage ramps from −100 to +100 mV. All recording data were analyzed with Igor Pro (Wave-metrics) and Origin 8.6 (OriginLab). For whole-cell recordings of dose-dependent effects of muralatin L on TRPV1 desensitization, both pipette solution and bath solution contained 130 mm NaCl, 0.2 mm EDTA, and 3 mm HEPES (20). Membrane potential was held at 0 mV. Current was elicited by a 300-ms step to +80 mV and followed by a 300-ms step to −80 mV at 1-s intervals.

For whole-cell recordings of mouse DRG neurons, the bath solution contained 140 mm KCl, 0.5 mm EGTA, 5 mm HEPES, 3 mm Mg-ATP, and 5 mm glucose, pH 7.2. The recording pipette was filled with a solution containing 140 mm NaCl, 3 mm KCl, 2 mm MgCl2, 2 mm CaCl2, and 10 mm HEPES, pH 7.2. Membrane potential was held at 0 mV. Current was elicited by a 300-ms step to +80 mV and followed by a 300-ms step to −80 mV at 1-s intervals. Chemical solutions were perfused with gravity perfusion system (VM8, ALA Scientific Instruments) (21).

Antinociceptive Tests

Kunming mice (18–22 g) or C57BL/6 mice were used for experiments. All animal experiments were approved by the Institutional Animal Care and Use Committee of Peking University Health Science Center and were performed in compliance with national and institutional guidelines for the care and use of laboratory animals.

Inflammatory Paw of Pain Induced by Formalin

Inflammatory pain in mouse right hindpaw was induced by intraplantar injection of 0.92% (v/v) formalin dissolved in saline. Paw licking was observed and compared between groups in mice injected intraperitoneally with either 0.2% (v/v) morphine dissolved in saline as positive control or muralatin L (10 or 40 mg·kg−1) dissolved in 100 μl of 10% Tween 80-containing saline or just 10% Tween 80-containing saline as vehicle control. Mice were placed individually into open polyvinyl cages (20 × 40 × 15 cm). The time spent licking the injected paw was recorded during phase I (0–5 min post-injection) and phase II (15–30 min post-injection) (22).

Trpv1 knock-out mice were obtained from Kunming Institute of Zoology, Chinese Academy of Sciences. Nociceptive behavior in mice lacking Trpv1 was induced by intraplantar injection of 1% formalin, capsaicin (1 μmol/paw), or muralatin L (10 mg/kg). Muralatin L was dissolved in 100 μl of saline or 10% Tween 80-containing saline. Mice in the control group received the same volume of saline. Injected mice were placed individually into open polyvinyl cages (20 × 40 × 15 cm). Time spent licking the injected paw was observed during the following 40 min.

Abdominal Writhing Induced by Acetic Acid

Mice were injected intraperitoneally with 100 μl of vehicle containing muralatin L (10 or 40 mg·kg−1) or 0.2% (v/v) morphine dissolved in saline 30 min before intraperitoneal injection of 100 μl of 1.6% (v/v) acetic acid, which induces abdominal contractions and hind limb stretching. The control group received the same volume of saline. Mice were placed into open polyvinyl cages (20 × 40 × 15 cm) immediately after acid challenge, and abdominal constrictions were counted cumulatively over a period of 30 min (22).

Thermal Pain Test in Mice

Pre-screening was conducted in mice with a light beam focused on the middle portion of the tail, and mice with withdrawal latency of 4–6 s were selected for subsequent tail-flick test. Test animals were injected intraperitoneally with 100 μl of vehicle containing muralatin L (10 or 40 mg·kg−1) or morphine 0.2% (v/v) 30 min before heat radiation to the tail. The control group received the same volume of saline. Tail withdrawal latency was measured as the time taken to withdraw the tail the from light beam (22).

Molecular Docking

Molecular docking was carried out using the Maestro software suite (Maestro, version 7.5, Schrödinger, New York). The muralatin L molecule was drawn using the builder tool in Maestro and then optimized for docking in Ligprep. The TRPV1 crystal structure (Protein Data Bank code 3J5R) was prepared for the docking following the Glide standard procedure (23). Grids defining the protein receptor were generated considering the binding mode of capsaicin (24).

Statistical Analysis

All data are expressed as mean ± S.E. Statistical significance was assessed by Student's t test using Prism 5.0 software. A value of p < 0.05 was considered to represent statistical significance. EC50 is the concentration for half-maximal effect.

Results

Identification of a Structurally Novel TRPV1 Agonist by Cell-based FlexStation 3 Calcium Assay

The genus Murraya contains nine species in China, and we collected and extracted all these species using 95% aqueous ethanol. A primary screening of these extracts was carried out against TRP channels, including TRPV1, TRPV3, Trpv4, and TRPA1, using FlexStation calcium assay. The extract of M. alata at the concentration of 200 μg/ml (Fig. 1A) was found to be active on TRPV1 but not on the other TRP channels. Thus, this plant was selected for further investigations.

FIGURE 1.

FIGURE 1.

Novel coumarin derivative muralatin L identified from M. alata and its activation of TRPV1 channel in FlexStation fluorescent calcium assay. A, image of M. alata, from which muralatin L was isolated. B, chemical structure of coumarin derivative, 8-[(2S)-2-hydroxy-3-methyl-3-butenyl)]-5,6,7-trimethoxycoumarin, named muralatin L, with a molecular mass of 320 daltons. C and D, activation of TRPV1 channel expressed in HEK-293T cells in response to a mixture of fraction A (200 μg/ml), the CHCl3 extract of M. alata, muralatin L (500 μm), and the tool compound capsaicin (5 μm) by FlexStation3 fluorescent calcium assay. The screening scheme consists of 120 or 250 s for test compounds followed by bath application of capsaicin (C) that activates TRPV1 or 10 μm ruthenium red (D) that blocks TRPV1.

Bioassay-guided fractionation of M. alata showed that fraction A (chloroform extract), which was rich in coumarins from HPLC and NMR analysis, was the most active portion. Further fractionation of fraction A by extensive separation techniques, including medium pressure liquid chromatography and preparative TLC, identified a novel coumarin, named muralatin L (Fig. 1B). The structure was determined to be 8-[(2S)-2-hydroxy-3-methyl-3-butenyl)]-5,6,7-trimethoxycoumarin by comprehensive analysis of data obtained from high resolution mass spectroscopy, infrared spectroscopy, and one- and two-dimensional NMR, and electronic circular dichroism assays (data not shown).

Muralatin L, αD24 −37.0 (c 0.10, MeOH), was isolated as light yellow oil with a molecular formula of C17H20O6 determined by the high resolution electrospray ionization-mass spectroscopy ion at m/z 321.1339 [M + H]+ (calculated for C17H21O6, 321.1338). The infrared spectroscopic absorptions indicated the existence of hydroxy (3468 cm−1) and carbonyl (1735 cm−1) functionalities. The 1H and 13C NMR data (Table 1) were similar to those of omphamurin (25) except for the presence of an additional methoxyl (δH 3.80 (3H, s, 6-OCH3), δC 60.7 (C-6)), which was deduced to be located at C-6 by the heteronuclear multiple bond correlations of H-1′ and C-7/C-9, H-4 and C-5/C-9/C-10, OCH3-5/C-5, OCH3-6/C-6, and OCH3-7/C-7. The absolute configuration of C-2′ was established as S based on the observation of positive sign of band E at 365 nm in its Rh2 (OCOCF3)4-induced electronic circular dichroism spectrum. Thus, the structure of muralatin L was defined as 8-[(2S)-2-hydroxy-3-methyl-3-butenyl)]-5,6,7-trimethoxycoumarin(Fig. 1B).

TABLE 1.

NMR data for muralatin L (in CDCl3, δ in ppm)

Position Muralatin L
δH (J in Hz) δC
2 160.7
3 6.18, d (9.7) 113.3
4 7.88, d (9.7) 138.6
5 148.0
6 141.7
7 155.6
8 115.6
9 148.8
10 109.4
1′ 3.02, m; 2.92, m 29.7
2′ 4.24, m 75.0
3′ 147.1
4′ 4.71, d (5.6); 4.83, d (5.6) 110.3
5′ 1.80, s 17.8
5-OCH3 3.93, s 61.6
6-OCH3 3.80, s 60.7
7-OCH3 3.92, s 61.1

As shown in Fig. 1C, both fraction A (200 μg/ml) and muralatin L (500 μm) were found to be able to significantly increase the intracellular calcium level in TRPV1-expressing cells, as compared with the positive control capsaicin (5 μm) that specifically activates TRPV1. The increased calcium signal can be inhibited by TRPV channel blocker ruthenium red (Fig. 1D). These results indicate that the coumarin muralatin L is a novel TRPV1 channel agonist.

Dose-dependent and Selective Activation of TRPV1 by Muralatin L in HEK-293T Cells

To confirm the effect of muralatin L on TRPV1, we utilized calcium imaging and detected the intracellular fluorescent calcium level in HEK-293T cells expressing TRPV1 channels in response to either test compound or capsaicin. Non-transfected cells showed no elevation of fluorescent calcium as determined by the ratio of Fura-2 in response to either muralatin L (500 μm) or capsaicin (5 μm) (Fig. 2A). In contrast, 500 μm muralatin L induced a sharp increase of the intracellular calcium fluorescence and a further small increase of calcium fluorescence signal upon addition of 5 μm capsaicin (Fig. 2B), confirming that the elevated calcium resulted from activating the TRPV1 channels. To further confirm the muralatin L effect, we performed whole-cell patch clamp recordings of HEK-293T cells expressing TRPV1 channels. Bath application of muralatin L (300 μm) elicited the activation of TRPV1 current, and the effect could be washed out before further activation of TRPV1 by capsaicin (1.0 μm) (Fig. 3A, left panel). The effect of muralatin L on activating TRPV1 was further confirmed by ramp recordings (Fig. 3A, right panel). Application of different concentrations of muralatin L from 0.3 μm to 3 mm resulted in a dose-dependent activation of the TRPV1 current (Fig. 3B). As compared with the potency and maximum effect of capsaicin, fitting the data from dose-dependent activation of TRPV1 by muralatin L with the Hill equation yielded an EC50 value of 205.6 ± 27.4 μm (n = 7) and a Hill coefficient of 1.14, confirming that muralatin L is an activator of TRPV1 with an equal maximum efficacy like capsaicin (Fig. 3C). In addition, we observed no difference between saturated 3 mm muralatin L-induced current and the current from a mixture of saturated muralatin L (3 mm) with saturated capsaicin (10 μm) (Fig. 3D). The current induced by muralatin L (500 μm) was concentration-dependently blocked by 0.01, 0.1, and 1.0 μm JNJ-17203212, a competitive TRPV1 antagonist (Fig. 3E). All these results suggest that muralatin L is a full agonist of TRPV1.

FIGURE 2.

FIGURE 2.

Muralatin L induces Ca2+ influx in TRPV1-expressing HEK-293T cells. A, left panels, live-cell fluorescent imaging of untransfected cells (top panels). Right panel, average effects of Fura-2 ratios induced by muralatin L (blue arrow) and capsaicin (red arrow) in untransfected cells (top panel, n = 50). B, left image panels, cells expressing hTRPV1 (bottom panels) in response to application of 500 μm muralatin L or 5 μm capsaicin. Right panel, average effects of Fura-2 ratios induced by muralatin L (blue arrow) and capsaicin (red arrow) in cells expressing hTRPV1 (bottom panel, n = 54). The experiment was repeated three times.

FIGURE 3.

FIGURE 3.

Dose-dependent activation of TRPV1 current by muralatin L in HEK-293T cells expressing TRPV1 channel. A, left panel, whole-cell current of TRPV1 in response to 300 μm muralatin L and 1 μm capsaicin. Right panel, current-voltage curves of TRPV1 in response to voltage ramps from −100 mV to +100 mV under control condition (0) or after addition of 300 μm muralatin L (1), 1 μm capsaicin (2), and back to baseline (3). B, representative whole-cell currents of TRPV1 channels activated by increasing the concentrations of muralatin L from 0.3 μm to 3.0 mm. C, curve fitting in red represents dose-dependent activation of TRPV1 by capsaicin with an EC50 of 98.1 nm (n = 6 for all data points). Curve fitting in blue represents dose-dependent activation of TRPV1 by muralatin L with EC50 at 205.6 μm; each data point is expressed as mean ± S.E. of 6–9 independent tests. D, whole-cell current of TRPV1 in response to 3 mm muralatin L or a mixture of 10 μm capsaicin with 3 mm muralatin L. E, TRPV1 current evoked by 500 μm muralatin L was inhibited by each application of 0.01, 0.1, and 1 μm TRPV1 potent antagonist JNJ-17203212.

To test whether muralatin L could induce channel desensitization, we repeatedly administered muralatin L (1 mm) or capsaicin (1 μm) and observed progressive reduction of TRPV1 currents (Fig. 4, A and B). Muralatin L produced a greater degree of macroscopic current desensitization than capsaicin upon its repetitive applications, resulting in the reduction of original current of about 63 ± 5.4% (n = 3) after seven applications of muralatin L, as compared with only a 29 ± 1.6% (n = 3) reduction for capsaicin. This result indicates that muralatin L causes a greater TRPV1 receptor desensitization than that of capsaicin (Fig. 4C).

FIGURE 4.

FIGURE 4.

Comparison of TRPV1 desensitization was induced by repeated applications of either muralatin L (A) or capsaicin (B). 1 mm muralatin L or 1 μm capsaicin was applied for 10 s with intervening washout periods of 1 min. Whole-cell current responses were evoked by muralatin L or capsaicin in TRPV1-transfected HEK-293T cells with Ca2+-free solution. C, summary of the percentage of the initial current after seven repeated applications of capsaicin or muralatin L from A and B (n = 3). **, p < 0.01, for comparison of desensitization between capsaicin- and muralatin L-induced currents.

To evaluate the selectivity of muralatin L on other TRPV members, we tested its effects on TRPV2, TRPV3, and TRPV4 channels individually expressed in HEK-293T cells. Currents were elicited by 400-ms voltage ramps from −100 to +100 mV. At the concentration of 300 μm, muralatin L had no effects on TRPV2, TRPV3, and TRPV4, whereas each application of their corresponding channel agonists such as 1.0 mm 2-APB, 300 μm 2-APB, and 100 nm GSK1016790A induced robust activation of the channel current, respectively (Fig. 5, left panels). Voltage ramp recordings further confirmed that muralatin L had no effects on TRPV2, TRPV3, and TRPV4 channels (Fig. 5, right panels).

FIGURE 5.

FIGURE 5.

Selectivity of muralatin L over other members of TRPV channel family. Whole-cell currents (left panels) were recorded in HEK-293T cells expressing different TRPV channels, mouse Trpv2 (A), human TRPV3 (B), and mouse Trpv4 (C), in response to muralatin L (300 μm) and their corresponding agonists as positive controls (left panels). Cells were held at 0 mV in left panels. Representative ramp currents are shown in right panels in response to 300 μm muralatin L (labeled as 0 in the left panels), and their agonists (labeled as 1 in the left panels) and washout (labeled as 2 in the left panels). Blue and red bars in the left panels indicate the time course of muralatin L and tool compound applications, respectively. The experiment was repeated at least three times.

Activation of Endogenous TRPV1 Currents by Muralatin L in Mouse DRG Neurons

Murraya plants as medicinal herbs have been reported for relief of pain (Editorial Committee of the Administration Bureau of Traditional Chinese Medicine, 1999). To test whether muralatin L could activate native TRPV1 currents expressed in DRG sensory neurons where TRPV1 plays a critical role in nociception, we acutely dissociated mouse DRG neurons and performed outside-out patch clamp recordings. As shown in Fig. 5A, a robust TRPV1-like current was elicited upon application of 1 μm capsaicin from DRG neurons (4 of 17), confirming the current was mediated by TRPV1 activation. Membrane patches from DRG neurons were first exposed to 1 μm capsaicin to identify TRPV1-expressing cells before application of muralatin L. Similar to the capsaicin effect, further application of 1 mm muralatin L also resulted in a large TRPV1 current. Repeated applications of muralatin L also resulted in current desensitization (Fig. 6A). These results indicate that muralatin L can activate endogenous TRPV1 current in DRG neurons, likely exerting antinociceptive action by current desensitization.

FIGURE 6.

FIGURE 6.

Muralatin L activates native TRPV1 current in capsaicin-sensitive DRG neurons. A, 1 μm capsaicin or 1 mm muralatin L activated currents in outside-out patches from DRG neurons. Membrane patches from DRG neurons were first exposed to 1 μm capsaicin to identify TRPV1-expressing cells. Muralatin L was applied to capsaicin-responsive membrane patches after capsaicin was washed from the bath. B, representative current traces activated by capsaicin or muralatin L from A. Traces are shown from the experiments obtained by stepping the voltage from 0 to 80 mV for 600 ms. Right panel, in response to 1 μm capsaicin (labeled as 1 in the left panels) and 1 mm muralatin L (labeled as 2, 3, and 4 in the left panels), and baseline (labeled as 0 in the left panels). The experiment was repeated at least three times.

Reversal of Inflammatory Pain by Muralatin L and Lack of Its Effect in Trpv1 Knock-out Mice

To test the effect of muralatin L on pain, we utilized several rodent models of pain induced by noxious chemicals, acid, or heat. Intraplantar injection of 1% formalin into either WT or Trpv1 KO mice elicited pain response of mice in two phases as follows: phase I, an early nociceptive response (0–5 min) caused by direct stimulation of C-fiber nociceptors; and phase II, a later second phase of nociceptive behavior (15–30 min) (26), which was observed by the time licking paws (Fig. 7). As shown in Fig. 7A, there was no significant difference between the WT and Trpv1 KO groups in the either phase. In addition, intraplantar injections of either muralatin L (10 mg/kg) or capsaicin (1 μm) into Trpv1 KO mice had no effect on paw licking (Fig. 7A), further confirming that muralatin L, like capsaicin, could not induce pain response in Trpv1-deficient mice. In contrast, inflammatory paw of pain induced by formalin in WT mice, intraperitoneal injection of muralatin L at 10 and 40 mg/kg, caused a dose-dependent decrease of phase II response of inflammatory pain induced by paw injection of formalin about 56% and 95%, respectively, as compared with the group of vehicle control (Fig. 7B).

FIGURE 7.

FIGURE 7.

Inhibition of inflammatory pain by muralatin L and lack of muralatin L effect in Trpv1 knock-out mice. A, induction of pain responses in C57BL/6 WT mice or Trpv1 knock-out mice by intraplantar injection of formalin, capsaicin, muralatin L, or vehicle, respectively. B, time of paw licking was measured during phase I (0–5 min post-injection) and phase II (15–30 min post-injection) following intraplantar injection of formalin in Kunming mice. C, muralatin L (10 and 40 mg/kg, intraperitoneal) and morphine (0.2%, intraperitoneal) were effective in reducing abdominal writhing induced by intraperitoneal injection of acetic acid in C57BL/6 mice (number of writhes, WT vehicle: 63 ± 4.7). D, number of writhes was measured for Trpv1 knock-out mice in different groups (Trpv1−/− vehicle: 26 ± 2.4). E, muralatin L had no effect on threshold of thermal pain induced by heat radiation to tail (Kunming mice). Data points are mean ± S.E. (n = 6). Significance of statistical differences between the vehicle control and treatment groups is indicated by **, p < 0.01; or ***, p < 0.001.

We also tested the effect of muralatin L on inflammatory pain induced by intraperitoneal injection of acetic acid (1.6%) in mice. As a positive control, injection (intraperitoneal) of morphine (0.2%) caused an analgesic effect by reducing abdominal writhing (Fig. 7C). Similarly, muralatin L resulted in a dose-dependent decrease of writhing, and the writhing numbers were decreased about 53% and 78% at the dose of 10 and 40 mg/kg (intraperitoneal), respectively, as compared with the vehicle control (Fig. 7C). To further confirm the effect of muralatin L on writhing induced by intraperitoneal injection of acetic acid, we also evaluated the effect of muralatin L on abdominal writhing in Trpv1 KO mice. The results showed that muralatin L had no further effect on reducing abdominal writhing as compared with the vehicle of Trpv1 KO mice, whereas morphine still caused an analgesic effect (Fig. 7D). These results indicate that muralatin L inhibits the inflammatory pain by directly acting on and desensitizing TRPV1 channel.

In addition, we tested the effect of muralatin L on thermal pain induced by a light beam focused on the middle portion of the tail. In the thermo-nociceptive test, muralatin L had no effect on reducing thermal pain, as compared with morphine that resulted in reduction of thermo-nociception by increasing latency time (Fig. 7E).

Prediction of TRPV1-binding Sites for Muralatin L by Modeling

The recent cryo-EM structure of rat TRPV1 reveals that there are two constrictions that gate the ion conductance pathway as follows: a funnel-like extracellular pore forming the selectivity filter that functions as an upper gate, and the middle of the S6 helix that constitutes the lower gate where capsaicin binds (27). To explore the binding sites of muralatin L for TRPV1, we docked the muralatin L molecule into the TRPV1 structure using Maestro Suite software (23). The docking results reveal that muralatin L is sequestered in a pocket that is formed by the residues Tyr-511 from S3, Met-547 and Thr-550 from S4, and Glu-570 in the S4-S5 linker of TRPV1. Muralatin L binds to TRPV1 through the C-2′-hydroxy group that is critical for a hydrogen bonding interaction with Tyr-511, and the aromatic area and C-3′-methyl group interact with the hydrophobic regions being composed of Leu-515, Met-547, Thr-550, Glu-570, and Leu-577 (Fig. 8, B and C), respectively. We also performed a docking analysis of capsaicin with its binding pocket in TRPV1, displaying a similar binding pattern to muralatin L (Fig. 8D). Muralatin L and capsaicin were found to contain two similar pharmacophoric regions by comparing the sequence alignment of the low-gate domains in TRPV1–4 (Fig. 8, E and F). To test the importance of the critical residues identified from the docking, we constructed two mutants of human TRPV1 in which Tyr-511 or Thr-550 was substituted by alanine (hTRPV1Y511A and hTRPV1T550A), respectively. The Y511A mutant was functional as determined by activation of 3 mm 2-APB, but it was insensitive to either capsaicin or muralatin L (Fig. 8G), indicating that the residue Tyr-511 that forms the hydrogen bond with muralatin L is critical for muralatin L binding. In contrast, the T550A mutant retained the channel sensitivity to both capsaicin and muralatin L (Fig. 8H). We also tested the effect of muralatin L on other residues such as Leu-515, Leu-547, Glu-570, and Leu-577, that are in close proximity to muralatin L (Fig. 8C). Mutating the individual four residues to alanine retained the robust sensitivity to either capsaicin or 2-APB, and all four mutants, L515A, L547A, E570A, and L577A were also robustly activated by 100 μm muralatin L, suggesting that these residues play a minor role in interacting with muralatin L (data not shown).

FIGURE 8.

FIGURE 8.

Putative binding sites for muralatin L in rat TRPV1 channel. A, location of four key residues mapped to the cryo-EM structure of rat TRPV1 (Protein Data Bank code 3J5R). The molecular surface of muralatin L is shown in blue, and key residues are in purple. B, side view of molecular docking of muralatin L into rat TRPV1 using Maestro Suite software. Amino acid side chains of residues Tyr-511, Met-547, Thr-550, and Glu-570 in TRPV1 are shown in pink. The helices are in gray, and the helices of the neighboring monomer are displayed as line ribbons. The ligand is depicted as a blue tube. Hydrogen bonds are black dashed lines. C, representative ichnography of muralatin L interacting with related amino acids of TRPV1. D, docked view of interactions between muralatin L and capsaicin with rat TRPV1 subunits. The binding pocket is composed of residues located in S3, S4, and S5. The key interacting residues are marked and displayed as a thin tube presenting in purple. The chemical structures of muralatin L and capsaicin are shown in blue and red, respectively. E, two compounds are both composed of two pharmacophoric regions as follows: the aromatic A-region and the double bond-participated junction B-region; in addition, capsaicin also possesses a hydrophobic side chain (C-region). F, sequence alignment and comparison of low-gate domains in TRPV1–4. Secondary structure elements are shown above the sequence alignment. Triangles (blue) are indicated as key residues. Current traces of TRPV1 Y511A mutant (G) and TRPV1 T550A mutant (H) expressed in HEK-293T cells in responses to muralatin L or capsaicin or 2-APB.

Discussion

The goal of this study was to identify active components from the genus Murraya that are widely used for pain relief as in traditional Chinese medicines and to investigate their molecular mechanisms of action. We isolated muralatin L, a structurally novel coumarin derivative from M. alata, through the bioactivity-guided fractionation, and we confirmed that muralatin L specifically activates TRPV1 and reverses inflammatory pain in mice. Our findings not only demonstrate the mechanism of action for muralatin L but also point to the possibility of identifying more structurally diversified natural compounds targeting TRP channels from the flowering plants such as Murraya genus.

Murraya is a popular genus of the plant family Rutaceae that occurs in tropical and sub-tropical regions of Southeast Asia, China, and northeast Australia. There are nine species and one variety distributed in China, most of which are used as traditional Chinese medicines for treatment of psychogenic pain or somatoform pain disorders (1). For example, the extract of Murraya paniculata is used to treat headache, dentalgia, gastralgia, and rheumatalgia, and the 50% aqueous ethanol extract of its root is also clinically used as a topical anesthetic. The extract of Murraya tetramera is regarded as a specific medicine for the management of rheumatic pains at Longzhou District in Guangxi Province in China. Moreover, some of Murraya plants have also been developed into drugs such as the prestigious Sanjiuweitai Granula, which is composed of Murraya exotica, Evodia lepta, Zanthoxylum nitidum, etc. for treatment of gastralgia and different kinds of gastritis, including superficial gastritis, erosive gastritis, and atrophic gastritis (28). Because of the widespread use of Murraya extracts in traditional medicines, there have been a number of studies investigating the active compounds as well as their mechanisms of action. Zou and co-workers (29) reported the extracts of all Murraya species distributed in China for their anti-nociceptive effects on abdominal writhing induced by acetic acid in mice. Among the tested Murraya plants, M. alata shows the highest inhibitory activity on pain (29). These findings have promoted the further study for identification of their active ingredients. Wu et al. (30) identified six coumarins from the 70% aqueous ethanol extract of M. exotica, and one of the isolates, murracarpin, exhibits substantial potent activities in anti-nociception and anti-inflammation (31).

Many studies on Murraya have been focused on the analgesic effects of the plant extracts as well as the compounds purified from the extracts in animal model tests; however, little is known about the mechanisms underlying the antinociceptive action of Murraya plants. Recently, Chen et al. (16) reported a known furanocoumarin, imperatorin, from the Angelica dahurica root extract as a new class of partial agonist of TRPV1, exhibiting an EC50 value of 12.6 ± 3.2 μm. Imperatorin delays TRPV1 recovery from desensitization and most likely acts via a site adjacent to or overlapping the TRPV1 capsaicin-binding site.

Our primary screening identified the extract from the plant M. alata to be the most potent in activating TRPV1 among several Murraya extracts, which is consistent with the report by Zou et al. (29). The use of TRPV1 agonists is aimed at achieving desensitization of sensory neurons (8). Topical capsaicin has been used as folk medicine to relieve pain for centuries. Capsaicin is not the only plant-derived agent as the TRPV1 agonist (3) and some other natural products such as eugenol, camphor, evodiamine, thymol, and carvacrol can also activate TRPV1 (4, 5, 32, 33). The drawback of using capsaicin, however, is that capsaicin products are associated with an intolerable burning sensation and the need for multiple applications for weeks to mediate their analgesic effects (12). Genetic and pharmacological studies have shown that TRPV1 is an essential component of the cellular signaling mechanisms through which injury produces thermal hyperalgesia and pain hypersensitivity (34–36). The mechanism of pain relief has been proposed to be due to desensitization of the receptor or degeneration of the nerve terminals (37, 38). This phenomenon is a Ca2+-mediated process in which Ca2+ entry results in a sufficiently high Ca2+ concentration to trigger desensitization. Desensitization is now mainly considered to be a dephosphorylation event (39). Through the process of desensitization, a neuron can diminish its overall response to a particular chemical, physical, or electrical signal (38). According to the result from our Fig. 4A, muralatin L induces the desensitization of TRPV1, thus leading to pain relief. There are two likely explanations for the anti-nociceptive effect of muralatin L. One is that the muralatin L-induced current is reduced in part due to the acute desensitization phase, similar to the effect of camphor (4). The other is the progressive desensitization of TRPV1 current with repetitive applications of muralatin L, presenting a greater current desensitization than capsaicin (Fig. 4C). Imperiatorin is an agonist for TRPV1 channel and delays the recovery of TRPV1 from the desensitization (16). Compared with imperiatorin, muralatin L as a coumarin derivative shares some structural similarity with imperiatorin. Muralatin L also has a similar property with piperine and produces a greater degree of macroscopic desensitization compared with capsaicin (40). The desensitization of the channel prevents continued perception of the stimulus, which makes the investigation of TRPV1 agonists as analgesics for the treatment of chronic pain (41).

Muralatin L is potent in reducing abdominal writhing induced by acetic acid and formalin-induced phase II pain in mice. Formalin is known to evoke nocifensive behaviors in two phases, the first of which is thought to be due to a direct chemonociceptive effect, and the second phase is mainly mediated by inflammatory reactions (26). Our results prove that muralatin L mainly relieves the inflammatory pain. Interestingly, muralatin L has no effect on reducing thermal pain in WT mice. Hot temperature (more than 43 °C) activates TRPV1 channels that cause excruciating pain (3), and Trpv1 knock-out mice show dramatic reduction of hypersensitivity to heat during inflammation (35, 36). We observed a similar phenomenon in our tests in which Trpv1 KO mice exhibit a significant reduction of acetic acid-induced pain, and TRPV1-specific muralatin L is ineffective in reducing pain in Trpv1 KO mice, suggesting that TRPV1 is directly involved in this model. However, in a formalin-induced pain model, Trpv1 KO mice show a similar response as WT mice. We speculate that there are two possible explanations. First, mice lacking trpv1 gene can often exhibit some undefined behaviors. It has been shown that formalin-induced acute chemonociception (or carrageenan-evoked subacute inflammatory mechanical hyperalgesia) remains the same between WT and Trpv1 KO mice, in which the participation of TRPV1 in formalin-induced inflammatory pain can be negligible (42). Moreover, mice lacking thermo-TRPV1 are still able to respond to noxious heat and show no significant difference in hot plate responses between WT and Trpv1 KO mice (36). The heat threshold of Trpv1 KO mice is not different from that of WT animals, although intraplantar injection of TRPV1 agonist resiniferatoxin induces a profound drop of heat threshold (43). Second, inflammatory pain induced by formalin can be mediated by many factors such as cytokines and cyclooxygenase products besides ion channels (44). Although muralatin L shows selectivity on TRPV1 among the TRP channels tested, we cannot rule out any effect of muralatin L on non-channel targets that are involved in inflammatory pain.

Molecular docking results indicate that muralain L interacts with TRPV1 by a similar fashion as capsaicin, suggesting the resembled action mode for muralatin L and capsaicin in activating TRPV1. Interestingly, muralatin L and capsaicin show some structural similarities. They both possess the aromatic A-region and the double bond-participating junction B-region. In a different way, muralatin L lacks the hydrophobic side chain (C-region) compared with capsaicin, which is a possible reason for its lower activity (Fig. 8E). In future structural modification, lengthening the C-8 substituent group of muralatin L or introducing an appropriate hydrophobic chain at the position of C-2′-OH might result in promoting TRPV1 activation. Taking imperatorin, the previously reported TRPV1 agonist, into consideration, we find that imperatorin is a structurally simple furanocoumarin that possesses an additional furan ring fused at the C-5 and C-6 positions of the coumarin nucleus compared with muralatin L (Fig. 1B), suggesting a feasible entry for the modification of the “A-region” of muralatin L to improve its activity. The docking also provides some hits for the selectivity of muralatin L on TRPV1. By aligning the sequence of low-gate domains of TRPV1 with other TRPV channels, it is noticeable that this part of homology between TRPV members is not well conserved, particularly in the region between S3 and S5. The residues Tyr-511, Met-547, Thr-550, and Glu-570 are clustered at the lower gate. However, TRPV2, TRPV3, and TRPV4 contain distinct residues such as Glu-570 in TRPV2, TRPV3, and TRPV4, as compared with Glu-570 in TRPV1 (Fig. 8F). The Tyr-511 in TRPV1 has been proven to be a critical residue for the action of muralatin L.

Although a weaker agonist compared with capsaicin, muralatin L presents a stronger desensitization than capsaicin upon its repetitive applications and also exhibits considerable efficacy for pain relief in vivo. Thus, muralatin L renders less dosing frequency and likely possesses fewer side effects than the strong TRPV1 activator such as capsaicin. Considering the non-addictive and non-drug-resistant properties of muralatin L as complementary and alternative medicine, we speculate that muralatin L may have a wide potential in pain-related therapy.

In summary, we have demonstrated that the structurally novel coumarin derivative muralatin L, isolated from the M. alata, can selectively activate TRPV1, providing a basis for Murraya extracts as traditional use for pain relief. Our findings also highlight the potential of coumarin analogues for broad pharmaceutical applications, and muralatin L as a second coumarin-based TRPV1 activator possesses the developmental potential for pain therapy.

Author Contributions

N. W. and H. L. conducted the majority of experiments, including isolation of the natural products, FlexStation3 assay, patch clamp recording, calcium imaging, molecular docking, animal behavior tests, and data analysis; Y. W. assisted with fluorescent calcium assay development and rat DRG neuron dissociation; R. L. and S. Y. provided Trpv1 knockout mice for us and supervised animal assays. X. S. conducted FlexStation3 assay. Y. J. supervised molecular docking; N. W., H. L., and Y. W. prepared the draft; K. W. W. and Y. J. conceived and supervised the project, participated in data analysis, and finalized the manuscript writing.

Acknowledgments

We are grateful for the discussion with laboratory members Drs. X. Bian and J. Zhou and the assistance from H. Li. K. W. W. wishes to thank J. M. Wang for consistent support during this research.

*

This work was supported by Ministry of Science and Technology of China Research Grants 2013CB531302, 2013ZX09103001-015, and 2014ZX09507003-006-004 (to K. W. W.), National Natural Sciences Foundation of China Grants 81222051 and 81473106, and National Key Technology R&D Program “New Drug Innovation” of China Grants 2012ZX09301002-002-002 and 2012ZX09304-005 (to Y. J.). The authors declare that they have no conflicts of interest with the contents of this article.

4
The abbreviations used are:
TRPV
transient receptor potential vanilloid
TRP
transient receptor potential
2-APB
2-aminoethyl diphenylborinate
DRG
dorsal root ganglion.

References

  • 1.Song L. R. (1999) Chinese Materia Medica (Zhong Hua Ben Cao) Vol. 4, pp. 961–948, Shanghai Science & Technology Press, Shanghai, China [Google Scholar]
  • 2.Nahin R. L., Barnes P. M., Stussman B. J., and Bloom B. (2009) Costs of complementary and alternative medicine (CAM) and frequency of visits to CAM practitioners: United States 2007. Natl. Health Stat. Report 30, 1–14 [PubMed] [Google Scholar]
  • 3.Caterina M. J., Schumacher M. A., Tominaga M., Rosen T. A., Levine J. D., and Julius D. (1997) The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816–824 [DOI] [PubMed] [Google Scholar]
  • 4.Xu H., Blair N. T., and Clapham D. E. (2005) Camphor activates and strongly desensitizes the transient receptor potential vanilloid subtype 1 channel in a vanilloid-independent mechanism. J. Neurosci. 25, 8924–8937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yang B. H., Piao Z. G., Kim Y. B., Lee C. H., Lee J. K., Park K., Kim J. S., and Oh S. B. (2003) Activation of vanilloid receptor 1 (VR1) by eugenol. J. Dent. Res. 82, 781–785 [DOI] [PubMed] [Google Scholar]
  • 6.Bhardwaj R. K., Glaeser H., Becquemont L., Klotz U., Gupta S. K., and Fromm M. F. (2002) Piperine, a major constituent of black pepper, inhibits human P-glycoprotein and CYP3A4. J. Pharmacol. Exp. Ther. 302, 645–650 [DOI] [PubMed] [Google Scholar]
  • 7.Siemens J., Zhou S., Piskorowski R., Nikai T., Lumpkin E. A., Basbaum A. I., King D., and Julius D. (2006) Spider toxins activate the capsaicin receptor to produce inflammatory pain. Nature 444, 208–212 [DOI] [PubMed] [Google Scholar]
  • 8.Szallasi A., and Blumberg P. M. (1999) Vanilloid (Capsaicin) receptors and mechanisms. Pharmacol. Rev. 51, 159–212 [PubMed] [Google Scholar]
  • 9.Owsianik G., Talavera K., Voets T., and Nilius B. (2006) Permeation and selectivity of TRP channels. Annu. Rev. Physiol. 68, 685–717 [DOI] [PubMed] [Google Scholar]
  • 10.Szallasi A., and Di Marzo V. (2000) New perspectives on enigmatic vanilloid receptors. Trends Neurosci. 23, 491–497 [DOI] [PubMed] [Google Scholar]
  • 11.Tominaga M., and Tominaga T. (2005) Structure and function of TRPV1. Pflugers Arch. 451, 143–150 [DOI] [PubMed] [Google Scholar]
  • 12.Szallasi A., Cortright D. N., Blum C. A., and Eid S. R. (2007) The vanilloid receptor TRPV1: 10 years from channel cloning to antagonist proof-of-concept. Nat. Rev. Drug Discov. 6, 357–372 [DOI] [PubMed] [Google Scholar]
  • 13.Armero P., Muriel C., Lopez M., Santos J., and Gonzalez-Sarmiento R. (2012) Analysis of TRPV1 gene polymorphisms in Spanish patients with neuropathic pain. Med. Clin. 139, 1–4 [DOI] [PubMed] [Google Scholar]
  • 14.Niiyama Y., Kawamata T., Yamamoto J., Omote K., and Namiki A. (2007) Bone cancer increases transient receptor potential vanilloid subfamily 1 expression within distinct subpopulations of dorsal root ganglion neurons. Neuroscience 148, 560–572 [DOI] [PubMed] [Google Scholar]
  • 15.Jones V. M., Moore K. A., and Peterson D. M. (2011) Capsaicin 8% topical patch (Qutenza)–a review of the evidence. J. Pain Palliat. Care Pharmacother. 25, 32–41 [DOI] [PubMed] [Google Scholar]
  • 16.Chen X., Sun W., Gianaris N. G., Riley A. M., Cummins T. R., Fehrenbacher J. C., and Obukhov A. G. (2014) Furanocoumarins are a novel class of modulators for the transient receptor potential vanilloid type 1 (TRPV1) channel. J. Biol. Chem. 289, 9600–9610 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lei L., Cao X., Yang F., Shi D. J., Tang Y. Q., Zheng J., and Wang K. (2013) A TRPV4 channel C-terminal folding recognition domain critical for trafficking and function. J. Biol. Chem. 288, 10427–10439 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.de la Roche J., Eberhardt M. J., Klinger A. B., Stanslowsky N., Wegner F., Koppert W., Reeh P. W., Lampert A., Fischer M. J., and Leffler A. (2013) The molecular basis for species-specific activation of human TRPA1 protein by protons involves poorly conserved residues within transmembrane domains 5 and 6. J. Biol. Chem. 288, 20280–20292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang F., Liu S., Yang F., Zheng J., and Wang K. (2011) Identification of a tetrameric assembly domain in the C terminus of heat-activated TRPV1 channels. J. Biol. Chem. 286, 15308–15316 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cao X., Yang F., Zheng J., and Wang K. (2012) Intracellular proton-mediated activation of TRPV3 channels accounts for the exfoliation effect of α-hydroxyl acids on keratinocytes. J. Biol. Chem. 287, 25905–25916 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Salazar H., Llorente I., Jara-Oseguera A., García-Villegas R., Munari M., Gordon S. E., Islas L. D., and Rosenbaum T. (2008) A single N-terminal cysteine in TRPV1 determines activation by pungent compounds from onion and garlic. Nat. Neurosci. 11, 255–261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang S., Xiao Y., Kang D., Liu J., Li Y., Undheim E. A., Klint J. K., Rong M., Lai R., and King G. F. (2013) Discovery of a selective NaV1.7 inhibitor from centipede venom with analgesic efficacy exceeding morphine in rodent pain models. Proc. Natl. Acad. Sci. U. S. A. 110, 17534–17539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Friesner R. A., Banks J. L., Murphy R. B., Halgren T. A., Klicic J. J., Mainz D. T., Repasky M. P., Knoll E. H., Shelley M., Perry J. K., Shaw D. E., Francis P., and Shenkin P. S. (2004) Glide: a new approach for rapid, accurate docking and scoring. 1. Method and assessment of docking accuracy. J. Med. Chem. 47, 1739–1749 [DOI] [PubMed] [Google Scholar]
  • 24.Cao E., Liao M., Cheng Y., and Julius D. (2013) TRPV1 structures in distinct conformations reveal activation mechanisms. Nature 504, 113–118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wu T. (1981) Omphamurin–a new coumarin from Murraya omphalocarpa. Phytochemistry 20, 178–179 [Google Scholar]
  • 26.Tjølsen A., Berge O. G., Hunskaar S., Rosland J. H., and Hole K. (1992) The formalin test: an evaluation of the method. Pain 51, 5–17 [DOI] [PubMed] [Google Scholar]
  • 27.Nilius B., and Szallasi A. (2014) Transient receptor potential channels as drug targets: from the science of basic research to the art of medicine. Pharmacol. Rev. 66, 676–814 [DOI] [PubMed] [Google Scholar]
  • 28.Gao Y., Xie Q., and Xiong Y. (2009) Study on quality standard for Sanjiu Weitai granules. Zhongguo Yaoshi 12, 691–693 [Google Scholar]
  • 29.Zou L., Yang C., and Zheng H. (2000) Study on the analgesic effects of Murraya plants. Zhongguo Yiyao Xuebao 15, 298–300 [Google Scholar]
  • 30.Wu L., Li P., Wang X., Zhuang Z., Farzaneh F., and Xu R. (2010) Evaluation of anti-inflammatory and antinociceptive activities of Murraya exotica. Pharm. Biol. 48, 1344–1353 [DOI] [PubMed] [Google Scholar]
  • 31.Arora R. K., Kaur N., Bansal Y., and Bansal G. (2014) Novel coumarin–benzimidazole derivatives as antioxidants and safer anti-inflammatory agents. Acta Pharm. Sin. B 4, 368–375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pearce L. V., Petukhov P. A., Szabo T., Kedei N., Bizik F., Kozikowski A. P., and Blumberg P. M. (2004) Evodiamine functions as an agonist for the vanilloid receptor TRPV1. Org. Biomol. Chem. 2, 2281–2286 [DOI] [PubMed] [Google Scholar]
  • 33.Xu H., Delling M., Jun J. C., and Clapham D. E. (2006) Oregano, thyme and clove-derived flavors and skin sensitizers activate specific TRP channels. Nat. Neurosci. 9, 628–635 [DOI] [PubMed] [Google Scholar]
  • 34.Basbaum A. I., Bautista D. M., Scherrer G., and Julius D. (2009) Cellular and molecular mechanisms of pain. Cell 139, 267–284 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Caterina M. J., Leffler A., Malmberg A. B., Martin W. J., Trafton J., Petersen-Zeitz K. R., Koltzenburg M., Basbaum A. I., and Julius D. (2000) Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306–313 [DOI] [PubMed] [Google Scholar]
  • 36.Davis J. B., Gray J., Gunthorpe M. J., Hatcher J. P., Davey P. T., Overend P., Harries M. H., Latcham J., Clapham C., Atkinson K., Hughes S. A., Rance K., Grau E., Harper A. J., Pugh P. L., et al. (2000) Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia. Nature 405, 183–187 [DOI] [PubMed] [Google Scholar]
  • 37.Docherty R. J., Yeats J. C., Bevan S., and Boddeke H. W. (1996) Inhibition of calcineurin inhibits the desensitization of capsaicin-evoked currents in cultured dorsal root ganglion neurones from adult rats. Pflugers Arch. 431, 828–837 [DOI] [PubMed] [Google Scholar]
  • 38.Koplas P. A., Rosenberg R. L., and Oxford G. S. (1997) The role of calcium in the desensitization of capsaicin responses in rat dorsal root ganglion neurons. J. Neurosci. 17, 3525–3537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wong W., and Scott J. D. (2004) AKAP signalling complexes: focal points in space and time. Nat. Rev. Mol. Cell Biol. 5, 959–970 [DOI] [PubMed] [Google Scholar]
  • 40.McNamara F. N., Randall A., and Gunthorpe M. J. (2005) Effects of piperine, the pungent component of black pepper, at the human vanilloid receptor (TRPV1). Br. J. Pharmacol. 144, 781–790 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Szallasi A., and Sheta M. (2012) Targeting TRPV1 for pain relief: limits, losers and laurels. Expert Opin. Investig. Drugs 21, 1351–1369 [DOI] [PubMed] [Google Scholar]
  • 42.Bölcskei K., Helyes Z., Szabó A., Sándor K., Elekes K., Németh J., Almási R., Pintér E., Petho G., and Szolcsányi J. (2005) Investigation of the role of TRPV1 receptors in acute and chronic nociceptive processes using gene-deficient mice. Pain 117, 368–376 [DOI] [PubMed] [Google Scholar]
  • 43.Almási R., Pethö G., Bölcskei K., and Szolcsányi J. (2003) Effect of resiniferatoxin on the noxious heat threshold temperature in the rat: a novel heat allodynia model sensitive to analgesics. Br. J. Pharmacol. 139, 49–58 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Safieh-Garabedian B., Poole S., Allchorne A., Winter J., and Woolf C. J. (1995) Contribution of interleukin-1β to the inflammation-induced increase in nerve growth factor levels and inflammatory hyperalgesia. Br. J. Pharmacol. 115, 1265–1275 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES