Skip to main content
Data in Brief logoLink to Data in Brief
. 2015 Dec 25;6:419–422. doi: 10.1016/j.dib.2015.12.013

Data on Na,K-ATPase in primary cultures of renal proximal tubule cells treated with catecholamines

Mary Taub 1,, Facundo Cutuli 1
PMCID: PMC4710796  PMID: 26866051

Abstract

This data article is concerned with chronic regulation of Na,K-ATPase by catecholamines. After a chronic treatment, inhibition of Na,K-ATPase activity was observed in cultures with dopamine, while a stimulation was observed in cultures treated with norepinephrine. Following a chronic incubation with guanabenz, an α adrenergic agonist, an increase in Na,K-ATPase α and β subunit mRNAs was observed. This data supports the research article entitled, “Renal proximal tubule Na, K-ATPase is controlled by CREB regulated transcriptional coactivators as well as salt inducible kinase 1” (Taub et al. 2015) [1].

Keywords: Catecholamines; Kidney; Proximal tubule; Na,K-ATPase; Chronic


Specifications Table

Subject area Biology
More specific subject area Renal transport regulation
Type of data Figure
How data was acquired Real-Time PCR on a Biorad Cycler, 86Rubidium uptake studies
Data format Analyzed
Experimental factors Primary cultures of rabbit kidney proximal tubule cells treated with catecholamines and control
Experimental features Rb+ uptake into intact cells was examined in triplicate, and standardized with respect to protein, to calculate nmoles of Rb+ uptake per mg protein; in Real-Time PCR, Ct values of Na,K-ATPase and GAPDH mRNAs were obtained from quadruplicate determinations, and used to calculate the relative increase in Na,K-ATPase in catecholamine treated and control cells.
Data source location All analyses and experiments were performed in Buffalo, New York, USA
Data accessibility Data is with this article

Value of the data

  • This data will have an impact on therapies using catecholamines for blood pressure regulation.

  • The data can be compared with other studies of transcriptional regulation of the genes encoding for each of these subunits.

1. Data

The data shown in this report measures changes both in Na,K-ATPase activity and Na,K-ATPase mRNA levels following a chronic incubation of renal proximal tubule cells with catecholamines.

2. Experimental design, materials and methods

2.1. Rubidium uptake studies

Primary cultures of rabbit kidney proximal tubule cells, were prepared as described previously [1,2]. Rabbits employed to obtain the primary cultures were used by procedures approved by the University at Buffalo Institutional Animal Care and Use Committee. The primary cultures were grown in a 50:50 mixture of Dulbecco׳s Modified Eagle׳s medium and Ham׳s F12 (DME/F12) supplemented with 5 µg/ml bovine insulin, 5 µg/ml human transferrin and 5×10−8 M hydrocortisone (i.e. Medium RK-1) [2]. 86Rb+ uptake studies were conducted, as described previously, in K+-free DME/F12 supplemented with insulin, transferrin and indomethacin [3], [4]. Agonists (PGE1, norepinephrine, Fig. 1A, and dopamine, Fig. 1B) were added after a 30 min pre-incubation in this supplemented, K+-free DME/F12 (+/−1 mM ouabain). Subsequently, agonists were added, followed by a 30 min incubation, the addition of 86Rb+ (1 mM), and a 20 min uptake period. Uptake values were corrected for zero time uptake, and standardized with respect to protein. The ouabain-sensitive component of Rb+ uptake was calculated, and divided by the value obtained for ouabain-sensitive Rb+ uptake with untreated controls (Fig. 1). Differences were considered significant if p<0.05 relative to the untreated control value.

Fig. 1.

Fig. 1.

The effect of PGE1, norepinephrine and dopamine on transport. A. Primary RPT cells were incubated 30 min with either 280 nM PGE1, 1 µM norepinephrine or untreated (and +/−ouabain), followed by a 20 min uptake period with 1 mM 86Rb+. Uptake values are averages (+/−SEM) of ouabain-sensitive Rb+ uptake relative to the untreated control. The ouabain-sensitive component of Rb+ uptake was calculated by subtracting the Rb+ uptake observed in the presence of ouabain from total Rb+ uptake. The results were divided by the untreated control value. B. Primary RPT cells were incubated 30 min with either 10 µM dopamine +/−5 µM monensin, or untreated (+/−5 µM monensin). Uptake studies were conducted both in the presence and in the absence of 1 mM ouabain for each of the 4 conditions, followed by a 20 min uptake period with 1 mM 86Rb+. The ouabain-sensitive component of Rb+ uptake was determined as described in part A. *p<0.05 relative to untreated Control.

2.2. Na,K-ATPase mRNA levels

Primary RPT cells were incubated for 4 days with either guanabenz (an α adrenergic agonist), or isoproterenol (a β adrenergic agonist). Subsequently, RNA was purified, and cDNA was synthesized [4]. Specific cDNAs were amplified in a Bio-Rad iCycler. Ct values were calculated, and relative mRNA levels quantitated using GAPDH mRNA as an internal control. Primers designed using Primer-BLAST (NCBI), include primers for rabbit ATP1A1 (Assession number AF235024, ATP1A1_RABIT), TGACTCTCCTGCTCTGAAG, CACAATGGAAGCGAAGTTATC; rabbit ATP1B1 (Assession number AF204927, ATP1B1_RABIT), ACTGGCAAGCGAGATGAAG, ATGGTGAGGTTGGTGAACTG; and rabbit GAPDH (Assession number L23961, RABGLY3PHO), GCCCTCAATGACCACTTTGT, TCATGACAAGGTAGGGCTCC. Increases in the level of Na,K-ATPase α and β subunit mRNA were observed in the presence of guanabenz, and were considered to be significantly elevated relative to the untreated control if p<0.05 (Fig. 2).

Fig. 2.

Fig. 2.

The effect of adrenergic agonists on Na, K-ATPase α and β subunit mRNAs. Primary RPT cells were incubated for 4 days in Medium RK-1 further supplemented with either 10 µM guanabenz, 10 µM isoproterenol, or untreated. After purifying RNA from the cultures, cDNA was synthesized, and the level of α and β mRNA was determined, relative to GAPDH mRNA. Values are averages (+/−SEM) of quadruplicate determinations, and were divided by the values obtained with untreated alpha and beta subunit mRNA controls. *p<0.05 relative to the untreated control alpha (or beta) subunit mRNA.

Acknowledgments

The work received support from NHLBI for 1RO1 HL6976-01 to Dr. Mary Taub.

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.dib.2015.12.013.

Appendix A. Supplementary material

Supplementary material

mmc1.docx (65.5KB, docx)

References

  • 1.Taub M., Garamella S., Kim D., Rajkhowa T., Cutuli F. Renal proximal tubule Na,K-ATPase is controlled by CREB regulated transcriptional coactivators as well as salt inducible kinase 1. Cell. Signal. 2015:2568–2578. doi: 10.1016/j.cellsig.2015.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Taub M. Primary kidney proximal tubule cells. Methods Mol. Biol. 2005;290:231–247. doi: 10.1385/1-59259-838-2:231. [DOI] [PubMed] [Google Scholar]
  • 3.Taub M.L., Wang Y., Yang I.S., Fiorella P., Lee S.M. Regulation of the Na,K-ATPase activity of Madin–Darby canine kidney cells in defined medium by prostaglandin E1 and 8-bromocyclic AMP. J. Cell. Physiol. 1992;151:337–346. doi: 10.1002/jcp.1041510215. [DOI] [PubMed] [Google Scholar]
  • 4.Herman M.B., Rajkhowa T., Cutuli F., Springate J.E., Taub M.L. Regulation of renal proximal tubule Na,K-ATPase by prostaglandins. Am. J. Physiol. Ren. Physiol. 2010;298:F1222–1234. doi: 10.1152/ajprenal.00467.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

mmc1.docx (65.5KB, docx)

Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES