Skip to main content
ZooKeys logoLink to ZooKeys
. 2015 Dec 16;(546):181–195. doi: 10.3897/zookeys.546.5964

Complete mitochondrial DNA sequence of the endangered fish (Bahaba taipingensis): Mitogenome characterization and phylogenetic implications

Linlin Zhao 1, Tianxiang Gao 2, Weihua Lu 3
PMCID: PMC4714352  PMID: 26798311

Abstract Abstract

To understand the systematic status of Bahaba taipingensis within Sciaenidae, the complete mitochondrial genome (mitogenome) sequence of Chinese bahaba has recently been determined by long PCR and primer walking methods. The complete mitochondrial genome is 16500 bp in length and contains 37 mitochondrial genes (13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes) as well as a control region (CR) as other bony fishes. Within the control region, we identified the (ETAS), the central conserved sequence block domain (CSB-D, SCB-E and CSB-F) and the conserved sequence block domain (CSB-1, CSB-2 and CSB-3). Phylogenetic analyses revealed that Bahaba taipingensis is more closely related to Pseudosciaeniae than Argyrosominae and Sciaeninae. Additionally, Bahaba taipingensis is the sister taxon of Miichthys miiuy, and those two are sister to Collichthys plus Larimichthys.

Keywords: Bahaba taipingensis, Sciaenidae, mitochondrial genome, control region, phylogenetic analysis

Introduction

The complete (mtDNA) sequence of vertebrates is a circular molecule with a length of 16-19 kb that includes 37 genes containing 13 protein-coding genes, 2 (rRNA) genes, 22 (tRNA) genes, and a (CR) (Anderson et al. 1981; Boore et al. 1999). The mitochondrial genome is frequently used for phylogenetic studies and population genetic analyses, due to its compact gene organization, fast evolutionary rate, maternal inheritance and lack of genetic recombination (Miya et al. 2003; Inoue et al. 2009). In recent years, complete mitochondrial DNA sequences have been widely used to reconstruct the phylogeny of higher-level taxa (Jondeung et al. 2007; Wang et al. 2008; Yang et al. 2010).

The family Sciaenidae in the order Perciformes is widely distributed throughout the world with approximately 70 genera and 300 species (Nelson 2006). Fishes of this family are popularly known as croakers and drums because of the ability using muscles associated with gas bladder to produce sound. In China, the family comprises 13 genera with about 37 species, and can be divided into seven subfamilies: Johniinae, Megalonibinae, Bahabinae, Sciaeninae, Otolithinae, Argyrosominae, Pseudosciaeniae (Zhu et al. 1963; Cheng et al. 1987; Tetsuji et al. 2000). The Chinese bahaba, Bahaba taipingensis, is one of the largest croakers and has a limited geographical distribution from Zhoushan Island southwards to the Pearl River (Zhu et al. 1963; Lu et al. 2002). Over the past years, its stock has been declining due to heavy catch pressure and environmental degradation, therefore it is defined as National Class II Protected Animals of China and Critically Endangered by the IUCN. There have been a few reports on the general ecology of this specie covering resources, biology, and otolith morphology (Lu et al. 2002; Ye et al. 2001; Ou et al. 2011). Additionally, the phylogenetic relationships of Sciaenidae have been investigated by means of molecular markers (Meng et al. 2004; Chen et al. 2007; Liu et al. 2010; Cheng et al. 2010), but only one study included Bahaba taipingensis (He et al. 2012), which revealed that Bahaba taipingensis is closely related to Pseudosciaeniae.

In this study, we sequenced the complete mtDNA sequence of Bahaba taipingensis for the first time and analyzed its genomic structure. Additionally, we conducted phylogenetic analyses based on the mitochondrial sequence data with the purpose of investigating the phylogenetic position of Bahaba taipingensis within the family Sciaenidae. The information reported in this article will facilitate further investigations of phylogenetic relationships of species in the Sciaenidae.

Materials and methods

Sample collection and DNA extraction

The sample of Bahaba taipingensis was collected from Dongguan offshore water, Guangdong, China. A piece of muscle tissue excised from the individual was preserved in 95% ethanol for DNA extraction. Total genomic DNA from muscle tissue was extracted with a standard phenol/chloroform procedure followed by ethanol precipitation and kept at 4 °C for subsequent use.

Mitochondrial DNA amplification

The complete Bahaba taipingensis mitogenome was amplified using a long-PCR technique (Miya et al. 1999). Six sets of primers (Table 1) were designed based on multiple alignments of the conserved region of the complete mitochondrial DNA sequences of other Sciaenidae fishes: Larimichthys crocea (EU339149), Collichthys niveatus (JN678726), Collichthys lucida (JN857362), Larimichthys polyactis (FJ618559), Miichthys miiuy (HM447240) and Pennahia argentata (HQ890946), as well as previously determined, partial sequences of the 16S rRNA, Cyt b, COI genes and control region. Subsequent sequencing was accomplished by primer walking method. After the sequencing of these fragments, 31 normal PCR primer sets were designed using Premier 5.0 (Primer Biosoft International) to obtain contiguous, overlapping segments of the entire mitogenome. It was necessary that every two contiguous segments overlapped by at least 50 bp to ascertain the accuracy of sequencing.

Table 1.

Primers used to amplify mtDNA of the Bahaba taipingensis.

Segment Primer code Nucleotide sequence(5'-3') Expected product length Annealling temperature
A H16396-F TGAGATCACTAACACTCCTGTA 3064bp 57 °C
H2080-R GTGACCATGAGTTTAACGG
B H2004-F CGCCTGTTTAACAAAAACAT 4174bp 58 °C
H6194-R TAGACTTCTGGGTGGCCAAAGAATCA
C H6108-F CAATGCTTCTAACAGACCG 3388bp 57 °C
H9516-R CAAGACCCGGTGATTGGAA
D H9428-F TTGGCTCTACATTCCTAGC 3554bp 57 °C
H12002-R TAGGCTAGGAGGAAGAAGA
E H11932-F CTCTTGGTGCAAATCCAAG 2471bp 56 °C
H14423-R AGTGCGTCGTTAGCGATTT
F H14326-F AGGACTCTAACCAGGACTA 2181bp 56 °C
H27-R CATCTTAACATCTTCAGTGT

All PCRs were performed in a Takara thermal cycler. Takara Ex-Taq and LA-Taq polymerase (Takara Biomedical) were used for normal and long-PCR reactions, respectively. Long-PCR reactions were carried out in 25 µl reaction mixture containing 15.25 µl of sterile distilled H2O, 2.5 µl of LA-Buffer, 4 µl of dNTP, 1 µl of each primer (5 µM), 0.25 µl of LA-Taq polymerase (1 unit/µl, Takara), and 1 µl of DNA template. The long-PCR reactions consisted of an initial denaturing step at 94 °C for 2 min, followed by 30 cycles of denaturing at 94 °C for 30 s, annealing at about 57 °C for 3 min and a final extension at 72 °C for 15 min. The normal PCR was performed following the standard procedure. Negative controls were included in all PCR amplifications to confirm the absence of contaminants. PCR products were cleaned by adding 0.45 µl of Shrimp Alkaline Phosphatase (Biotech Pharmacon), 0.9 µl of Exonuclease I (GE Healthcare) and 1.65 µl of sterile distilled H2O to 9 µL of PCR product and incubating at 37 °C for 30 min and 80 °C for 20 min. The purified product was then sequenced on ABI Prism 3730 (Applied Biosystems) from both strands with the same primers as those used for PCRs.

Sequence editing and analysis

Sequence trace files were corrected and aligned with the DNAstar 5.0 software package (DNAstar, Inc.,Wisconsin, USA). The locations of 13 protein-coding genes and 2 rRNA genes were determined by their similarity to published mitogenomes of other Sciaenidae species as shown in Table 2, whereas the tRNA genes were identified using the program tRNAscan-SE 1.21 (Lowe et al. 1997). Some tRNA genes, e.g. tRNA-Ser (AGY) that could not be found by the tRNAscan-SE, were identified by their secondary structure and their position in the mitogenome (Zhang et al. 2009).

Table 2.

Fish species analyzed in this study.

Species Length/bp GenBank accession no.
Family Sciaenidae
Subfamly Pseudosciaeniae
Larimichthys crocea 16466 EU339149
Larimichthys polyactis 16470 FJ618559
Collichthys lucida 16451 JN857362
Collichthys niveatus 16450 JN678726
Miichthys miiuy 16493 HM447240
subfamly Argyrosominae
Pennahia argentata (China) 16485 HQ890946
Pennahia argentata (Japan) 16486 KC545800
Nibea albiflora 16499 HQ890947
Nibea coibor 16509 KM373207
subfamly Sciaeninae
Dendrophysa russelii 16626 JQ728562
family Haemulidae
Parapristipoma trilineatum 16546 NC009857

The structure of the control region and its conserves motifs were identified by making a comparison with homologous sequences of reported teleost (Lee et al. 1995; Cui et al. 2009; Cheng et al. 2010). The proposed secondary structure of the putative OL was analyzed with the program Mfold v.3.2 with default setting (Zuker 2003) and visualized using RNAViz (De Rijk and De Wachter 1997).

Phylogenetic analyses

To clarify the phylogenetic position of Bahaba taipingensis within the family Sciaenidae, the complete mitogenome sequences of 9 fish species with 10 complete mitogenome sequences in Sciaenidae (Table 2) were incorporated together with the presently obtained mitogenome sequence of Bahaba taipingensis for phylogenetic analysis. In addition, possible close outgroups in Percoidei (Table 2) were chosen to root phylogenetic trees (Boger and Kritsky 2003). Sequences were aligned using Clustal W (Thompson et al. 1994), and adjustments were made manually. Phylogenetic analyses were based on the concatenated sequences of 12 protein-coding genes and 2 rRNA. The ND6 gene was excluded because of its heterogeneous base composition and consistently poor performance in phylogenetic analysis (Miya et al. 2003). For protein-coding genes, all stop codons were excluded from the analysis. The possible bias of substitution saturation at each codon position of protein-coding genes and 2 rRNA genes was investigated using DAMBE v.4.5.57 (Xia et al. 2001), and the results suggested that the third codons position were saturated both for transitions and transversions in the plot against with pairwise sequence divergence. Finally, unambiguously aligned sequences were 3630, 3630, 2728 nucleotide positions from first and second codon position of 12 protein-coding genes, 2 rRNA genes, respectively, and thus a total of 9988 bp positions were utilized for phylogenetic analysis.

Two different methods, Bayesian inference (BI) and maximum likelihood (ML), were used to construct the phylogenetic tree. Three partitions (first and second codon positions of protein-coding genes, 2 rRNA genes) were set in the combined data set for partitioned Bayesian analyses using MrBayes 3.1.2 (Ronquist et al. 2003), which allowed different substitution models in individual partitions. (MCMC) Bayesian analyses were undertaken with MrBayes 3.1.2 setting for the best-fit model of nucleotide evolution selected by (hLRTs) in MrModeltest version 2.3 (Posada et al. 2004). Four Markov chains (one cold and three heated) were used in each of two simultaneous runs starting from different random trees. Analyses were run for 1,000,000 generations, sampled every 100 generations to assess convergence. The distribution of log-likelihood scores was examined to determine stationarity for each search and to determine if extra runs were required to achieve convergence in log likelihoods searches. We discarded initial trees with non-stationary log-likelihood values as part of a burn-in procedure, and combined the remaining trees that resulted in convergent log-likelihood scores from both independent searches. These trees were used to construct a 50% majority rule consensus tree.

(ML) was performed in PAUP 4.0 (Swofford 2000), and the GTR+I+G (I=0.45, G=0.88) model of DNA substitution for the analysis was assessed by Modeltest version 3.7 (Posada and Crandall, 1998). The ML analysis was performed with random sequence addition replicates. Heuristic search was undertaken using 10 random addition sequence starting (TBR) branch swapping. The confidence level (Felsenstein, 1985) at each branch was evaluated by performing (BP) with 100 replicates in ML analysis.

Results and discussion

Mitochondrial genomic structure

The complete mitogenome of Bahaba taipingensis was sequenced to be 16500 bp which consisted of 13 typical vertebrate protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 putative (CR, Table 3). It had been submitted to GenBank with accession number JX232404. The mitogenome of Bahaba taipingensis had substantially similar patterns on mitogenome structural organization with other vertebrates (Anderson et al. 1981; Miya et al. 1999; Cui et al. 2009). The encoding genes of mitogenome were located on H-strand with the exception of ND6 and 8 tRNA genes that were transcribed from L-strand (Table 3). All genes from Bahaba taipingensis mitogenome were similar in size to most Perciformes species (Kim et al. 2004; Mabuchi et al. 2007; Cui et al. 2009; Cheng et al. 2011a; Cheng et al. 2012a) and the presence length of control region assumed variation in size, because they were prone to undergo the insertion/deletion events in the sequences (Sbisa et al. 1997).

Table 3.

Characteristics of the mitochondrial genome of Bahaba taipingensis.

Gene Position Size(bp) Amino acid Condon Initiation Stop Intergenic nucleotide Stand
From To Nucleotide
tRNAPhe 1 68 68 0 H
12S rRNA 69 1017 949 0 H
tRNAVal 1018 1090 73 0 H
16S rRNA 1091 2792 1702 0 H
tRNALeu(UUR) 2793 2866 74 0 H
ND1 2867 3841 975 324 ATG TAG 4 H
tRNAIle 3846 3915 70 -1 H
tRNAGln 3915 3985 71 -1 L
tRNAMet 3985 4054 69 0 H
ND2 4055 5099 1046 328 ATG TA 0 H
tRNATrp 5100 5170 71 1 L
tRNAAla 5172 5240 69 2 L
tRNAAsn 5243 5315 73 37 L
tRNACys 5353 5418 66 0 L
tRNATyr 5419 5488 70 1 L
COI 5490 7046 1557 518 ATG AGA -5 H
tRNASer(UCN) 7042 7112 71 3 L
tRNAAsp 7116 7184 69 8 H
COII 7193 7883 691 230 ATG T 0 H
tRNALys 7884 7957 74 1 H
ATPase8 7959 8126 168 55 ATG TAA -10 H
ATPase6 8117 8799 683 227 ATG TA 0 H
COIII 8800 9584 785 261 ATG TA 0 H
tRNAGly 9585 9655 71 0 H
ND3 9656 10005 349 118 ATG T 0 H
tRNAArg 10005 10073 69 0 H
ND4L 10074 10370 297 98 ATG TAA -7 H
ND4 10364 11744 1381 460 ATG T 0 H
tRNAHis 11745 11813 69 0 H
tRNASer(AGY) 11814 11880 67 5 H
tRNALeu(CUN) 11886 11958 73 0 H
ND5 11959 13797 1839 612 ATG TAG 4 H
ND6 13794 14315 522 173 ATG TAA 0 L
tRNAGlu 14316 14384 69 4 L
Cytb 14389 15529 1141 380 ATG T 0 H
tRNAThr 15530 15601 72 3 H
tRNAPro 15605 15674 70 0 L
Control Region 15675 16500 826 H

The overall base composition of the Bahaba taipingensis mitogenome was estimated to be 28.2% for A, 31.1% for C, 16.2% for G, and 24.6% for T (Table 4), respectively, indicating an obvious antiguanine bias. Furthermore, the G content of all protein-coding genes presents obviously lower just as found in other bony fishes (Miya et al. 2003; Mabuchi et al. 2007). The most remarkable character of metazoan mitogenomes is the strand-specific bias in nucleotide composition (Reyes et al. 1998; Hassanin et al. 2005), which can be measured as GC-skew (G%-C%)/(G%+C%) and AT-skew (A%-T%)/(A%+T%), respectively (Perna et al. 1995). The overall GC- and AT-skews of the H-strand of Bahaba taipingensis mitogenome were -0.328 and 0.047, respectively, indicating a strand compositional bias characterized by a strong excess of C over G nucleotides and a slight excess of A over T nucleotides on the H-strand.

Table 4.

Base composition for protein-coding, tRNA, and rRNA genes of Bahaba taipingensis mitogenome.

Gene/regon Base composition(%) A+T number
T C A G
ND1 25.9 35.3 24.5 14.3 50.4 975
ND2 24.6 38.1 25.6 11.7 50.2 1046
ND3 26.4 38.1 20.9 14.6 47.3 349
ND4 24.6 35 26.1 14.3 50.7 1381
ND4L 25.6 38.7 21.9 13.8 47.5 297
ND5 26.2 33.4 28.3 12.1 54.5 1839
ND6 12.3 35.4 38.3 14 50.6 522
COI 29.2 28.7 23 19.1 52.2 1557
COII 27.1 28.9 28.5 15.5 55.6 691
COIII 28.3 31.2 23.6 16.9 51.9 785
ATP6 25.2 38.4 23.4 13 48.6 683
ATP8 23.2 33.3 32.8 10.7 56 168
Cytb 26.8 35 24 14.2 50.8 1141
Protein coding
1st 29.1 30.6 24 16.3 53.1 3630
2nd 21.7 35.1 26.9 16.3 48.6 3630
3rd 28.3 36.2 24.7 10.8 53 3630
Total 26.4 34 25.2 14.4 51.6 10890
tRNA 27.1 22.6 27.4 23.9 54.5 1553
rRNA 20.8 26.7 32.2 20.3 53 2651
D-loop 30.4 22.8 31.6 15.2 62 826
Overall 25.1 31.4 27.6 15.9 52.7 16500

Protein-coding genes

The Bahaba taipingensis genome contained 13 protein-coding genes encoded on the H-strand excluding ND6 gene that was oriented to L-strand. The 13 protein-coding genes were total 11,436 bp in size, accounting for 69.15% of the whole mitogenome. All protein-coding genes initiated with an ATG codon, just as in most vertebrates. Three open reading frames (ATP8, ND4L and ND6) of Bahaba taipingensis ended with TAA, two open reading frames (ND1 and ND5) with TAG, and one open reading frames (COI) with AGA. The remainder used incomplete stop codons, either TA (ND2, ATP6 and COIII) or T (COII, ND3, ND4 and Cytb), probably completed by post-transcriptional polyadenylation (Ojala et al. 1981). It should be noted that these genes (ND4L with ND4, ATP8 with ATP6 and COI with tRNASer(UUR)) could complete their stopped codons within the overlapping portion of the next genes.

Nucleotide composition and codon using frequencies were calculated from a concatenated sequence of all protein-coding genes on the H-strand, except for ND6 on the L-strand. The base composition of protein-coding genes revealed weak bias against G (14.4%), especially at third codon positions (10.8%, Table 4). For all protein genes, C was the most frequent nucleotide at the first and third positions whereas T was most frequent at the second position as found in other bony fishes (Oh et al. 2007).

Ribosomal and transfer RNA genes

Like other mitochondrial genomes (Zardoya et al. 1995; Inoue et al. 2000), twenty-two tRNA genes were identified. The tRNA genes were interspersed among the mitochondrial genome and ranged in size from 66 to 74 bp (Table 3). They showed the typical gene arrangement as found in most vertebrates. Fourteen tRNA genes were transcribed on the H-strand, whereas the remaining eight tRNA genes were oriented on the L-strand (Table 3). These tRNA genes were predicted capable of folding into typical cloverleaf secondary structures with normal base pairing. The Bahaba taipingensis mitogenome also contained a small subunit of rRNA (12S rRNA) and a large subunit of rRNA (16S rRNA) as in other bony fishes (Zardoya et al. 1995; Inoue et al. 2000), which were 947 bp and 1684 bp in length, respectively. As in other vertebrate genomes, these genes were located between the tRNAPhe and tRNAVal genes and between tRNAVal and tRNALeu(UUR) genes, respectively.

Non-coding regions

As shown in Table 3, there were non-coding intergenic spacers from 1 to 8 bp observed in Bahaba taipingensis, spanning the contiguous genes apart from OL and control region. Furthermore, mitochondrial intergenic spacers were a total of 36 bp in eleven different locations.

As in most vertebrates, the major non-coding region in Bahaba taipingensis mitochondrial genome was located between tRNA-Pro and tRNA-Phe. It was determined to be 826 bp in length, longer than other reported Sciaenidae species, and it had an overall base composition that was rich in A and T (A+T=62.0%). By comparing with the recognition sites in some reported fishes (Lee et al. 1995; Cui et al. 2009; Cheng et al. 2010; Cheng et al. 2011a; Cheng et al. 2012a), three domains were detected in Bahaba taipingensis, namely, the termination associated sequence domain (ETAS), the central conserved sequence block domain (CSB-D, CSB-E and CSB-F) and the conserved sequence block domain (CSB-1, CSB-2 and CSB-3) (Figure 1). The ETAS was thought to act as a signal for the termination of H-strand elongation (Clayton 1991), and this domain was a hypervariable domain that might be useful for population genetic analyses. Furthermore, the motif sequence of ETAS was TACATAT with one palindromic sequence ATGTATA. The control region of mammals contained five blocks (CSB-B, CSB-C, CSB-D, CSB-E and CSB-F) in central conserved sequence blocks, however, only CSB-D, CSB-E and CSB-F were mostly detected in fishes (Brought et al. 1994; Lee et al. 1995). In this study, all these three motifs were identified in the central domain in accordance with Miichthys miiuy (Cheng et al. 2010), and Nibea albiflora (Cheng et al. 2011b) within Sciaenidae, which was not detected in four other species of Pseudosciaeniae (Cui et al. 2009; Cheng et al. 2011a; Cheng et al. 2012a; Cheng et al. 2012b). In addition, the consensus sequence of CSB-F was ATGTAATAAGAACCGACCAT, which distinguished the central conserved sequence block domain from the termination associated sequence domain. CSB-E was located downstream of CSB-F, whose consensus sequence was AGGGACAAGTATTGTGGGGG, characterized by the box GTGGGG. CSB-E was followed by CSB-D with its consensus sequence TATTCCTGGCATTTGGT. Generally, these key sequences were highly conserved and easily recognized. Three conserved sequence blocks (CSB-1, CSB-2 and CSB-3) were determined in the conserved sequence block domain which was thought to be involved in positioning RNA polymerase both for transcription and for priming replication (Shadel et al. 1997). Moreover, the critical central conserved sequences of CSB-1, CSB-2, and CSB-3 were ATTTGGATATCAAGTGCATAAA, ACCCCCCCTACCCCCCC, and AAACCCCCCGTAAA, respectively.

Figure 1.

Figure 1.

The structure of control region about Bahaba taipingensis.

The additional non-coding region, the putative origin of L-strand replication (OL), was located in a cluster of five tRNA genes (the WANCY region) between the tRNA-Asn and tRNA-Cys genes, almost identical with other Sciaenidae fishes. The putative OL could form a stable stem-loop secondary structure with 20 bp in the stem and 13 bp in the loop (Figure 2), which was 37 bp in length (CCTTTCCCCCGCCTACTATAGGACTAAAGGCGGGGGA). Furthermore, the conserved stem-loop structures in mitochondrial genomes was thought to play an importance role in conjunction with the origin of mtDNA replication.

Figure 2.

Figure 2.

Potential secondary structure of the origin of L-strand replication (OL) of Bahaba taipingensis mtDNA.

Phylogenetic analyses within family Sciaenidae

The phylogenetic trees (the 50% majority-rule consensus tree is shown in Figure 3) were highly coincident regardless of the analytic method used, and were statistically supported by high posterior probability and intermediate bootstrap values. This phylogenetic analysis represented the first investigation of relationships of Bahaba taipingensis within the Sciaenidae based on the whole mitogenome. In our analysis, Bahaba taipingensis was found to be more closely related to Pseudosciaeniae (Collichthys, Larimichthys and Miichthys) than to Pennahia and Nibea, the latter of which was suggested by morphological topology (Zhu et al. 1963; Cheng et al. 1987) and previous molecular study (He et al. 2012). However, phylogenetic analyses showed that Miichthys could not be merged into the CollichthysLarimichthys clade. On the contrary, Miichthys and Bahaba formed an independent clade well supported by high posterior probability value, and this clade formed the sister group of the CollichthysLarimichthys clade. Therefore, the relationship between Miichthys and Pseudosciaeniae deservesd to be further studied. The proposed phylogenetic position of Bahaba taipingensis within the Sciaenidae based on the findings of the present study should be accepted with caution due to limited taxon sampling. However, the phylogenetic relationship within the Sciaenidae remains to be resolved, and it is necessary to make further analysis based on more molecular information and extensive taxon sampling.

Figure 3.

Figure 3.

Phylogenetic relationships among Sciaenidae species based on the combined 9988 bp nucleotide positions. The posterior probability value of BI analyses and bootstrap support values of ML analyses (in the order: BI, ML) are indicated near the branches.

Acknowledgements

This study was supported by Public Science and the Fundamental Research Funds for the Central Universities (201262022).

Citation

Zhao L, Gao T, Lu W (2015) Complete mitochondrial DNA sequence of the endangered fish (Bahaba taipingensis): Mitogenome characterization and phylogenetic implications. ZooKeys 546: 181–195. doi: 10.3897/zookeys.546.5964

References

  1. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG. (1981) Sequence and organization of the human mitochondrial genome. Nature 290: 457–465. doi: 10.1038/290457a0 [DOI] [PubMed] [Google Scholar]
  2. Boeger WA, Kritsky DC. (2003) Parasites, fossils and geologic history: Historical biogeography of the South American freshwater croakers, Plagioscion spp. (Teleostei, Sciaenidae). Zoologica Scripta 32: 3–11. doi: 10.1046/j.1463-6409.2003.00109.x [Google Scholar]
  3. Boore JL. (1999) Animal mitochondrial genomes. Nucleic Acids Research 27: 1767–1780. doi: 10.1093/nar/27.8.1767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brought RE, Dowling TE. (1994) Length variation in mitochondrial DNA of the minnow Cyprinella spiloptera. Genetics 138: 179–190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen QM. (2007) Molecular Phylogeny of the Sciaenidae in China. Dissertation, Jinan University; [In Chinese with an English abstract] [Google Scholar]
  6. Cheng J, Ma GQ, Miao ZJ, Shui BN, Gao TX. (2011a) Complete mitochondrial genome sequence of the spinyhead croaker Collichthys lucidus (Perciformes, Sciaenidae) with phylogenetic considerations. Molecular Biology Reports 39(4): 4249–4259. doi: 10.1007/s11033-011-1211-6 [DOI] [PubMed] [Google Scholar]
  7. Cheng J, Ma GQ, Song N, Gao TX. (2012a) Complete mitochondrial genome sequence of bighead croaker Collichthys niveatus (Perciformes, Sciaenidae): A mitogenomic perspective on the phylogenetic relationships of Pseudosciaeniae. Gene 492(2): 210–223. doi: 10.1016/j.gene.2011.09.020 [DOI] [PubMed] [Google Scholar]
  8. Cheng QT, Zheng BS. (1987) Retrieval System of Chinese Fish. Science Publishing Press, Beijing, 317–324. [In Chinese] [Google Scholar]
  9. Cheng YZ, Xu TJ, Shi G, Wang RX. (2010) Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciformes, Sciaenidae) with phylogenetic consideration. Marine Genomics 3: 201–209. doi: 10.1016/j.margen.2010.10.003 [DOI] [PubMed] [Google Scholar]
  10. Cheng YZ, Xu TJ, Jin XX, Wang RX. (2011b) Complete mitochondrial genome of the yellow drum Nibea albiflora (perciformes, sciaenidae). Mitochondrial DNA 22(4): 80–82. doi: 10.3109/19401736.2011.624602 [DOI] [PubMed] [Google Scholar]
  11. Cheng YZ, Wang RX, Sun YN, Xu TJ. (2012b) The complete mitochondrial genome of small yellow croaker and partitoned Bayesian analysis of Sciaenidae fish phylogeny. Genetics and Molecular Biology 35(1): 191–199. doi: 10.1590/S1415-47572012005000006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Clayton DA. (1991) Nuclear gadgets in mitochondrial DNA replication and transcription. Trends in Biochemical Sciences 16: 107–111. doi: 10.1016/0968-0004(91)90043-U [DOI] [PubMed] [Google Scholar]
  13. Cui ZX, Liu Y, Li CP, You F, Chu KH. (2009) The complete mitochondrial genome of the large yellow croaker, Larimichthys cracea (Perciformes, Sciaenidae): Unusual features of its control region and the phylogenetic position of the Sciaenidae. Gene 432: 33–43. doi: 10.1016/j.gene.2008.11.024 [DOI] [PubMed] [Google Scholar]
  14. De Rijk P, De Wachter R. (1997) RnaViz, a program for the visualisation of RNA secondary structure[J]. Nucleic Acids Research 25: 4679–4684. doi: 10.1093/nar/25.22.4679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Felsenstein J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. doi: 10.2307/2408678 [DOI] [PubMed] [Google Scholar]
  16. Hassanin A, Leger N, Deutsch J. (2005) Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Systematic Biology 54: 277–298. doi: 10.1080/10635150590947843 [DOI] [PubMed] [Google Scholar]
  17. He W, Lu WH, Li XG, Lu NN, Sun DF, Li YZ. (2012) Taxonomic status of Chinese bahaba (Bahaba taipingensis) and its phylogenetic relationship with other species in the family Sciaenidae. Mitochondrial DNA 23(2): 53–61. doi: 10.3109/19401736.2011.653797 [DOI] [PubMed] [Google Scholar]
  18. Inoue JG, Kumazawa Y, Miya M, Nishida M. (2009) The historical biogeography of the freshwater knifefishes using mitogenomic approaches: A mesozoic origin of the Asian notopterids (Actinopterygii: Osteoglossomorpha). Molecular Phylogenetics and Evolution 51(3): 486–499. doi: 10.1016/j.ympev.2009.01.020 [DOI] [PubMed] [Google Scholar]
  19. Inoue JG, Miya M, Tsukamoto K, Nishida M. (2000) Complete mitochondrial DNA sequence of the Japanese sardine (Sardinops melanostictus). Fisheries Science 66: 924–932. doi: 10.1046/j.1444-2906.2000.00148.x [Google Scholar]
  20. Jondeung A, Sangthong P, Zardoya R. (2007) The complete mitochondrial DNA sequence of the Mekong giant catfish (Pangasianodon gigas), and the phylogenetic relationships among Siluriformes. Gene 387: 49–57. doi: 10.1016/j.gene.2006.08.001 [DOI] [PubMed] [Google Scholar]
  21. Kim IC, Kweon HS, Kim YJ, Kim CB, Gye MC, Lee WO, Lee YS, Lee JS. (2004) The complete mitochondrial genome of the javeline goby Acanthogobius hasta (Perciformes, Gobiidae) and phylogenetic considerations. Gene 336: 147–153. doi: 10.1016/j.gene.2004.04.009 [DOI] [PubMed] [Google Scholar]
  22. Lee WJ, Conroy J, Howell WH, Kocher TD. (1995) Structure and evolution of teleost mitochondrial control region. Journal of Molecular Evolution 41: 54–66. doi: 10.1007/BF00174041 [DOI] [PubMed] [Google Scholar]
  23. Liu SF, Chen LL, Dai FQ, Zhuang ZM. (2010) Application of DNA barcoding gene COI for classifying family Sciaenidae. Oceanologia Limnologia Sinica 41: 223–232. [In Chinese with an English abstract] [Google Scholar]
  24. Lowe TM, Eddy SR. (1997) tRNAscan-SE: A program for detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 955–964. doi: 10.1093/nar/25.5.0955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lu WH, Ye PR. (2002) Investigation Report on Resource of Bahaba taipingensis. Jounal of Modern Fisheries Information 17(5): 9–14. [In Chinese with an English title] [Google Scholar]
  26. Mabuchi K, Miya M, Azuma Y, Nishida M. (2007) Independent evolution of the specialized pharyngeal jaw apparatus in cichlid and labrid fishes. BMC Evolutionary Biology 7: 1–12. doi: 10.1186/1471-2148-7-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Miya M, Nishida M. (1999) Organization of the mitochondrial genome of a deep-sea fish, Gonostoma gracile (Teleostei: Stomiiformes): First example of transfer RNA gene rearrangements in bony fishes. Marine Biotechnology 1: 416–426. doi: 10.1007/PL00011798 [DOI] [PubMed] [Google Scholar]
  28. Miya M, Takeshima H, Endo H, Ishiguro NB, Inoue JG, Mukai T, Satoh TP, Yamaguchi M, Kawaguchi A, Mabuchi K, Shirai SM, Nishida M. (2003) Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 26: 121–138. doi: 10.1016/S1055-7903(02)00332-9 [DOI] [PubMed] [Google Scholar]
  29. Oh DJ, Kim JY, Lee JA, Yoon WJ, Park SY, Jung YH. (2007) Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene 392: 174–180. doi: 10.1016/j.gene.2006.12.007 [DOI] [PubMed] [Google Scholar]
  30. Ojala D, Montoya J, Attardi G. (1981) tRNA punctuation model of RNA processing in human mitochondria. Nature 290: 470–474. doi: 10.1038/290470a0 [DOI] [PubMed] [Google Scholar]
  31. Ou YJ, Liao R, Li Je, Gou XW. (2011) The morphology of otolith and its characteristics of microstructure in Bahaba taipingensis. Guangdong Agricultural Sciences 11: 123–125. [In Chinese with an English abstract] [Google Scholar]
  32. Perna NT, Kocher TD. (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. doi: 10.1007/BF00186547 [DOI] [PubMed] [Google Scholar]
  33. Posada D, Buckley TR. (2004) Model selection and model averaging in phylogenetics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793–808. doi: 10.1080/10635150490522304 [DOI] [PubMed] [Google Scholar]
  34. Posada D, Crandall K. (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817–818. doi: 10.1093/bioinformatics/14.9.817 [DOI] [PubMed] [Google Scholar]
  35. Reyes A, Gissi C, Pesole G, Saccone C. (1998) Asymmetrical directional mutation pressure in the mitochondrial genome of mammals. Molecular Biology and Evolution. 15: 957–966. doi: 10.1093/oxfordjournals.molbev.a026011 [DOI] [PubMed] [Google Scholar]
  36. Ronquist F, Huelsenbeck JP. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. doi: 10.1093/bioinformatics/btg180 [DOI] [PubMed] [Google Scholar]
  37. Sbisa E, Tanzariello F, Reyes A, Pesole G, Saccone C. (1997) Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205: 125–140. doi: 10.1016/S0378-1119(97)00404-6 [DOI] [PubMed] [Google Scholar]
  38. Shadel GS, Clayton DA. (1997) Mitochondrial DNA maintenance in vertebrates. Annual Review of Biochemistry 66: 409–435. doi: 10.1146/annurev.biochem.66.1.409 [DOI] [PubMed] [Google Scholar]
  39. Swofford D. (1998) PAUP 4.0: phylogenetic analysis using parsimony[M]. Smithsonian Institution. [Google Scholar]
  40. Tetsuji N. (2000) Fish of Japan with pictorial keys to the species, 2nd ed., Tokai University Press, Tokyo. [Google Scholar]
  41. Thompson JD, Higgins DG, Gibson TJ. (1994) Clustalw: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. doi: 10.1093/nar/22.22.4673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Wang CH, Chen Q, Lu GQ, Xu JW, Yang QL, Li SF. (2008) Complete mitochondrial genome of the grass carp (Ctenopharyngodon idella, Teleostei): insight into its phylogenic position within Cyprinidae. Gene 424: 96–101. doi: 10.1016/j.gene.2008.07.011 [DOI] [PubMed] [Google Scholar]
  43. Xia X, Xie Z. (2001) DAMBE: Software package for data analysis in molecular biology and evolution. Journal of Heredity 92: 371–373. doi: 10.1093/jhered/92.4.371 [DOI] [PubMed] [Google Scholar]
  44. Yang R, Wu XB, Yan P, Su X, Yang BH. (2010) Complete mitochondrial genome of Otis tarda (Gruiformes, Otididae) and phylogeny of Gruiformes inferred from mitochondrial DNA sequences. Molecular Biology Reports 37: 3057–3066. doi: 10.1007/s11033-009-9878-7 [DOI] [PubMed] [Google Scholar]
  45. Ye PR, Lu WH. (2001) The biological research of Bahaba taipingensis. Fisheries Science and Trchnology 95: 7–8. [In Chinese] [Google Scholar]
  46. Zardoya R, Garrido-Pertierra A, Bautista JM. (1995) The complete nucleotide sequence of the mitochondrial DNA genome of the rainbow trout (Oncorhynchus mykiss). Journal of Molecular Evolution 41: 942–951. doi: 10.1007/BF00173174 [DOI] [PubMed] [Google Scholar]
  47. Zhang XY, Yue BS, Jiang WX, Song Z. (2009) The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Molecular Biology Reports 36: 981–991.doi: 10.1007/s11033-008-9271-y [DOI] [PubMed] [Google Scholar]
  48. Zhu YT, Lo YL, Wu HL. (1963) A Study on the Classication of the Sciaenoid Fishes of China, with Description of New Genera and Species. 1st edition Shanghai Science and Technology Press, Shanghai, 13–14. [In Chinese] [Google Scholar]
  49. Zuker M. (2003) Mfold web server for nucleic acid folding and hybridization prediction [J]. Nucleic Acids Research 31: 3406–3415. doi: 10.1093/nar/gkg595 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES