Skip to main content
NCBI home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2016 Jul 1.
Published in final edited form as: Mol Cancer Res. 2015 Oct 9;14(1):44–55. doi: 10.1158/1541-7786.MCR-15-0188-T

RAD51 and BRCA2 enhance oncolytic adenovirus type 5 activity in ovarian cancer

Laura A Tookman 1, Ashley K Browne 1, Claire M Connell 1, Gemma Bridge 1, Carin K Ingemarsdotter 1, Suzanne Dowson 3, Atsushi Shibata 2, Michelle Lockley 1, Sarah A Martin 1, Iain A McNeish 1,3,*
PMCID: PMC4716290  EMSID: EMS65584  PMID: 26452665

Abstract

Homologous Recombination (HR) function is critically important in High Grade Serous Ovarian Cancer (HGSOC). HGSOC with intact HR has a worse prognosis and is less likely to respond to platinum chemotherapy and PARP inhibitors. Oncolytic adenovirus, a novel therapy for human malignancies, stimulates a potent DNA damage response that influences overall anti-tumor activity. Here, the importance of HR was investigated by determining the efficacy of adenovirus type 5 (Ad5) vectors in ovarian cancer. Using matched BRCA2 mutant and wild-type HGSOC cells, it was demonstrated that intact HR function promotes viral DNA replication and augments overall efficacy, without influencing viral DNA processing. These data were confirmed in a wider panel of HR competent and defective ovarian cancer lines. Mechanistically, both BRCA2 and RAD51 localize to viral replication centers within the infected cell nucleus and that RAD51 localization occurs independently of BRCA2. In addition, a direct interaction was identified between RAD51 and adenovirus E2 DNA binding protein. Finally, using functional assays of HR competence, despite inducing degradation of MRE11, Ad5 infection does not alter cellular ability to repair DNA double strand break damage via HR. These data reveal that Ad5 redistributes critical HR components to viral replication centers and enhances cytotoxicity.

Implications

Oncolytic adenoviral therapy may be most clinically relevant in tumors with intact HR function.

Keywords: Adenovirus, BRCA2, Homologous recombination, ovarian cancer, RAD51

Introduction

Aberrant DNA damage responses (DDR) are common in human malignancies (1). This is particularly true in high grade serous ovarian cancer (HGSOC), where approximately 15% patients have germline mutations in BRCA1 or BRCA2 (2). Moreover, data from the Cancer Genome Atlas consortium (TCGA) inferred that homologous recombination (HR) defects may be present in 50% HGSOC, through a variety of additional mechanisms including somatic BRCA1/2 mutation and epigenetic loss of BRCA1 expression (3). A separate study, which used functional assays of HR competence in primary ascites cells from women with advanced HGSOC, strikingly concurred with TCGA, with 52% (26/50) showing HR deficiency (4). There is great interest in the use of poly-(ADP ribose) polymerase (PARP) inhibitors in HR defective HGSOC (5), but there are few therapeutic targets available for HR competent tumours, which have a poorer prognosis (6) and are less likely to respond to platinum-based chemotherapy (4).

Oncolytic adenoviruses are a potential novel therapy for ovarian and other human cancers. These viruses infect malignant cells, multiply selectively within them and cause cell death with release of mature virions that infect neighbouring cells. An understanding of the complex interplay between the virus and host cells is vital to increase efficacy, develop biomarkers and improve patient selection in clinical trials. E1A CR2 deleted Ad5 vectors such as dl922-947 (7) and Δ24 (8) replicate selectively within cells with a defective Rb pathway, a frequent abnormality in many malignancies, including HGSOC (3). We have previously shown that dl922-947 has considerable activity in ovarian cancer and is more potent than E1A wild-type adenoviruses and the E1B-55K deletion mutant dl1520 (9, 10). dl922-947 induces death via a necrosis-like mechanism (11) but the sensitivity of ovarian cancer cells to dl922-947 varies considerably, even between cells with similar infectivity (12).

Infection by many DNA viruses, including adenovirus, triggers a DNA damage response, which viruses seek to circumvent through a series of mechanisms. A major target following adenovirus type 5 (Ad5) infection is the MRN complex (MRE11, RAD50, NBS1) and components of the non-homologous end-joining (NHEJ) pathway. Immediately following infection, before E1A is expressed, core protein VII protects the viral genome from recognition by MRN (13). As early proteins are expressed, MRN is inactivated by several mechanisms, including proteosomal degradation (14, 15) and mislocalisation to PML-containing “nuclear tracks” (16, 17). Specific mechanisms that inhibit NHEJ include proteosomal degradation of DNA Ligase IV (18) and inactivation of DNA dependent protein kinase (DNA-PK) (19).

Beyond the observation that the BLM helicase is also degraded following Ad5 infection (20), there has been little specific investigation into the role of components of the HR pathway in adenovirus biology. Previously, we showed that oncolytic adenovirus activity is associated with profound deregulation of cell cycle checkpoints and cell cycle progression (21), inducing cellular DNA damage, with subsequent activation of DDR pathways, including ATR-Chk1 (22). Here, we have investigated the relationship between homology-mediated DSB repair and oncolytic adenovirus activity in ovarian cancer further. Our data indicate for the first time that key HR components BRCA2 and RAD51 interact with viral DNA replication centres and promote both virus replication and cytotoxicity.

Materials and Methods

Cell lines, viruses and chemotherapy

Cells were cultured in Dulbecco’s modified Eagle Medium (DMEM) or RPMI (both Sigma, Poole, UK) supplemented with 10% heat-inactivated foetal bovine serum (FBS) (Biosera, Sussex, UK), 100 units/ml penicillin and 100 mg/ml streptomycin (PAA Laboratories, Somerset, UK). Cell lines were maintained at 37°C in a humidified atmosphere with 5% CO2 and routinely passaged twice a week using 0.5% trypsin in PBS. All cell lines were routinely tested for mycoplasma and underwent 10-loci STR profiling to verify their authenticity, most recently in July 2014. SKOV3 and HeLa were obtained from Cancer Research UK Cell Services (Clare Hall, Hertfordshire, UK), TOV21G from Prof F Balkwill (Barts Cancer Institute, UK) and IGROV1 from NCI. PEO1 and PEO4 were kindly provided by Dr Simon Langdon (University of Edinburgh, UK). Of these cell lines, IGROV1, PEO1, PEO4 and SKOV3 cells were maintained in RPMI, HeLa and TOV21G cells in DMEM.

All viruses, including wild-type Ad5, Ad11 and Ad35, were originally obtained from Dr Y. Wang (Barts Cancer Institute, UK). The Ad5 mutant dl922-947 is deleted in the region encoding amino acids 122-129 of E1A CR2. It also contains a 745bp deletion in E3B (nt 30,005-30,750) that is substituted by a 642bp non-coding DNA fragment (7). dl309 has the same E3B deletion as dl922-947 but is E1A wild-type. Ad GFP is deleted in E1 and E3B and has green fluorescent protein (GFP) in the E1 position under control of the cytomegalovirus (CMV) immediate early promoter.

Cisplatin (Accord Healthcare, Harrow, UK) was obtained for the chemotherapy pharmacy, St Bartholomew’s Hospital, London. Rucaparib was provided by Clovis Oncology (Boulder CO, USA).

Cell Survival assays

For adenovirus and cisplatin experiments, cell survival was measured using MTT assay (23) using a Wallac1420 Multilabel reader (PerkinElmer Life and Analytical Sciences, London, UK). 104 cells were infected in 24 well plates in serum free medium. Cell viability was measured after 120 hours. CellTitre Glo (Promega, Southampton, UK) and sulphorhodamine B assays were used in assays involving PARP inhibitors. For clonogenic assays, cells were infected in 24 well plates as above. 72h post-infection, cells were trypsinised and 100 – 200 cells were plated onto 6 well plates in triplicate. Colonies were stained with Crystal Violet ten days thereafter and counted.

Virus Infectivity assay

5×105 cells were infected with Ad GFP. GFP fluorescence was assessed 24 hours post infection on a FACSCaliber (Becton Dickinson, Oxford, UK). All conditions were repeated in triplicate and analysed using FLOWJO software.

Viral replication assays - TCID50 and quantitative PCR

2×105 cells were infected with dl922-947 in serum-free medium and re-fed 2 hours later with serum containing medium. Up to 72 hours post infection, cells were harvested in 0.1M Tris pH 8.0 and subjected to 3 rounds of freeze/thawing (liquid N2/37 °C) all time points were harvested in triplicate. The supernatant was titred on JH293 cells.

2×105 were harvested at 24-72 hours following infection, washed twice in ice cold PBS and scrapped into 500μl PBS. Extraction of viral DNA was performed using QIAmp DNA Blood Mini Kit (Qiagen, Manchester, UK). Real-time PCR was performed using ABI Prism7500. Oligonucleotides and probes were as follows: E1A: sense: 5′-CCACCTACCCTTCACGAACTG; antisense: 5′-GCCTCCTCGTTGGGATCTTC; probe: ATGATTTAGACGT GACGGCC Hexon: sense: 5′- GGTGGCCATTACCTTTGACTCT; antisense: 5′ GGGTAAGCAGGCGGTCATT; probe: 5′- CTGTCAGCTGGCCTGG PCR conditions were: 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. A standard curve using 103–109 dl922-947 genomes was used for quantification.

Reverse transcriptase PCR

For analysis of BRCA2 expression, 1μg DNase-treated RNA was reverse transcribed using the Applied Biosystems High Capacity cDNA Reverse Transcription Kit (Life Technologies, Paisley, UK). The following primers and probes were used to assess BRCA2 transcription. BRCA2-sense 1: 5′-CAGAAGCCCTTTGAGAGTGGA; BRCA2-antisense 1: 5′-TGAGACCATTCACAGGCCAA; BRCA2 probe 1: 5′-(6FAM)CCAAGGAAGTTGTACCGTC(TAM); BRCA2-sense 2: 5′-CCACAGCCAGGCAGTCTGTAT; BRCA2-antisense 2: 5′-AGAACACGCAGAGGGAACTTG BRCA2 probe 2: 5′-(6FAM)CCACTCTGCCTCGAAT(TAM). Data were normalised to 18S.

Immunoblotting

Protein lysates were electrophoresed on precast gels (Invitrogen) and transferred onto nitrocellulose membranes (GE Healthcare, Amersham, UK) by semi-dry blotting. Antibody binding was visualised using enhanced chemilumunescence (GE healthcare). Antibodies were obtained as follows: E1A (mouse, Becton Dickinson 554155), Ad5 (goat, Abcam Ab36851), RAD51 (rabbit, Santa-Cruz sc-8348), mcm3 (rabbit, Abcam ab36851), Ku70 (goat, Santa-Cruz, sc-1486), (rabbit, Cell Signaling, 4895). All HRP-conjugated secondary antibodies were obtained from Dako (Ely, UK).

Southern blotting

106 cells plated and infected with dl922-947 (MOI 10 for PEO4, MOI 100 for PEO1 cells). 48 and 72 hours later, cells were trysinised and washed in TBS. Extraction of DNA was performed using QIAmp DNA Blood Mini Kit (Qiagen). DNA concentration was measured using Nanodrop® ND-1000 spectrophotometer and 10 μg genomic DNA was electrophoresed on a 1% agarose gel. The gel was soaked in 200ml 0.2 M HCl for 10 min, washed and then soaked Alkaline Transfer buffer (0.4M NaOH, 1M NaCl). DNA was transferred onto a Hybond N+ membrane (GE Healthcare Life Sciences) by conventional capillary transfer over 48 hours. Probe Labelling against viral DNA, hybridization and detection were performed using the Amersham ECL Direct Nucleic Acid Labelling and Detection systems.

Flow cytometry

For cell cycle analyses, cells were trypsinised, washed twice in ice-cold PBS, and fixed in ice-cold 100% ethanol. Cells were then washed with PBS and re-suspended in 200μl propidium iodide (PI) and 100μg/ml RNase A (MP Biomedicals, Santa Ana, CA, USA). For γH2AX analysis, cells were harvested, washed, and fixed in ice-cold 70% ethanol. After incubation with primary anti-γH2AX mAb or IgG control, cells were washed and then incubated with FITC-conjugated anti-mouse secondary antibody (Invitrogen) for 1 hour in the dark and analysed using a FACSCaliber flow cytometer. Results analysed using FlowJo software.

Immunofluorescence and co-immunoprecipitation

Cells were seeded on Poly-l-lysine coated coverslips and treated with rucaparib (10μM for 24 hours) or dl922-947 for up to 48 hours. Following treatment, medium was aspirated and 0.04% Triton (Sigma) in PBS added for 1min. Cells were then fixed in 3% paraformaldehyde and 2% sucrose for 10 min. The cells were stained with anti-γH2AX antibody (Millipore, Watford, UK) or a rabbit anti-Ad5 E2-DNA binding protein (E2-DBP - a kind gift of Dr David Ornelles, Wake Forest Medical Center, NC, USA) and co-stained with anti-RAD51 or anti-BRCA2 antibody for 45 minutes at 37°C. Following incubation for 45 min at 37°C with secondary antibodies, cells were co-stained with DAPI. Coverslips were mounted on slides and images captured using a Zeiss 510 or 710 confocal microscope and foci counted using Image J software.

2×106 TOV21G cells were infected with dl922-947 (MOI 10) and lysed 24 hours later in 800μl RIPA lysis buffer (with complete protease inhibitors, Roche, Herts, UK). 35μl Sepharose beads (Santa Cruz, CA, US) were incubated with anti-RAD51 antibody (Santa Cruz, H-92, sc8349) or control antibody (anti-HA, sigma H6908) for 1 hour at 4°C. Lysates were then incubated with the IP matrix beads for 1 hour at room temperature and washed with RIPA lysis buffer. SDS loading buffer was added, samples boiled and proteins detected by Western blot as described earlier. Primary antibodies used: rabbit anti-Ad5 E2 DBP and anti-RAD51 (Abcam, ab213).

siRNA

Small interference RNA (siRNA) targeted against BRCA2 and RAD51 were obtained from either Dharmacon (siGENOME SMARTpool; GE Lifesciences, High Wycombe, UK) or Qiagen. A non-targeting (NT) pool of siRNA was also used (Qiagen). All cell lines were transfected using lipofectamine 2000 (Invitrogen), apart from IGROV1 cells where DharmaFECT1 (Dharmacon) was used. A final concentration of 10nM RAD51 siRNA and 30nM or 50nM (depending on cell line) BRCA2 siRNA was used. 24 hours following transfection, cells were infected with dl922-947 or dl309. Cell survival was assessed 120 hours later by MTT assay. Cell survival following siRNA was compared to the scrambled control. All experiments were repeated using a second siRNA (Qiagen) at a concentration of 50nM.

Homologous Recombination Reporter assay

Full details of the assay are reported elsewhere (24). Briefly, pDR-GFP (a gift from Maria Jasin (Addgene plasmid 26475 (25)) contains two differently mutated GFP genes orientated as direct repeats and separated by a puromycin resistance gene. One of the GFP constructs, SceGFP, is mutated to contain the recognition site for the rare cutting endonuclease I-SceI; as a result, exposure to I-SceI will induce a unique double strand break. The I-SceI site is incorporated at a BcgI restriction site by substituting 11bp of wild type GFP sequence with those of the I-SceI recognition site. These substituted base pairs also supply two in frame stop codons, which terminate translation and inactivate the protein. Downstream of SceGFP gene is an 812 bp internal GFP fragment termed iGFP. Homologous sequences in the two mutated GFP genes are separated by 3.7kb. When I-SceI-induced DSB occurs, iGFP sequence can act a donor strand to allow homology-mediated repair and generation of a functional GFP open reading frame – this in turn can be detected by flow cytometry.

PEO1 and PEO4 cells were transfected with pDR-GFP using FugeneHD. Following puromycin selection, 106 cells were plated and 24 hours later transfected with either 1μg pI-SceI or pCAAGs (negative empty vector control). 24 hours later, cells were infected with dl922-947 (MOI 50 for PEO4 cells MOI 500 for PEO1 cells). 24 hours thereafter, cells were analysed for GFP events using a FACSCaliber. 100,000 events were recorded and results analyzed using FlowJo software.

Results

Adenovirus cytotoxicity is greater in homologous recombination (HR) competent ovarian cancer cells

To investigate the link between cellular HR function and adenovirus activity, we first utilised the PEO1/PEO4 cell pair (26). These cells originate from the same ovarian cancer patient: PEO1 was derived at the time of first, platinum-sensitive relapse and contains a deleterious BRCA2 mutation; PEO4 was derived at subsequent relapse, when platinum resistance had developed, and contains a secondary BRCA2 mutation that restores the open reading frame (27). Using a previously described assay of HR competence, based upon formation of RAD51 foci in response to DSB damage (28), we confirmed that PEO4 cells demonstrate functional HR, whilst PEO1 are HR defective (Fig. 1A and S1). We also confirmed that BRCA2 mutant PEO1 are more sensitive than BRCA2 wild-type PEO4 to both cisplatin and the poly-(ADP) ribose polymerase (PARP) inhibitor rucaparib (Fig. S2).

Figure 1. Greater efficacy and viral DNA replication in HR competent than HR defective ovarian cancer cells.

Figure 1

Open in a new tab

A. Competence of homologous recombination was assessed in PEO1 and PEO4 cells. Cells were treated with rucaparib (10 μM, 24h), permeabilised, fixed in 4% PFA and stained for RAD51 and γH2AX. RAD51 foci were counted in at least 30 nuclei per treatment condition. Bars represent mean (+/− s.d.) number of RAD51 foci per cell. Dotted line represents 2x number of foci in untreated cells.

B. 104 PEO1 and PEO4 cells were infected in triplicate with dl922-947. Cell survival was measured 120h post-infection by MTT assay. Mean +/− s.d. IC50 for four experiments are shown: *; p=0.011

C. 104 PEO1 and PEO4 cells were infected in triplicate with Ad5 WT (left) or dl309 (right) (MOI 0.001 – 1000 pfu/cell). Cell survival was measured 120h post-infection by MTT assay.

D. PEO1 and PEO4 cells were infected with Ad CMV-GFP (left) at MOI 60 and 100 (PEO1) and 6 and 10 (PEO4). GFP positivity was assessed 24h post-infection by flow cytometry. PEO1 and PEO4 cells were also infected with dl922-947 (right) at MOI 60 and 100 (PEO1) and 6 and 10 (PEO4). Cell survival was assessed 120h post-infection by MTT assay. Data represent mean +/− s.d., n=3. ***: p<0.001.

E. PEO1 and PEO4 cells were infected with dl922-947 MOI 100 (PEO1) or 10 (PEO4). Protein was harvested up to 72h post-infection. Expression of E1A and adenovirus 5 structural proteins was assessed by immunoblot. E1A band density was assessed from three separate exposures – at 24h, 48 and 72h, mean (+/− s.d.) E1A:KU70 ratio was 1.3 +/− 0.2, 1.4 +/− 0.1 and 1.4 +/− 0.2 for PEO1, and 0.7 +/− 0.4, 1.2 +/− 0.3 and 1.6 +/− 0.2 for PEO4.

F and G. PEO1 and PEO4 cells were infected with dl922-947 MOI 100 (PEO1) or 10 (PEO4) for up to 72h. Virus replication was assessed by TCID50 (1F) or quantitative PCR (1G). ***: p<0.001.

H. PEO1 and PEO4 cells were infected with dl922-947 MOI 100 (PEO1) or 10 (PEO4) for up to 72h. DNA was extracted and subjected to neutral pulsed-field gel electrophoresis, probed with HRP-labelled adenovirus type 5 probe. 100 ng purified dl922-947 DNA was run as positive control (+)

We found PEO4 to be significantly more sensitive to cytotoxicity induced by the E1A CR2 deleted Ad5 vector dl922-947 (Fig. 1B) as well as Ad5 WT and dl309 (E1A wild-type) (Fig. 1C). PEO4 were slightly more infectable with Ad5 vectors than PEO1 (data not shown). However, even when MOI was adjusted to ensure equal levels of infection (hereafter called iso-infection), PEO4 remained significantly more sensitive to both dl922-947 and dl309 (Fig. 1D). This increased sensitivity in PEO4 was confirmed by clonogenic assay (Fig. S3). By immunoblot, there was comparable early (E1A) and late viral protein expression in iso-infected cells (Fig. 1E). Assessing viral replication, there was no significant difference in the number of infectious virions generated following iso-infection (Fig. 1F). However, quantitative PCR indicated that there was more viral DNA generated in PEO4 (Fig. 1G), which was confirmed by Southern blotting (Fig. 1H). There were no obvious abnormalities in viral DNA processing on the Southern blot, and specifically no obvious concatemers in either cell line (Fig. 1H and Fig. S4 for long exposure). The increased sensitivity appeared to be Ad5-specific, as there was no difference between PEO1 and PEO4 in sensitivity to the group B adenoviruses Ad11 and Ad35 (Fig. S5).

Adenovirus DNA replication triggers the DNA damage response and interacts with core HR machinery

We first investigated whether the difference in sensitivity to Ad5 vectors between HR proficient and deficient cells was reflected in their accumulation of DNA damage. In keeping with their germline BRCA2 mutation and genomic instability (29), uninfected PEO1 cells demonstrated greater basal levels of DNA damage (γH2AX positivity) and a higher proportion of the cells with >4N DNA content on flow cytometry than PEO4 (Fig. 2A and Fig. S1 and S6). However, following iso-infection with dl922-947, there were significantly greater increases in both γH2AX positivity and >4N DNA in PEO4 (Fig. 2A), consistent with our previous observations that virus-induced DNA damage correlates with sensitivity (22, 30).

Figure 2. dl922-947 replication induces genomic DNA damage; RAD51 and BRCA2 co-localise with sites of adenovirus replication.

Figure 2

Open in a new tab

A. PEO1 and PEO4 cells were harvested 48h following infection with dl922-947 (MOI 100 and 10 respectively) or mock infection, fixed in 70% cold ethanol, incubated with an anti-γH2AX Ab, counter-stained with PI and analysed by flow cytometry (left). Increase in γH2AX-positive cells and cells with >4N DNA are plotted (right) – bars represent mean +/− s.d., n=3. ***: p<0.001.

B and C. PEO1 and PEO4 cells were harvested following infection with dl922-947 (MOI 100 and 10 respectively). Expression of E1A, MRE11 (B) and RAD51 (C) was detected by immunoblot.

D and E. PEO1 and PEO4 cells were fixed in 4% PFA following infection with dl922-947 (MOI 300 and 30 respectively). Expression of adenovirus E2 DNA binding protein, BRCA2 (D) and RAD51 (E) was assessed by confocal microscopy.

Inhibition of NHEJ using the DNA-PKcs NU7026 had no effect on cytotoxicity (data not shown), and, as previously noted (14), there was a reduction in expression of MRE11 following dl922-947 infection in both PEO1 and PEO4 (Fig. 2B), and the reduction was similar in both cell lines. However, expression of RAD51 did not diminish following infection in either PEO1 or PEO4 (Fig. 2C). By confocal microscopy, BRCA2 expression was maintained in PEO4 following dl922-947 infection. Interestingly, there was clear co-localisation between BRCA2 and viral replication centres (VRC), as indicated by expression of viral E2 DNA binding protein (E2 DBP – Fig. 2D). Furthermore, we also saw clear co-localisation between RAD51 and E2 DBP in PEO4 (Fig 2E). It is widely known that, in BRCA2-deficient cells, RAD51 is unable to form foci at the site of DNA damage (Fig. S1 and (28)). However, to our surprise, we observed RAD51 foci co-localised with E2 DBP in PEO1 cells, despite the absence of BRCA2 (Fig. 2E). These findings were confirmed in two other lines that demonstrated HR competence, TOV21G and HeLa (Fig. 3A), as well as in IGROV1 cells, which are hypermutated and contain mutations in both BRCA1 and BRCA2 (31) (http://cancer.sanger.ac.uk/cell_lines/sample/overview?id=905968) and were HR defective in our assay (Fig. 3A). In both HR competent lines, there was co-localisation between viral replication centres and BRCA2 (Fig. 3B, Fig. S7), whilst all three lines, regardless of HR status, showed RAD51 foci associated with E2 DBP (Fig. 3C). Co-immunoprecipitation suggested a direct interaction between RAD51 and E2 DBP following Ad5 infection in TOV21G cells (Fig. 3D). Thus, for the first time, these data show that RAD51 and BRCA2 can localise to viral replication centres and that this is independent of recruitment to DNA damage foci.

Figure 3. RAD51 and BRCA2 co-localise with sites of adenovirus replication in multiple malignant cell lines.

Figure 3

Open in a new tab

A. Homologous recombination competence was assessed in TOV21G, HeLa and IGROV1 cells as for Figure 1A. Bars represent mean (+/− s.d.) number of RAD51 foci per cell. Dotted line represents 2x number of foci in untreated cells. TOV21G and HeLa demonstrate HR competence, whilst IGROV1 are HR defective.

B and C. Cells were fixed in 4% PFA following infection with dl922-947 (MOI 10). Expression of adenovirus E2 DNA binding protein, BRCA2 (B) and RAD51 (C) was assessed by confocal microscopy.

D. RAD51 was immunoprecipitated from TOV21G infected with dl922-947 (MOI 10) and the presence of E2 DNA binding protein was detected by immunoblotting.

RAD51 and BRCA2 influence adenovirus efficacy in both HR competent and HR deficient cells

To investigate the requirement for RAD51 in viral replication and cytotoxicity, we depleted RAD51 using two different siRNA constructs in both PEO1 and PEO4 cells (Fig. 4A). RAD51 depletion caused significant reductions in efficacy of dl922-947 in both cell lines (Fig. 4B and Fig. S8), and also reduced viral replication (Fig. 4C). Again, these findings were recapitulated in HR competent HeLa and TOV21G cells, with reductions in both viral cytotoxicity (both dl922-947 and dl309) and replication (Fig. 4D, 4E and S9) upon RAD51 silencing, as well as by clonogenic assay in PEO1 and PEO4 cells (Fig. S10). Moreover, we were able to confirm this finding in HR defective IGROV1 cells (Fig. 4F). We also found a small but significant reduction in cytotoxicity following BRCA2 knockdown in PEO4 (Fig. 5A), which was recapitulated in TOV21G and HeLa cells (Fig. 5B and C). Taken together, our data suggest that recruitment of RAD51 and BRCA2 to VRC augments viral replication and cytotoxicity, and is independent of its role in the response to DNA damage.

Figure 4. RAD51 knockdown decreases adenovirus efficacy and replication.

Figure 4

Open in a new tab

A. Using two different siRNA pools, RAD51 was knocked down in both PEO1 and PEO4 cells.

B and C. 24h following siRNA-mediated RAD51 knockdown, PEO1 (MOI 300) and PEO4 cells (MOI 30) were infected with dl922-947 (left) and dl309 (right, MOI 500 and 50). Survival was assessed 96h post-infection by MTT assay (B). Viral replication was also assessed 48h post-infection by quantitative PCR (C). *; p<0.05. ***: p<0.001.

D – F. 24h following siRNA-mediated RAD51 knockdown, TOV21G (D), HeLa (E) and IGROV1 (F) cells were infected with dl922-947 (MOI 1, 8 and 5 respectively). Survival was assessed 96h post-infection by MTT assay. RAD51 knockdown was confirmed by immunoblot. Viral replication was also assessed in TOV21G 48h post-infection. **; p<0.01. ***: p<0.001.

Figure 5. BRCA2 knockdown also decreases adenovirus efficacy and replication.

Figure 5

Open in a new tab

A. 24h following siRNA-mediated BRCA2 knockdown, PEO4 cells were infected with dl922-947 (MOI 30). Survival was assessed 96h post-infection by MTT assay. BRCA2 knockdown was confirmed by quantitative RT-PCR, normalised to 18S RNA. *; p<0.05. ***: p<0.001.

B and C. 24h following siRNA-mediated BRCA2 knockdown, TOV21G (B) and HeLa (C) cells were infected with dl922-947 (MOI 1 and 2 for TOV21G; MOI 8 for HeLa). Survival was assessed 96h post-infection by MTT assay. BRCA2 knockdown was confirmed by quantitative RT-PCR in TOV21G cells, normalised to 18S RNA. *; p<0.05. ***: p<0.001.

dl922-947 does not inhibit HR function in HR competent cell lines

To assess whether adenovirus infection impaired the capacity of cells to repair DNA double strand break damage by HR, we first used confocal microscopy. In HR competent cells infected with dl922-947, RAD51 was able to localise, at least partially, to sites of DNA DSB damage, suggesting that HR function remains grossly intact following adenovirus infection (Fig. 6A). This functionality was further assessed using a fluorescence reporter assay, which incorporates a green fluorescence protein reporter (DR-GFP) as a repair substrate into the genome and assays non-crossover gene conversion events in response to DNA DSB damage (See Materials and Methods for full assay details). The HR competence of PEO4 cells was again confirmed by this assay, with a significant increase in GFP events following expression of I-Scel compared to control plasmid, whereas PEO1 showed no increase (Fig. 6B). RAD51 knockdown abolished any increase GFP events in PEO4 (Fig. S11). To investigate the effect of adenovirus infection on overall HR function, this assay was repeated 48 hours after infection with dl922-947 - results again showed that PEO4, but not PEO1, was able to repair I-SceI-induced DNA DSB damage using HR (Fig. 6C). This implies that Ad5 infection does not functionally impair homology-mediated repair. To confirm this, PEO4 cells were treated with the PARP inhibitor rucaparib 24h following dl922-947 or mock infection: the presence of dl922-947 was unable to sensitise PEO4 cells to rucaparib (Fig. 6D), again indicating that HR function remains intact following Ad5 infection.

Figure 6. Adenovirus infection does not inhibit homology-mediated DNA repair.

Figure 6

Open in a new tab

A. PEO4 cells were infected with dl922-957 (MOI 10). 24h post-infection, cells were fixed. Expression of γH2AX and RAD51 was assessed by confocal microscopy.

B. PEO1 and PEO4 cells stably expressing DR-GFP plasmid were transfected with a plasmid encoding the rare cutting endonuclease (pI-SceI) or control plasmid. 24h thereafter, expression of GFP was assessed by flow cytometry. Data show fold change in GFP positive events following pI-SceI transfection relative to control plasmid (dotted line). Bars represent mean +/− s.d. *: p<0.05 compared to control plasmid transfection.

C. PEO1 and PEO4 cells stably expressing DR-GFP plasmid were infected with dl922-947 (MOI 50 and 500 respectively). 24h later, they were transfected with pI-SceI or control plasmid. 24h thereafter, expression of GFP was assessed by flow cytometry. Data again show fold change in GFP positive events following pI-SceI transfection relative to control plasmid (dotted line). Bars represent mean +/− s.d. ***: p<0.001 compared to control plasmid transfection.

D. PEO4 cells were infected with dl922-947 MOI 50 and 24 hours later treated with rucaparib (0.01 – 300 μM) for 72h.

Together, these results indicate that Ad5 vectors do not inhibit HR function in infected cells – rather, components of the HR machinery localise to VRC and bind directly to E2 DBP. This interaction promotes viral DNA replication and increases overall cytotoxicity.

Discussion

In this manuscript, we show for the first time that components of the HR pathway of DNA double strand break (DSB) repair significantly influence the activity of Ad5 vectors. Using matched BRCA2 mutant and wild-type ovarian cancer cells, we show that the activity of both E1A wild-type (Ad5 WT and dl309) and E1A CR2-deleted (dl922-947) Ad5 viruses is greater in the presence of functional BRCA2, with increased cytotoxicity and viral DNA replication, and that BRCA2 co-localises with viral replication centres (VRC) within the nucleus. These results were re-capitulated in other malignant cell lines, HeLa and TOV21G, that are BRCA2 wild-type and HR competent. Moreover, we were able to demonstrate that RAD51, a key partner of BRCA2, also influences Ad5 activity. Strikingly, we show that RAD51 influences adenovirus activity and locates to VRC in the absence of functional BRCA2.

HR is vitally important in the biology of high grade serous ovarian cancer (HGSOC). Tumours with intact HR are less likely to respond to platinum-based chemotherapy (4) and have a worse overall prognosis (6). HR is a complex process involving multiple proteins. However, BRCA2 is particularly important, as it mediates the loading of RAD51 onto 3′-single stranded DNA overhangs (created by MRE11 nuclease activity), creating a RAD51 nucleoprotein filament. The nucleoprotein filament then catalyses the critical step of HR, namely strand invasion and homology search on the sister chromatid.

The interaction between adenoviral infection and the DDR is complex; in contrast to other forms of DNA damage, such as irradiation, where damage occurs almost instantaneously, viral infection represents a dynamic onslaught to the cell, which makes analysis challenging. However, the DNA damage response is clearly activated following viral infection – here and previously (22), we show robust phosphorylation of H2AX following infection with dl922-947 and other Ad5 viruses, which others have also observed (32). We have also shown that Ad5 infection activates replication-dependent ATR/Chk1 signalling (22). Ad5 inhibits DDR using a variety of mechanisms, prime amongst which is proteasome-mediated degradation of key cellular proteins, including MRE11 and DNA Ligase IV. Degradation is largely orchestrated by E1B55K and E4orf6, in concert with cellular proteins Cul5, Rbx1 and elongins B and C (15, 33), whilst infection with E4-deleted viruses results in concatemer formation (34). Consistent with these previous findings, we show here that MRE11 expression diminishes following Ad5 infection in ovarian cancer cells, regardless of their HR competence, and that inhibition of DNA-PK has no effect on overall cytotoxicity in both HR competent and HR defective cells. In addition, our Southern blot showed no concatemer formation in either PEO4 or PEO1 cells, suggesting that viral DNA can be processed correctly regardless of the state of cellular HR competence.

The relocation of other DDR proteins, including RPA32 (35), ATR, ATRIP, Rad9, TOPBP1, Rad17 and hnRNPUL1 (36-38), to VRC following Ad5 infection has been described previously. However, it has been unclear whether this re-localisation inhibits DNA damage repair function or whether it is required for viral replication (reviewed in (39)) – in the case of BRCA2 and RAD51, our data suggest the latter, as loss of either protein reduces Ad5 replication. In addition, using three different techniques to assess HR function, our results suggest that the ability of cells to repair DNA DSB damage via HR is not inhibited following Ad5 infection. This reinforces the idea that Ad5 utilises components of the HR pathway rather than degrading and inhibiting them as is the case with NHEJ.

Several key questions remain. First, how do cells retain the apparent capacity to repair DSB damage by HR following the proteasomal degradation of MRE11, which is critical for endresection? Although MRE11 is clearly critical to end resection, other molecules, in particular CtIP and Exo1, can also fulfil this role (40, 41). Thus, it is possible that other proteins substitute for the MRE11 end-resection function following Ad5 infection. Also, degradation of MRE11 is not complete (see Fig. 2B and (42)) – thus, there may be a dosage effect whereby the remaining MRE11 retains sufficient end resection capacity following adenovirus infection. Nonetheless, whatever residual HR capacity remains following infection is still unable to repair virus-induced genomic DNA damage. This may result from both the cell cycle and DNA replication states induced by the virus. Adenovirus infection drives infected cells into an S phase-like state, with endoreduplication of genomic DNA (43). However, genomic DNA replication is clearly disorganised, which may preclude reliable generation of intact sister chromatids. In addition, adenovirus infection causes over-ride of multiple cell cycle checkpoints, with appearance of multiple abnormal mitoses (21). Thus, cells may slip rapidly through S and G2 phases, thereby precluding HR repair. This re-emphasises the challenge of investigating cellular responses to adenovirus infection, where changes are dynamic and evolve over a period of 48 – 72 hours.

A second key question is how do BRCA2 and RAD51 relocate to VRC and which adenovirus proteins drive the process? And indeed what is their precise function within these VRC? Ad5E4orf3 is responsible for re-localisation of PML protein into cytoplasmic tracks, but whether it is also responsible for movement of cellular proteins into VRC is unknown. Our immunoprecipitation suggested a direct interaction between RAD51 and E2DBP – our attempts at immunoblot and immunoprecipitation of BRCA2 were unsuccessful, so we do not know whether there is also a similar direct interaction with E2DBP. Certainly, the RAD51 role in viral efficacy appears independent of its function in HR as knockdown in HR incompetent cell lines also reduces viral efficacy. Our data, however, show that the presence of BRCA2 together with RAD51 results in more efficient viral replication. Adenovirus DNA replication generates a displaced single strand of parental DNA in addition to a duplex formed of a newly synthesised daughter strand plus the other parental strand, a structure that could resemble a replication fork. Both RAD51 and BRCA2 have recently been shown to protect newly replicated DNA strands at stalled replication forks from degradation (44, 45) and this role is independent of their function in HR. It is possible that adenovirus utilises this function of RAD51 and BRCA2 resulting in more accurate and efficient viral DNA replication, and that RAD51 can execute this role alone. Certainly, no BRCA2 homologue has been identified in lower eukaryotes, including S.cerevisiae in which Rad51 alone can resolve replication stress. Clearly adenoviral replication and cytotoxicity can still occur in the absence of BRCA2 and RAD51, suggesting that these proteins are supportive rather than critical to the adenoviral lifecycle.

Third, why are there differences between adenovirus species in this effect? Here we show that sensitivity to Ad11 and Ad35 does not vary between BRCA2 WT and mutant cells, and previous data demonstrate that DDR proteins vary in their targeting by different adenoviral serotypes (42). Nonetheless, it is clear that interaction with DDR machinery is a widespread phenomenon in DNA virus infection. ATM is required for optimal replication of SV40 (46) and HSV-1 requires ATM and the MRN complex for virus replication (47), whilst proteins involved in HR have been shown to localise to EBV VRCs (48).

In summary, we show for the first time that adenovirus type 5 re-localises components of the HR pathway to VRC and that viral replication is enhanced in the presence of functional HR. We have recently shown that oncolytic adenoviruses may be more effective in ovarian cancers with paclitaxel resistance (30). Data here show that these viruses may also have specific activity in another group of poor prognosis ovarian cancers, namely those with platinum and PARP inhibitor resistance thought intact HR function. Given the importance of HR in the biology of high grade serous ovarian cancer, an understanding of the interaction between HR and any novel therapy is particularly important in patient selection for clinical trials and identification of novel virus/drug combinations.

Supplementary Material

Supplementary Figure Legends
Supplementary Figures

Acknowledgements

We thank Linda Hammond and Guglielmo Rosignoli for technical assistance with microscopy and flow cytometry respectively.

Grant support: This work was funded by the Medical Research Council, grant references G1002009 (to LT) and G0601891 (to IAMcN).

Footnotes

Conflict of interest: The authors have no conflict of interest to declare.

References

  • 1.Alexandrov LB, Nik-Zainal S, Wedge DC, Aparicio SA, Behjati S, Biankin AV, et al. Signatures of mutational processes in human cancer. Nature. 2013;500:415–21. doi: 10.1038/nature12477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alsop K, Fereday S, Meldrum C, Defazio A, Emmanuel C, George J, et al. BRCA Mutation Frequency and Patterns of Treatment Response in BRCA Mutation-Positive Women With Ovarian Cancer: A Report From the Australian Ovarian Cancer Study Group. J Clin Oncol. 2012;30:2654–63. doi: 10.1200/JCO.2011.39.8545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.TCGA Integrated genomic analyses of ovarian carcinoma. Nature. 2011;474:609–15. doi: 10.1038/nature10166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mukhopadhyay A, Plummer ER, Elattar A, Soohoo S, Uzir B, Quinn JE, et al. Clinicopathological Features of Homologous Recombination-Deficient Epithelial Ovarian Cancers: Sensitivity to PARP Inhibitors, Platinum, and Survival. Cancer Res. 2012;72:5675–82. doi: 10.1158/0008-5472.CAN-12-0324. [DOI] [PubMed] [Google Scholar]
  • 5.McNeish I, Coleman RL, Oza A, Konecny G, O'Malley DM, Kichenadasse G, et al. Updated Results of Ariel2, a Phase 2 Open-Label Study to Identify Ovarian Cancer Patients Likely to Respond to Rucaparib. International Journal of Gynecological Cancer. 2014;24:323–4. [Google Scholar]
  • 6.Bolton KL, Chenevix-Trench G, Goh C, Sadetzki S, Ramus SJ, Karlan BY, et al. Association between BRCA1 and BRCA2 mutations and survival in women with invasive epithelial ovarian cancer. JAMA. 2012;307:382–90. doi: 10.1001/jama.2012.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Heise C, Hermiston T, Johnson L, Brooks G, Sampson-Johannes A, Williams A, et al. An adenovirus E1A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nature Med. 2000;6:1134–9. doi: 10.1038/80474. [DOI] [PubMed] [Google Scholar]
  • 8.Fueyo J, Gomez-Manzano C, Alemany R, Lee P, McDonnell T, Mitlianga P, et al. A mutant oncolytic adenovirus targeting the Rb pathway produces anti-glioma effect in vivo. Oncogene. 2000;19:2–12. doi: 10.1038/sj.onc.1203251. [DOI] [PubMed] [Google Scholar]
  • 9.Lockley M, Fernandez M, Wang Y, Li NF, Conroy SE, Lemoine NR, et al. Activity of the adenoviral E1A deletion mutant dl922-947 in ovarian cancer: comparison with adenovirus wild-type, bioluminescence monitoring and intraperitoneal delivery in icodextrin. Cancer Res. 2006;66:989–98. doi: 10.1158/0008-5472.CAN-05-2691. [DOI] [PubMed] [Google Scholar]
  • 10.Leyton J, Lockley M, Aerts JL, Baird SK, Aboagye EO, Lemoine NR, et al. Quantifying the Activity of Adenoviral E1A CR2 Deletion Mutants Using Renilla Luciferase Bioluminescence and 3′-Deoxy-3′-[18F]Fluorothymidine Positron Emission Tomography Imaging. Cancer Res. 2006;66:9178–85. doi: 10.1158/0008-5472.CAN-06-1539. [DOI] [PubMed] [Google Scholar]
  • 11.Baird SK, Aerts JL, Eddaoudi A, Lockley M, Lemoine NR, McNeish IA. Oncolytic adenoviral mutants induce a novel mode of programmed cell death in ovarian cancer. Oncogene. 2008;27:3081–90. doi: 10.1038/sj.onc.1210977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Flak MB, Connell CM, Chelala C, Archibald K, Salako MA, Pirlo KJ, et al. p21 promotes oncolytic adenoviral activity in ovarian cancer and is a potential biomarker. Mol Cancer. 2010;9:175. doi: 10.1186/1476-4598-9-175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Karen KA, Hearing P. Adenovirus Core Protein VII Protects the Viral Genome from a DNA Damage Response at Early Times after Infection. J Virol. 2011;85:4135–42. doi: 10.1128/JVI.02540-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Karen KF, Hoey PJ, Young CS, Hearing P. Temporal regulation of the Mre11-Rad50-Nbs1 complex during adenovirus infection. J Virol. 2009;83:4565–73. doi: 10.1128/JVI.00042-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Harada JN, Shevchenko A, Pallas DC, Berk AJ. Analysis of the adenovirus E1B-55K-anchored proteome reveals its link to ubiquitination machinery. J Virol. 2002;76:9194–206. doi: 10.1128/JVI.76.18.9194-9206.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Araujo FD, Stracker TH, Carson CT, Lee DV, Weitzman MD. Adenovirus type 5 E4orf3 protein targets the Mre11 complex to cytoplasmic aggresomes. J Virol. 2005;79:11382–91. doi: 10.1128/JVI.79.17.11382-11391.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Evans JD, Hearing P. Relocalization of the Mre11-Rad50-Nbs1 complex by the adenovirus E4 ORF3 protein is required for viral replication. J Virol. 2005;79:6207–15. doi: 10.1128/JVI.79.10.6207-6215.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Baker A, Rohleder KJ, Hanakahi LA, Ketner G. Adenovirus E4 34k and E1b 55k oncoproteins target host DNA ligase IV for proteasomal degradation. J Virol. 2007;81:7034–40. doi: 10.1128/JVI.00029-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Boyer J, Rohleder K, Ketner G. Adenovirus E4 34k and E4 11k inhibit double strand break repair and are physically associated with the cellular DNA-dependent protein kinase. Virology. 1999;263:307–12. doi: 10.1006/viro.1999.9866. [DOI] [PubMed] [Google Scholar]
  • 20.Orazio NI, Naeger CM, Karlseder J, Weitzman MD. The adenovirus E1b55K/E4orf6 complex induces degradation of the Bloom helicase during infection. J Virol. 2011;85:1887–92. doi: 10.1128/JVI.02134-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Connell CM, Wheatley SP, McNeish IA. Nuclear survivin abrogates multiple cell cycle checkpoints and enhances viral oncolysis. Cancer Res. 2008;69:7923–31. doi: 10.1158/0008-5472.CAN-08-0817. [DOI] [PubMed] [Google Scholar]
  • 22.Connell CM, Shibata A, Tookman LA, Archibald KM, Flak MB, Pirlo KJ, et al. Genomic DNA damage and ATR-Chk1 signaling determine oncolytic adenoviral efficacy in human ovarian cancer cells. J Clin Invest. 2011;121:1283–97. doi: 10.1172/JCI43976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983;65:55–63. doi: 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
  • 24.Plessis D, Sale JE. Monitoring I-SceI-induced double-strand break repair in DT40 cells. Methods Mol Biol. 2012;920:371–7. doi: 10.1007/978-1-61779-998-3_26. [DOI] [PubMed] [Google Scholar]
  • 25.Pierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev. 1999;13:2633–8. doi: 10.1101/gad.13.20.2633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Langdon SP, Lawrie SS, Hay FG, Hawkes MM, McDonald A, Hayward IP, et al. Characterization and properties of nine human ovarian adenocarcinoma cell lines. Cancer Res. 1988;48:6166–72. [PubMed] [Google Scholar]
  • 27.Sakai W, Swisher EM, Jacquemont C, Chandramohan KV, Couch FJ, Langdon SP, et al. Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2-mutated ovarian carcinoma. Cancer Res. 2009;69:6381–6. doi: 10.1158/0008-5472.CAN-09-1178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mukhopadhyay A, Elattar A, Cerbinskaite A, Wilkinson SJ, Drew Y, Kyle S, et al. Development of a functional assay for homologous recombination status in primary cultures of epithelial ovarian tumor and correlation with sensitivity to poly(ADP-ribose) polymerase inhibitors. Clin Cancer Res. 2010;16:2344–51. doi: 10.1158/1078-0432.CCR-09-2758. [DOI] [PubMed] [Google Scholar]
  • 29.Cooke SL, Ng CK, Melnyk N, Garcia MJ, Hardcastle T, Temple J, et al. Genomic analysis of genetic heterogeneity and evolution in high-grade serous ovarian carcinoma. Oncogene. 2010;29:4905–13. doi: 10.1038/onc.2010.245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ingemarsdotter CK, Tookman LA, Browne A, Pirlo K, Cutts R, Chelela C, et al. Paclitaxel resistance increases oncolytic adenovirus efficacy via upregulated CAR expression and dysfunctional cell cycle control. Molecular oncology. 2015;9:791–805. doi: 10.1016/j.molonc.2014.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Domcke S, Sinha R, Levine DA, Sander C, Schultz N. Evaluating cell lines as tumour models by comparison of genomic profiles. Nat Commun. 2013;4:2126. doi: 10.1038/ncomms3126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Nichols GJ, Schaack J, Ornelles DA. Widespread phosphorylation of histone H2AX by species C adenovirus infection requires viral DNA replication. J Virol. 2009;83:5987–98. doi: 10.1128/JVI.00091-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Querido E, Blanchette P, Yan Q, Kamura T, Morrison M, Boivin D, et al. Degradation of p53 by adenovirus E4orf6 and E1B55K proteins occurs via a novel mechanism involving a Cullin-containing complex. Genes Dev. 2001;15:3104–17. doi: 10.1101/gad.926401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Weiden MD, Ginsberg HS. Deletion of the E4 region of the genome produces adenovirus DNA concatemers. Proc Natl Acad Sci U S A. 1994;91:153–7. doi: 10.1073/pnas.91.1.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Stracker TH, Lee DV, Carson CT, Araujo FD, Ornelles DA, Weitzman MD. Serotype-specific reorganization of the Mre11 complex by adenoviral E4orf3 proteins. J Virol. 2005;79:6664–73. doi: 10.1128/JVI.79.11.6664-6673.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Blackford AN, Bruton RK, Dirlik O, Stewart GS, Taylor AM, Dobner T, et al. A role for E1B-AP5 in ATR signaling pathways during adenovirus infection. J Virol. 2008;82:7640–52. doi: 10.1128/JVI.00170-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Carson CT, Schwartz RA, Stracker TH, Lilley CE, Lee DV, Weitzman MD. The Mre11 complex is required for ATM activation and the G2/M checkpoint. Embo J. 2003;22:6610–20. doi: 10.1093/emboj/cdg630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Carson CT, Orazio NI, Lee DV, Suh J, Bekker-Jensen S, Araujo FD, et al. Mislocalization of the MRN complex prevents ATR signaling during adenovirus infection. Embo J. 2009;28:652–62. doi: 10.1038/emboj.2009.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Turnell AS, Grand RJ. DNA viruses and the cellular DNA-damage response. J Gen Virol. 2012;93:2076–97. doi: 10.1099/vir.0.044412-0. [DOI] [PubMed] [Google Scholar]
  • 40.Gravel S, Chapman JR, Magill C, Jackson SP. DNA helicases Sgs1 and BLM promote DNA double-strand break resection. Genes Dev. 2008;22:2767–72. doi: 10.1101/gad.503108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Makharashvili N, Tubbs AT, Yang SH, Wang H, Barton O, Zhou Y, et al. Catalytic and noncatalytic roles of the CtIP endonuclease in double-strand break end resection. Mol Cell. 2014;54:1022–33. doi: 10.1016/j.molcel.2014.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Forrester NA, Sedgwick GG, Thomas A, Blackford AN, Speiseder T, Dobner T, et al. Serotype-specific inactivation of the cellular DNA damage response during adenovirus infection. J Virol. 2011;85:2201–11. doi: 10.1128/JVI.01748-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Cherubini G, Petouchoff T, Grossi M, Piersanti S, Cundari E, Saggio I. E1B55K-deleted adenovirus (ONYX-015) overrides G1/S and G2/M checkpoints and causes mitotic catastrophe and endoreduplication in p53-proficient normal cells. Cell Cycle. 2006;5:2244–52. doi: 10.4161/cc.5.19.3263. [DOI] [PubMed] [Google Scholar]
  • 44.Hashimoto Y, Ray Chaudhuri A, Lopes M, Costanzo V. Rad51 protects nascent DNA from Mre11-dependent degradation and promotes continuous DNA synthesis. Nature structural & molecular biology. 2010;17:1305–11. doi: 10.1038/nsmb.1927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schlacher K, Christ N, Siaud N, Egashira A, Wu H, Jasin M. Double-Strand Break Repair-Independent Role for BRCA2 in Blocking Stalled Replication Fork Degradation by MRE11. Cell. 2011;145:529–42. doi: 10.1016/j.cell.2011.03.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sowd GA, Mody D, Eggold J, Cortez D, Friedman KL, Fanning E. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products. PLoS Pathog. 2014;10:e1004536. doi: 10.1371/journal.ppat.1004536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lilley CE, Carson CT, Muotri AR, Gage FH, Weitzman MD. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc Natl Acad Sci U S A. 2005;102:5844–9. doi: 10.1073/pnas.0501916102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kudoh A, Iwahori S, Sato Y, Nakayama S, Isomura H, Murata T, et al. Homologous recombinational repair factors are recruited and loaded onto the viral DNA genome in Epstein-Barr virus replication compartments. J Virol. 2009;83:6641–51. doi: 10.1128/JVI.00049-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure Legends
NIHMS65584-supplement-Supplementary_Figure_Legends.docx (111.2KB, docx)
Supplementary Figures
NIHMS65584-supplement-Supplementary_Figures.ai (2.2MB, ai)

RESOURCES