Skip to main content
NCBI home page
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2014 Nov 24;12(6):729–742. doi: 10.1038/cmi.2014.110

Over-activation of TLR5 signaling by high-dose flagellin induces liver injury in mice

Yang Xiao 1, Fang Liu 1, Jingyi Yang 1, Maohua Zhong 1, Ejuan Zhang 1, Yaoming Li 1, Dihan Zhou 1, Yuan Cao 1, Wei Li 1, Jie Yu 1, Yi Yang 1, Huimin Yan 1
PMCID: PMC4716618  PMID: 25418468

Abstract

Flagellin is a potent activator of a broad range of cell types that are involved in innate and adaptive immunity. Therefore, it is a good adjuvant candidate for vaccines, and it might function as a biological protectant against both major acute radiation syndrome during cancer radiotherapy and a mitigator of radiation emergencies. However, accumulating evidence has implicated flagellin in the occurrence of some inflammatory diseases, such as acute lung inflammation, cardiovascular collapse and inflammatory bowel disease. The aim of this study was to elucidate whether only flagellin-TLR5 signaling activation plays a role in the pathophysiology of liver or whether some other flagellin activity also contributes to liver injury either via bacterial infections or during clinical applications. Recombinant flagellin proteins with or without TLR5-stimulating activity were used to evaluate the role of flagellin-TLR5 signaling in liver injury in wild-type and TLR5 KO mice. Gross lesions and large areas of hepatocellular necrosis were observed in liver tissue 12 h after the intraperitoneal administration of 100 or 200 µg flagellin (FliC) in a dose- and time-dependent manner in wild-type mice, but not in TLR5 KO mice. Deletion of the N-terminal or TLR5 binding domain of flagellin inhibited flagellin-induced inflammatory responses and the subsequent acute liver function abnormality and damage. These data confirmed that flagellin is an essential determinant of liver injury and demonstrated that the over-activation of TLR5 signaling by high-dose flagellin caused acute inflammatory responses, neutrophil accumulation and oxidative stress in the liver, which contributes to the progression and severity of flagellin-induced liver injury.

Keywords: flagellin, liver injury, pathological effect, TLR5

Introduction

Bacterial flagellin is a well-known typical pathogen-associated molecular pattern that can be recognized by cell surface toll-like receptor 5 (TLR5)1 and the cytosolic NLRC4 inflammasome receptor, NAIP5.2,3 TLR5 detects flagellin at the cell surface and signals through MyD88, resulting in the induction of pro-inflammatory cytokines, chemokines, antimicrobial defenses and antiapoptotic effects.4,5,6 NAIP5/NLRC4 senses flagellin in the cytosol and activates caspase-1, which leads to the secretion of the pro-inflammatory cytokine, IL-1β7 and pyroptotic cell death.8 Flagellin contains two highly conserved N/C domains (D0 and D1) and one central hypervariable domain (D2/D3).9,10,11 The hypervariable domain is vastly diverse in size and amino-acid composition among bacterial strains and species.4 The conserved D0 and D1 domains are required for the immune activity of flagellin as a pathogen-associated molecular pattern. D1 interacts directly with TLR5,12 and the N-terminal amino acid residues 90–97 (QRVRELAV) of D1 form a highly conserved motif that is essential for both high-affinity binding to TLR5 and subsequent signaling.13 The 35 C-terminal amino acids of flagellin are responsible for the interaction between flagellin with NAIP5.14

TLRs usually regulate innate immune responses to initiate and enhance host antimicrobial defenses. The TLR5 agonist, flagellin, is a potent activator of a broad range of cell types that are involved in innate and adaptive immunity. Therefore, an increasing number of studies have used flagellin as an adjuvant because of its ability both to promote cytokine production by a range of innate cell types and to trigger adaptive immune responses in a manner that is distinct from cognate antigen recognition.15 Furthermore, flagellin has the potential to be used as a biological protectant against both major acute radiation syndrome during cancer radiotherapy and a mitigator of radiation emergencies.6 Vijay-Kumar et al.16 demonstrated that the systemic administration of flagellin might be a relatively safe means of providing temporary nonspecific protection against chemical, bacterial, viral and radiation challenge. However, in contrast, several studies have shown that flagellin not only triggers a prototypical systemic inflammatory response in mice, including the induction and secretion of pro-inflammatory cytokines in the lungs, small intestine, liver and kidney,17 but also plays an important pathophysiological role in certain inflammatory diseases. Flagellin-specific CD4+ T cells might induce severe colitis when adoptively transferred into naive SCID mice.18 Flagellin also participates in the pathophysiology of colitis, and flagellin released from commensal bacteria in the gut might contribute to chronic bowel inflammation diseases.19 The intravenous administration of flagellin in mice can elicit severe acute lung inflammation.20 TLR5 signaling is a key molecular pathway that mediates lung inflammation during cystic fibrosis.21 The flagellin–TLR5 axis might also trigger cardiac innate immune responses and result in cardiovascular dysfunction.22 Consistent with previous reports,23,24 we previously demonstrated that either intranasally or intraperitoneally administered flagellin could induce a significant increase in the serum aminotransferase levels in mice,25 suggesting that flagellin might be a potent inducer of liver damage. Flagellin-triggered responses exert various effects on different cells, tissues and organs; these responses vary greatly according to the dose, physiological condition of the cell, the animal used and the experimental setting.15,17,26 However, the beneficial flagellin-activated responses for host defenses and the potential adverse effects of flagellin in different organs can be contradictory. Therefore, the flagellin-triggered pathophysiological responses should be explored further to provide a clearer understanding of the correlation between the pattern recognition receptors (PRRs)–flagellin interaction and its pathophysiological effects to enhance the application of recombinant flagellin as a prophylactic and therapeutic agent. It will also help define the role of flagellin during severe bacterial infection and sepsis.

Because flagellin is linked to a wide range of diseases and might induce significant liver damage based on our observations25 and those of other studies,23,27 flagellin might be an essential determinant of liver injury. However, flagellin can also activate the inflammasome NLRC4 pathway in addition to TLR5 signaling. It is unclear whether the activation of only flagellin-TLR5 signaling plays a role in the pathophysiology of liver or whether other flagellin activities also contribute to liver injury during bacterial infections or for the clinical application of flagellin. Therefore, in present study, we used recombinant flagellin proteins with or without TLR5-stimulating activity to evaluate the role of flagellin-TLR5 signaling in liver injury in wild-type and TLR5 KO mice. Our results demonstrated that the activation of TLR5 signaling was associated with inflammation, neutrophil accumulation and oxidative stress in the liver, which contributed to liver injury in mice. Moreover, relieving oxidative stress or depletion of neutrophils in the liver could help alleviate the flagellin-TLR5-induced liver injury.

Materials and methods

Cloning the fliC gene from Salmonella and the generation of recombinant FliC-expressing DNA constructs

The fliC gene from Salmonella enterica subsp. (GenBank Accession No. 1070204) and a plasmid containing the complete fliC gene was used to construct truncation, deletion and chimeric plasmids; the appropriate oligonucleotide primers were designed based on the full-length flagellin fliC28 (Table 1). Two appropriate restriction enzyme sites were introduced into each amplified DNA fragment, and the amplimers were cloned into the pET28 plasmid vector (Invitrogen/Life Technologies, Carlsbad, CA, USA). All plasmids contained a six-His Tag at the C-terminus of the recombinant proteins. All recombinant plasmids were transformed into competent Escherichia coli BL21 cells (DE3), selected and then confirmed by DNA sequencing (Invitrogen/Life Technologies).

Table 1. Oligonucleotide primers used to generate the flagellin variants pFliCΔ1–180, pFliCΔ90–97 and pFliΔ472–506.

Plasmid Restriction site Sequence (5′–3′)
pFliCΔ1–180 NdeI GCGCGCATATG CCGAAAGAAACTGCTGTAACCGT
  XhoI GCCGATCTCGAG ACGCAGTAAAGAGAGGACGTTTTG
pFliCΔ90–97 Nco I GCGCGCCATGGCACAAGTCATTAATACA
    GTTGTTGTTGATTTCGTTCAGCGC
  XhoI GTTCAGTCTGCGAATGGTACTAAC
    GCCGATCTCGAGACGCAGTAAAGAGAGGACGTTTTG
    TTAGTACCATTCGCAGACTGAACGTTGTTGTTGATTTCGT
    ACGAAATCAACAACAACGTTCAGTCTGCGAATGGTACTAA
pFliΔ472–506 Nco I CGCGTTCCATGGCACAAGTCATTAATACA
  Xho I GATGATCTCGAGGGTTGCGTAGTCGGAATC
Open in a new tab

Expression and purification of recombinant FliC, FliCΔ1–180, FliCΔ90–97 and FliCΔ472–506

Transformed E. coli BL21 (DE3) cells containing recombinant flagellin constructs expressing FliC, FliCΔ1–180, FliCΔ90–97 and FliCΔ472–506 were grown and induced as described previously.28 These recombinant proteins were prepared and purified using affinity chromatography on a Ni-NTA column (Qiagen, Venlo, Limburg, Netherlands). The concentrations of the purified proteins were measured using Bradford protein assays. The purified proteins were verified with western blotting, and antibody–antigen complex formation was visualized using SuperSignal West Pico Chemiluminescent Substrate (Pierce/Thermo Fisher Scientific, Waltham, MA, USA) followed by imaging on a Versadoc 3000 imager (Bio-Rad, Hercules, CA, USA).

Analyzing the recombinant flagellin purity

Contaminating lipopolysaccharide (LPS) was removed from the purified recombinant proteins using Affinity Pak Detoxi Gel Endotoxin Removing gels (Pierce), and the residual LPS content was measured using a Limulus assay (Associates of Cape Cod, East Falmouth, MA, USA). The endotoxin values of the purified recombinant flagellin preparation was <0.03 EU/mg. Pathogen-associated molecular pattern contamination was further analyzed using 5–200 µg/ml of purified protein to stimulate flagellin-non-responsive RAW264.7 cells15 overnight.

MCP-1 and IL-8 releasing assays

Caco-2 cells were maintained in the Dulbecco's modified Eagle medium (Invitrogen/Life Technologies) that was supplemented with 10% fetal bovine serum (Gibco/Life Technologies, Carlsbad, CA, USA). The cells were seeded at a density of 2×105/well in 24-well plates at 37 °C in 5% CO2. For the IL-8 and MCP-1 release assays, Caco-2 cells were generally used 7 days later. After an overnight culture in media without fetal bovine serum, tightly polarized monolayers were stimulated with 100 ng/ml concentrated recombinant flagellin proteins for 6 h. The supernatants were collected, and the IL-8 and MCP-1 levels were measured using enzyme-linked immunosorbent assay (ELISA) kits (BD Biosciences, Franklin Lakes, NJ, USA). The experiment was repeated at least three times.

Macrophage, splenocyte and intrahepatic immune cell preparation

Peritoneal macrophages were obtained as described previously.29 Resident peritoneal macrophages were collected from naïve animals by RPMI 1640 lavage, resuspended in RPMI 1640 containing 10% fetal bovine serum and seeded at a density of 1×105 cells/well in 96-well plates. After an overnight incubation, the cells were washed to remove non-adherent cells. Splenocyte suspensions were then prepared by homogenization and cultured as described previously.30 Intrahepatic immune cells were obtained from mouse livers as described in a previous study.31 Briefly, livers were first perfused with 10 ml of PBS via the portal vein to remove circulating lymphocytes and were then passed through a 70-µm cell strainer (Becton Dickinson, Franklin Lakes, NJ, USA). Total liver cells were digested with 10 ml of RPMI 1640 medium containing 0.02% (w/v) collagenase IV (Sigma, St Louis, MO, USA) and 0.002% (w/v) DNase I (Sigma) for 30–40 min at 37 °C. The cells were then washed with RPMI 1640 medium and then underlaid with mouse lymphocyte isolation medium (Biolegend, San Diego, CA, USA). After centrifugation for 20 min at 1500g, intrahepatic lymphocytes were isolated at the interface, washed twice with RPMI 1640 medium and then analyzed.

Stimulating macrophages with recombinant flagellin

Macrophages were pre-treated with 50 ng/ml LPS for 3 h. They were then stimulated with flagellin in RPMI 1640 medium supplemented with 3% FBS and antibiotics in the presence of purified flagellin protein in its free form or inserted into DOTAP (Roche Diagnostics, BASEL, Switzerland), a cationic lipid formulation that permits the delivery of proteins into the cytosol.30,32 Briefly, DOTAP Liposomal Transfection Reagent (15 µl; Roche, BASEL, Switzerland) was incubated for 20 min in serum-free media with 5 µg purified recombinant flagellin. Then, 1 ml of RPMI 1640 medium was added, and an aliquot of 100 µl was added to the macrophages (for a final concentration of 100 nM in 96-well plates). Supernatants were collected at the indicated time points, and IL-1β was quantified using ELISA kits (eBioscience, San Diego, CA, USA). Each sample was analyzed in triplicate, and the results are representative of at least three experiments.

FACS analysis of the immune cell populations

Splenocytes or intrahepatic immune cells were pre-incubated with anti-CD16/32 to block non-specific FcRγ binding and were then stained with a mixture of mAbs against anti-CD45-PE/Cy7 (clone 30-F1 1), anti-Gr-1-PE (clone RB6-8C5), anti-CD11b-FITC (clone M1/70), anti-F4/80-APC (clone BM8), anti-CD4-FITC (clone GK1.5), anti-CD-25-PE (clone 2A3) and anti-Foxp3-APC (clone PCH101). All antibodies were purchased from Biolegend or eBioscience. Neutrophils were defined as CD45+, CD11b+ and GR-1+, macrophages were defined as CD45+, CD11 b+ and F4/80+, and regulatory T cell (Tregs) were defined as CD4+, CD25+ and Foxp3+. Flow cytometry data were acquired on a FACS AriaIII flow cytometer (BD Biosciences), and 100 000–150 000 lymphocyte-gated events were collected per sample. Analyses were performed using the FlowJo (Tree Star, Ashland, OR, USA) software.

Neutrophil depletion

For cell type-specific neutrophil depletion, mice were treated 1 day before treatment with flagellin. Anti-Ly6G antibodies (clone 1A8)33 were diluted to a concentration of 100 µg/100 µl and were injected intraperitoneally into C57BL/6 mice. Rat IgG2a antibodies were used as the isotype control. Flagellin treatment was performed 24 h post-depletion, and the mice were killed after 12 h.

Animal experiments

Six- to eight-week-old female, specific pathogen-free C57BL/6 mice were purchased from the Center for Disease Control of Hubei Province, China. The mice were housed in an SPF room in the Experimental Animal Center of the Wuhan Institute of Virology, Chinese Academy of Sciences (WIV, CAS), and were exposed to 12 h light/dark cycles; the temperature was maintained at 23±1 °C. The animal studies were performed according to the Regulations for the Administration of Affairs Concerning Experimental Animals in China (1988), and the Guidelines for Animal Care and Use, WIV and CAS (permit number WIVA09201203). All animal studies and methods conformed to the ARRIVE guidelines. All animals were assigned randomly to groups before the experiments.

Experiment 1

FliC was suspended in 200 µl of saline aseptically, and four groups of mice (n=6) were administered intraperitoneally with 0, 5, 50, 100 or 200 µg of full-length flagellin; the control groups received saline only. All animals were sacrificed and blood samples were collected after 8 h to measure alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity. The experiment was repeated at least three times.

Experiment 2

Two groups of mice (n=36) were treated intraperitoneally with 200 µl of saline or FliC (200 µg/mouse). Six mice from each group were sacrificed at 0, 1, 6, 12 and 24 h after treatment. Blood samples were collected in capillary tubes by retro-orbital puncture prior to sacrifice and were used for biochemical analyses. All liver tissues were preserved in 10% buffered formaldehyde for histological examinations. The experiment was repeated at least three times.

Experiment 3

Five groups of mice (n=24) were injected intraperitoneally with 200 µl of saline, FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506 (all recombinant proteins with administered at a dose of 200 µg/mouse dissolved in saline). Six mice from each group were sacrificed 12 h after treatment. Before sacrifice, blood samples were collected to measure the serum ALT and AST levels, and liver samples were harvested to quantify GSH and malondialdehyde (MDA) expression. Liver injury, as assessed using ALT and AST, was confirmed by histopathology using 10% formalin-fixed, paraffin-embedded, 4-µm liver sections that were stained with hematoxylin and eosin (H&E). The experiment was repeated at least three times.

Experiment 4

Four groups of TLR5 KO mice (n=24) were injected intraperitoneally with 200 µl of saline, FliC, FliCΔ1–180 or FliCΔ90–97 (all recombinant proteins with used at a dose of 200 µg/mouse dissolved in saline). Six mice from each group were sacrificed 12 h after treatment. Before sacrifice, blood samples were collected for ALT and AST level analyses, and liver samples were collected for GSH and MDA analyses. Liver injury, as assessed using ALT and AST, was confirmed with histopathology using 10% formalin-fixed, paraffin-embedded, 4-µm liver sections that were stained with H&E. The experiment was repeated at least three times.

Experiment 5

Except the blank control group (n=6), one mouse group (n=12) was treated with 200 µl saline as a mock and one mouse group (n=12) was treated with GSH (100 mg/kg each time, Sigma) in 200 µl saline on alternate days for 7 days, twice a day at 8 h intervals. Six of the 12 mice that received either GSH or saline were injected intraperitoneally with FliC (200 µg/mouse in saline). The remaining 12 mice were divided into GSH-treated and saline-treated groups. Mice from each group were killed 12 h after treatment. Blood samples were collected for the ALT and AST level analyses, and liver samples were harvested to measure GSH and MDA expression. This experiment was repeated at least three times.

Biochemical analysis of blood samples

All animals were fasted for 12 h before blood sample collection. In the present study, liver function was evaluated by measuring the serum levels of ALT and AST at Zhongnan Hospital of Wuhan University.

Oxidative stress-related biomarker assays

GSH

GSH levels were measured using colorimetric microplate assay kits purchased from the Beyotime Institute of Biotechnology, Haimen, China. Briefly, 40 µl metaphosphoric acid was added to 10 µl liver homogenates, and then centrifuged at 10 000g for 10 min at 4 °C. The supernatants were used for GSH assays. GSH levels were quantified using a dithionitrobenzoic acid–glutathione disulfide reductase recycling assay. The total protein concentration in parallel samples was measured using a BCA protein assay kit (Beyotime, Haimen, China). GSH levels were normalized to protein content.

MDA

For the lipid peroxidation assays, commercial kits (Beyotime) were used to quantify MDA generation according to the manufacturer's protocol. Briefly, liver tissue samples were harvested after all mice were killed, and the samples were then homogenized in RIPA buffer on ice. Tissue lysates were then centrifuged at 10 000g for 20 min at 4 °C to remove debris. The supernatants were used to measure MDA levels and protein content. The total protein concentration of parallel samples was measured using BCA protein assay kits (Beyotime), and MDA concentrations were normalized to protein content.

Histopathological examinations

At the end of the study, all animals were sacrificed by cervical dislocation at the indicated time points. Necropsy was performed to analyze the macroscopic external features of the liver. The organs were excised carefully, fixed in 10% formalin and embedded in paraffin blocks. Four-micrometer sections were cut from two regions of each paraffin-embedded tissue block that were separated by ∼200 µm and were then examined using H&E staining. The slides were observed using an Olympus BX-51 microscope.

Statistical analyses

Results were expressed as the means±standard deviations (s.d.). Statistical analyses were performed using the Instat GraphPad software, version 5.0. Time- and dose-dependent effects were analyzed using two-way analysis of variance; all other data analyses were performed using one-way analysis of variance. Statistical significance is indicated by * (P<0.05).

Results

High-dose flagellin induced acute liver function abnormality, damage and oxidative stress

As reported previously,23,24 flagellin induced widespread systemic inflammation and significant increase in aminotransferase levels in the serum,25 which might result in liver injury. To more precisely define the features underlying this phenomenon, the potential time- and dose-dependent effects of flagellin on the development of liver injury were analyzed. Briefly, C57BL/6 mice were treated intraperitoneally with 0, 5, 10, 50, 100 or 200 µg full-length recombinant flagellin derived from Salmonella typhi (FliC).28 LPS was used as a positive control, and saline alone was the negative control. After all animals were killed, necropsies were performed to assess the presence of gross lesions in the lung, heart, liver, spleen, kidney and small intestine. No gross pathological lesions were observed in the heart, spleen, kidney, or small intestine (data not shown), but they were present in the lung and liver. As shown in the left panel of Figure 1a, gross lesions were observed in the livers of mice 12 h after treatment with 100 or 200 µg FliC. Microscopic pathological analysis also revealed that the mice that received 100 or 200 µg FliC exhibited large areas of hepatocellular necrosis in liver tissue, which was accompanied by granulocyte infiltration similar to that observed in the LPS group (lower panel of Figure 1a). Additionally, there was a significant increase in ALT and AST levels in mice treated with 100 or 200 µg flagellin compared with mice that received 0, 5, 10 or 50 µg FliC. This result suggests that flagellin-induced liver injury was dose-dependent in vivo and that a dose of at least 100 µg was needed to induce liver injury (Figure 1b).

Figure 1.

Figure 1

Open in a new tab

Liver functional abnormality and damage induced by FliC. (a) Dose-dependent flagellin-induced liver injury and representative gross appearance of the liver. C57BL/6 mice were treated intraperitoneally with 0, 5, 10, 50, 100 or 200 µg of full-length flagellin. Six mice from each group were sacrificed 24 h after treatment, and their livers were photographed and then fixed. Paraffin-embedded liver tissue sections were examined using H&E staining. Original magnification was ×100. Arrows indicate areas of hepatocellular necrosis. (b) Dose-dependent effects of flagellin-induced serum ALT and AST activity. C57BL/6 mice were injected intraperitoneally with 0, 5, 10, 50, 100 or 200 µg of full-length flagellin. Six mice from each group were sacrificed 12 h after treatment, and blood samples were collected to measure serum ALT and AST activity. (c) Serum inflammatory cytokine levels were measured using ELISA at the indicated times after flagellin administration (200 µg/mouse). (d) A time course of flagellin-induced serum ALT and AST activity. C57BL/6 mice were treated with saline or flagellin. Six mice from each group were sacrificed 0, 1, 6, 12 and 24 h after treatment, and blood samples were collected to measure serum ALT and AST activity. (e) GSH or MDA levels were measured as an indicator of oxidant stress in the liver, as described in the section on ‘Materials and methods'. *P<0.05. ALT, alanine aminotransferase; AST, aspartate aminotransferase; H&E, hematoxylin and eosin; MDA, malondialdehyde.

We next assessed the time course of the effects of flagellin on mouse livers. Mice were sacrificed at the indicated time points after the intraperitoneal administration of 200 µg FliC or saline. Blood and liver tissue samples were collected, and the cytokine and ALT/AST responses in the serum were measured. As shown in Figure 1c, the treatment of mice with FliC resulted in a rapid increase in serum IL-6 and keratinocyte-derived chemoattractant (KC) 4 h after FliC delivery compared with control mice. In contrast, the ALT/AST levels in the serum of mice injected with 200 µg FliC began to increase after 6 h, and reached a peak at 12 h (Figure 1d). However, this process was reversible. Specifically, the gross or microscopic pathological lesions disappeared after 168 h (data not shown). Furthermore, the GSH and MDA levels in liver tissue were measured, and the data revealed that GSH decreased over time and was lowest level at 12 h. Additionally, MDA levels increased with time and reached a peak at 12 h after the administration of 200 µg FliC (Figure 1f), which suggests that FliC resulted in hepatocyte oxidative stress, similar to that observed in Gram-negative bacterial sepsis, alcohol or hepatitis C virus-induced liver disease.34,35,36 These data suggest that a high-dose of flagellin induced acute liver abnormality, damage and oxidative stress.

Deletion of amino acids 1–180 or 90–97 of flagellin inhibited the flagellin-induced inflammatory responses and subsequent acute liver function abnormality and damage

To further investigate the effects of recombinant Salmonella typhi flagellin on liver function and possible pathological lesions in internal organs, three novel recombinant flagellins were expressed and purified: one variant with a deletion of the N-terminus (FliCΔ1–180), one with the TLR5 binding domain deleted (QRVRELAV) (FliCΔ90–97), and one with the NLRC4-activating domain deleted (35 C-terminal amino acids; FliCΔ472–506) (Figure 2a). To assess whether these recombinant flagellins could stimulate pro-inflammatory cytokine production via TLR5, Caco-2 cells that expressed TLR5 constitutively were used as an in vitro model. As shown in Figure 2b, FliC and FliCΔ472–506, but not FliCΔ1–180 or FliCΔ90–97, could activate Caco-2 cells to produce IL-8 or secrete MCP-1, which suggests that the pro-inflammatory activity of recombinant FliC was dependent upon TLR5. Next, peritoneal macrophages were prepared as an ex vivo model to assess the ability of flagellin and its variant proteins to activate NLRC4 signaling. As also shown in Figure 2b, FliC, FliCΔ1–180 and FliCΔ90–97, but not FliCΔ472–506, could activate mouse peritoneal macrophages to produce IL-1β via caspase-1 activation, whereas the use of DOTAP as a delivery agent did not induce IL-1β secretion (Figure 2b). Additionally, LPS alone was unable to induce IL-1β secretion (data not shown). This result confirms that FliCΔ1–180 and FliCΔ90–97 lost the ability to stimulate TLR5, but retained the ability to stimulate the inflammasome response via NLRC4.

Figure 2.

Figure 2

Open in a new tab

(a) FliC and flagellin mutants. Schematic diagram showing the domain structures and deletion variants. (1) FliC, full-length flagellin; (2) FliCΔ1–180, FliC with amino acids 1–180 deleted; (3) FliCΔ90–97, FliC with f amino acids 90–97 in the conserved N-terminal domain deleted; (4) FliCΔ472–506, FliC with the NLRC4-activating domain deleted (35 C-terminal amino acids). (b) Differential activation of TLR5 signaling in Caco-2 cells treated with flagellin and its mutants. IL-8 and MCP-1 production was measured in Caco-2 cells stimulated with FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506 using ELISA. *P<0.05. (c) A time course of flagellin- and its mutant-induced inflammatory cytokine production in vivo. Five C57BL/6 mice from each group were treated with saline or 10 µg/mouse of FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506 and were then sacrificed 4, 8, 12 or 24 h after treatment. Blood samples were collected to measure serum KC and IL-6 production. *P<0.05. (d) Changes in serum ALT and AST activity were measured in mice treated with saline, FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506. Mice were injected intraperitoneally with 200 µg FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506, and killed after 12 h. Blood samples were then collected to measure serum ALT and AST activity. Data are expressed as the mean±s.d., *P<0.05 vs. saline control. (e) GSH and MDA levels were determined as an indicator of oxidative stress in the liver, as described in the section on ‘Materials and methods'. (f) H&E-stained sections of liver tissues 12 h after treatment. Original magnification was ×100. Arrows indicate areas of hepatocellular necrosis. ALT, alanine aminotransferase; AST, aspartate aminotransferase; H&E, hematoxylin and eosin; KC, keratinocyte-derived chemoattractant; MDA, malondialdehyde.

We next assessed the pro-inflammatory activity of FliCΔ1–180, FliCΔ90–97, FliCΔ472–506 and FliC in mice. Briefly, C57BL/6 mice were injected intraperitoneally with 10 g (400 g/kg body weight) of purified recombinant FliC, FliCΔ1–180, FliCΔ90–97 or FliCΔ472–506. Sera were then collected, and IL-6, KC and IL-18 production was measured. Neither FliCΔ1–180 nor FliCΔ90–97 could induce IL-6 and KC production similar to the saline control. In contrast, FliC and FliCΔ472–506 induced significant IL-6 and KC production at 4 h (Figure 2c), which was similar to the effects of 200 µg recombinant flagellin (Figure 1c). Additionally, higher doses induced increased production of serum IL-6 and KC. Only FliCΔ472–506 lost the ability to induce IL-18 production, whereas FliC, FliCΔ1–180 and FliCΔ90–97 induced IL-18 efficiently compared with the saline control (Figure 2c). In summary, the flagellin variants FliCΔ1–180 and FliCΔ90–97 lost TLR5 stimulating activity but could still activate the NLRC4 pathway, whereas FliCΔ472–506 lost the ability to activate the NLRC4 pathway but retained the TLR5 stimulating activity, as expected.

To further determine whether the flagellin-induced liver injury was associated with flagellin/TLR5, NLRC4-stimulating activity or both, mice were injected intraperitoneally with 200 µg FliC, FliCΔ90–97, FliCΔ1–180 or FliCΔ472–506, and killed after 12 h. As shown in Figure 2d, the administration of FliCΔ90–97 or FliCΔ1–180 did not change the serum ALT/AST activity compared with saline, whereas FliC and FliCΔ472–506 caused a significant change, as expected. Moreover, FliC and FliCΔ472–506 caused a change in the hepatic MDA and GSH levels; however, FliCΔ90–97 or FliCΔ1–180 did not induce these changes (Figure 2e). Furthermore, there were no microscopic pathological lesions in mice treated with FliCΔ1–180 (Figure 2f) or FliCΔ90–97 (Figure 2f), but the lesions were present in those treated with FliC and FliCΔ472–506 (Figure 2f, arrow). Therefore, deleting amino acids 1–180 or 90–97 of flagellin substantially diminished the flagellin-induced inflammatory responses and subsequent acute liver function abnormality and injury. This finding suggests that flagellin-induced liver pathological changes might be dependent upon the activation of flagellin-TLR5 signaling because the deletion of the TLR5 binding motif abolished the pathological effects. Furthermore, the involvement of flagellin-NLRC4 activity in flagellin-induced liver pathological changes could be excluded.

Flagellin-induced liver injury and oxidant stress were abolished in TLR5 KO mice

To assess whether the flagellin-induced liver pathological effects were dependent upon the activation of flagellin-TLR5 signaling, we performed parallel experiments in TLR5 knockout (TLR5 KO) and wild-type mice (WT). Mice were treated intraperitoneally with 200 µg FliC, and liver pathological lesions were detected microscopically. Serum IL-6/KC and ALT/AST as well as hepatic IL-6/KC and GSH/MDA were also detected. As shown in Figure 3A, microscopic pathological assessments revealed that there was no hepatocellular necrosis in the TLR5 KO mice. However, microscopic pathological lesions were observed in wild-type mice treated with FliC. Additionally, the treatment did not cause a significant increase in serum KC and IL-6 levels in the TLR5 KO mice compared with the wild-type mice after 4 h (Figure 3b). Furthermore, serum ALT and AST activities were comparable in the TLR5 KO and wild-type mice treated with FliC (Figure 3c). Similarly, no significant KC and IL-6 production was observed in the TLR5 KO mouse livers (TLR5KO+FliC); however, they were changed in the wild-type (WT+FliC) mice treated with FliC (Figure 3d). The GSH and MDA levels were also measured in the TLR5 KO mice and wild-type mice following the administration of 200 µg flagellin. The GSH levels did not change significantly 12 h after flagellin treatment in TLR5 KO mice, but they decreased significantly in the wild-type mice (Figure 3e). Accordingly, MDA levels in the liver did not change significantly in the TLR5 KO mice, but they increased about threefold, 12 h after flagellin administration in the wild-type mice (Figure 3f). Therefore, flagellin-induced liver injury and oxidative stress were abolished in the TLR5 KO mice. This result further confirmed that high-dose flagellin-induced liver injury was dependent upon flagellin-TLR5 signaling activation.

Figure 3.

Figure 3

Open in a new tab

TLR5 KO mice abolished severe liver injury and hepatic GSH depletion after challenge with flagellin. (a) Representative histopathological images of the livers of flagellin-treated WT and TLR5 KO mice. Original magnification was ×100. Arrows indicate areas of hepatocellular necrosis. (b) Serum inflammatory cytokine levels in WT vs. TLR5 KO mice 4 h after flagellin challenge. (c) Serum ALT and AST in WT and TLR5 KO mice following the administration of saline or 200 µg flagellin. (d) Liver inflammatory cytokine levels in WT and TLR5 KO mice 4 h after flagellin challenge. (e, f) Fold changes in GSH and MDA levels in WT and TLR5 KO mice 12 h after the administration of saline or flagellin. *P<0.05. ALT, alanine aminotransferase; AST, aspartate aminotransferase; KO, knockout; MDA, malondialdehyde; WT, wild-type.

GSH-treatment alleviated flagellin-induced oxidative stress and liver injury in mice

To further confirm that flagellin-induced hepatic GSH depletion was associated with its effect on liver injury, we assessed whether pre-treatment with GSH could attenuate flagellin-induced liver injury in mice. Short-term pre-treatment with GSH in wild-type mice had little effect on FliC-induced MDA increase and liver injury (data not shown). However, when wild-type mice were treated with GSH twice daily (2 mg/mouse/dose) for 7 days, GSH levels were significantly increased in the liver of GSH-treated mice (Figure 4a, left panel), whereas MDA concentrations in the livers of GSH-treated mice were unchanged compared with untreated mice (Figure 4b, right panel). Meanwhile, the GSH-treated mice (Figure 4a, group GSH+FliC) exhibited significantly higher levels of hepatic GSH but lower levels of MDA, 12 h after FliC administration compared with the saline-treated mice (Figure 4a, left panel and Figure 4b, right panel, saline+FliC). Furthermore, the 7-day continuous injection of GSH had no obvious effect on FliC-induced serum IL-6 production (data not shown), but it significantly alleviated FliC-induced serum AST/ALT levels compared with the saline+FliC or FliC group (Figures 4c and 4d). Because MDA is an in vivo oxidative stress biomarker37 and is generated from reactive oxygen species, these results demonstrate that exogenous GSH supplementation in the liver by continuous administration could attenuate oxidative stress and decrease the production of MDA in the liver. Therefore, GSH-treatment alleviated high-dose flagellin-induced oxidative stress and the associated liver injury.

Figure 4.

Figure 4

Open in a new tab

Effects of exogenous GSH injection on flagellin-induced liver injury in WT mice. Mice were treated with 100 mg/kg GSH or saline by i.p. injection twice daily for 7 days. Some mice were also challenged with flagellin and were sacrificed after 12 h. Hepatic GSH and MDA levels in liver tissue homogenates and serum ALT/AST activity were measured, as described in the section on ‘Materials and methods'. (a, b) Fold changes in GSH and MDA levels. (c, d) Serum ALT and AST activity was measured in each mouse. *P<0.05. ALT, alanine aminotransferase; AST, aspartate aminotransferase; MDA, malondialdehyde; WT, wild-type.

Neutrophils play an important role in high-dose flagellin-induced liver injury in mice

Because the above data suggest that oxidative stress plays a role in flagellin-induced liver injury, we next investigated whether the oxidative stress was caused by intrahepatic immune pressure. We further analyzed three types of immune cells: neutrophils, to assess oxyradical delivery, macrophages (the largest liver resident and infiltrating cell type), and Tregs, which protect against immunopathological damage. As shown in Figure 5a, intraperitoneal injection with flagellin induced a significant accumulation of intrahepatic neutrophils in a dose-dependent manner. Specifically, treatment with 200 µg flagellin increased the number of intrahepatic neutrophils by 15% compared with 2.5% in the control group. The number of intrahepatic macrophages was also increased significantly, but to a similar level regardless of the amount of flagellin administered. No significant change was found in the frequency of intrahepatic Tregs (Figure 5a, upper panel). Flagellin induced a dose-dependent increase in the neutrophil frequency in the spleen. The number of macrophages was increased in the spleen after treatment with flagellin, similar to those in the liver, but there were no dose dependent effects. However, the number of Tregs in the spleen was increased when doses of flagellin that were higher than 10 µg were administered (Figure 5a, lower panel). This result suggests that there was significant and dose-dependent neutrophil accumulation in both the liver and spleen, and it suggests that the upregulation of intrahepatic and peripheral neutrophils might be related to liver damage.

Figure 5.

Figure 5

Open in a new tab

Neutrophils play an important role in flagellin-induced liver injury. C57BL/6 mice were treated with flagellin doses of 10–200 µg/mouse and were then sacrificed 12 h after injection. (a) The neutrophil, macrophage, and Treg numbers in the liver and spleen were then analyzed. Neutrophils were defined as CD45+, CD11b+ and GR-1+, macrophages were defined as CD45+, CD11 b+ and F4/80+, and Tregs were defined as CD4+, CD25+ and Foxp3+. Neutrophils were depleted using anti-mouse Ly6G or isotype control antibodies and were then treated with a high dose of flagellin (200 µg/mouse). Mice were sacrificed 12 h after treatment with flagellin. (b) Intrahepatic neutrophils and macrophages were isolated and quantified. (c) Serum ALT and AST activity were measured. *P<0.05 vs. flagellin-treated control mice. (d) Histological analysis of liver sections using H&E staining. Arrows indicate the sites of pathological changes in hepatocyte and neutrophil infiltration. Original magnification was ×200. ALT, alanine aminotransferase; AST, aspartate aminotransferase; H&E, hematoxylin and eosin; Treg, regulatory T cell.

To clarify whether the accumulation of intrahepatic neutrophils plays a key role in flagellin-induced liver damage, we depleted neutrophils using specific antibodies. After the injection of anti-mouse Ly6G antibodies, neutrophils were cleared adequately, but the number of macrophages was not changed (data not shown). Twenty-four hours after depletion, mice were treated with 200 µg/mouse flagellin, and intrahepatic immune cells, serum aminotransferase and liver histological staining were analyzed. In the neutrophil-depleted group, flagellin did not induce the accumulation of neutrophils in the liver, whereas macrophage accumulation was unchanged (Figure 5b). Surprisingly, there were no significant increases in ALT and AST in the neutrophil-depleted mice after flagellin treatment (Figure 5c). Consistent with this, the neutrophil-depleted mice exhibited much less hepatocellular necrosis than the flagellin-treated control mice according to microscopic pathological analysis (Figure 5d). Therefore, the neutrophil depletion protected against flagellin-induced liver injury. This suggests that neutrophils play a major role in flagellin-induced liver damage and that the depletion of neutrophils could successfully rescue the liver from high-dose flagellin-induced injury.

Discussion

In this study, we observed gross lesions and large areas of hepatocellular necrosis in the livers of mice 12 h after the intraperitoneal administration of 100 or 200 µg FliC. The data revealed that flagellin induced the production of pro-inflammatory cytokines, AST, ALT, GSH and MDA, as well as liver injury in a dose- and time-dependent manner. These data suggest that flagellin is an essential determinant of liver injury, and demonstrated that the over-activation of TLR5 signaling by high-dose flagellin caused liver injury, which is dependent upon the flagellin/TLR5 axis. This observation helps our understanding of previous reports regarding the ‘beneficial' and ‘harmful' immune responses elicited by flagellin. There might be a specific dose of flagellin that activates the TLR5 axis to switch the responses from ‘beneficial' to ‘harmful'.

Upon the recognition of flagellin during flagellated bacterial infections, TLR5 signaling induces potent innate immune responses for the initial host defense against the bacteria. TLR5 is expressed predominantly in the liver and lungs, and it is expressed at only low levels in most other tissues.17,22,38 Notably, the liver is an important organ that senses bacterial infection via flagellin/TLR5 signaling. However, no obvious inflammation occurs in healthy livers, even though the liver is constantly exposed to a certain amount of flagellin and other bacterial products from the commensal and enteroinvasive microflora that are carried through the portal circulation to the liver. It is assumed that the liver normally regulates innate immune responses partly by modulating TLR signals to reach a state of ‘liver tolerance'.39 Therefore, a breakdown of liver tolerance and the resulting inappropriate or excessive immune responses in the liver should be considered to be the main reason for bacterial infections that are related to acute and chronic inflammatory liver diseases.40 This explains the phenomena whereby liver injury and dysfunction are common in patients with severe sepsis and septic shock,41 where a large number of bacterial-derived TLR agonists are produced. The current study suggested that flagellin is an important initiator of liver injury in severe bacterial infections because flagellin circulates in significant concentrations in the plasma of patients with typhoid fever42 or septic shock.20 Additionally, different doses of flagellin that are used to evaluate pathophysiological effects might result in opposing conclusions. For example, the intravenous injection of 100 µg flagellin/mouse induced liver damage, as determined by increased serum ALT/AST levels.23 An additional study did not observe the same side effects using 25–50 µg/mouse.16 This is one reason why we analyzed the dose-dependent effects of flagellin on the development of liver injury in mice and tested doses of 0–200 µg. The current data suggest that the gross lesions in liver and significant increase in serum ALT/AST levels usually occurred 12 h after the intraperitoneal treatment with 100 or 200 µg, but not with lower doses.

Although the role of LPS as a potent inducer of hepatic innate immune responses and liver injury during severe bacterial infection is widely established,41 the pathological role of flagellin in the liver remains elusive. By creating deletion variants of recombinant flagellin, FliCΔ1–180 and FliCΔ90–97 derived from Salmonella typhi, we confirmed that deleting amino acids 1–180 or 90–97 of flagellin substantially abolished the TLR5 activity of flagellin, and diminished the pro-inflammatory cytokine response and subsequent acute liver function abnormality and damage. In the host, no flagellin-induced liver expression of KC and IL-6 was detected in TLR5 KO mice, which further demonstrated that the flagellin-induced inflammatory liver responses and the associated induced injury were mediated by TLR5. Furthermore, flagellin-NLRC4 activity might be excluded from flagellin-induced liver pathological effects based on the results observed with FliCΔ472–506 in TLR5 KO mice. These data suggest, for the first time, that the pathological effects of flagellin in the liver were mediated mainly by TLR5 signaling activation.

The current study revealed that flagellin-induced hepatic GSH depletion and increased MDA production were absent in TLR5 KO mice, suggesting that TLR5 also plays a critical role in inducing oxidative stress. Reduced glutathione is an antioxidant found in every cell in the body. Increasing evidence suggests that bacteremia and shock are associated with increased oxidative stress and the depletion of tissue GSH, which in turn contributes to organ dysfunction and an impaired host response to infection.43 In many forms of liver disease, the hepatic GSH pool is compromised via impaired synthesis and transport and/or overconsumption of GSH. The disruption of GSH homeostasis in the liver not only gives rise to reactive oxygen species that oxidize proteins, DNA and lipids but also affects multiple signaling pathways that modulate intermediary metabolism, survival and proliferation to contribute to the pathogenesis of various liver diseases.44 It was also suggested that thiol antioxidants and GSH-increasing agents could help attenuate liver diseases that are accompanied by the depletion of hepatic GSH.45,46 Because flagellin-induced hepatic GSH depletion was associated with the occurrence of liver injury after flagellin administration, we assessed whether the continuous injection of GSH might significantly increase basal hepatic GSH levels and enhance GSH stores. The increase in hepatic basal and enhanced stores of GSH attenuated high-dose flagellin-induced hepatic GSH depletion and the related MDA production, and thereby, reduced serum ALT/AST levels in flagellin-treated mice. This suggests that the excessive activation of flagellin/TLR5 also activates the oxidative stress machinery in the liver to result in liver damage.

Neutrophils have been widely implicated in liver injury models, such as alcoholic hepatitis, ischemia/reperfusion liver injury, endotoxic shock, adenovirus-induced liver injury, obstructive cholestasis and concanavalin A-induced liver injury.47 Therefore, we performed additional studies and demonstrated that neutrophils also play an important role in the progression of high-dose flagellin hepatotoxicity. Our data confirmed that a higher concentration of administered flagellin resulted in an increased accumulation of neutrophils in the liver, which was totally dependent upon TLR5 activation. The neutrophil accumulation reached a peak 12 h after the flagellin administration, which was consistent with the peak serum ALT/AST levels. Additionally, flagellin induced macrophages to migrate toward the liver and spleen efficiently, but without dose-dependence. Interestingly, flagellin could increase the Treg frequency in the spleen, but not in the liver. Recently, Hao et al.48 found that recombinant flagellin prolonged allograft survival, which was associated with the activation of recipient Tregs in a TLR5-dependent manner. Because Tregs are a protective cell type during immunopathological damage, this suggests that Tregs do not play a role in flagellin-induced liver injury, but that they might play roles in other organs, such as the spleen. Therefore, flagellin-induced liver injury could be described briefly as follows: high-dose flagellin activates TLR5 in the mouse liver and induces a significant release of chemotactic factors such as KC, which induces the chemotaxis of a large number of neutrophils and macrophages into the liver. These intrahepatic neutrophils are active and capable of ingesting flagellin, resulting in the formation of a phagosome and a respiratory burst. Therefore, a large amount of reactive oxygen species and hydrolytic enzymes are secreted from intrahepatic neutrophils into the liver, which results in liver oxidative stress and injury.

The flagellin-induced response is a double-edged sword for defense and offense. In vitro, minute concentrations of flagellin can activate the pro-inflammatory cytokine response in different cell lines that express TLR5. In vivo, the critical concentration of flagellin required for the activation of TLR5 might differ among organs because of different levels of TLR5 expression and different amounts of flagellin that were delivered from the circulatory system. The flagellin/TLR5 axis both supports the sensitive and prompt need for the effective surveillance of pathogenic bacterial invasions and maintain the balance between bacterial symbionts, in which lower amount of free flagellin could be detected for both defense and protection. Consistent with this feature, some organs might be sensitive to flagellin and are easily excessively activated. Therefore, it is understandable that several studies reported that flagellin triggers pathophysiological responses in mice in many organs, including the lungs, small intestine, liver, kidney and even the heart using different experimental systems and assays. With high flagellin doses, it is possible that there are significant hemodynamic consequences. However, our current studies in TLR5-KO mice clearly and convincingly excluded the possible hemodynamic consequences. If the liver injury were due to the hemodynamic effects of high flagellin doses, then the TLR-5-KO mice would still exhibit liver injury. It is also accepted that flagellin is a novel effective adjuvant and biological protectant against radiation during anticancer therapy31 when used at an appropriate dose or/and are modified by the deletion or replacement of some part of the protein. These results suggest that flagellin might only induce liver damage at a very high dose, suggesting that flagellin is a well-regulated liver damage inducer. The current study further demonstrated that flagellin is safe and well tolerated as a vaccine adjuvant and anti-radiation or anti-cancer therapeutic agent when effective doses are used clinically. However, because it is one of the few protein structures that can activate both transmembrane and cytosolic pattern recognition receptors, flagellin should be investigated further for its pathophysiological responses in the innate and acquired immune systems during severe acute bacterial infection. It should also be assessed whether flagellin induces possible synergistic effects together with other TLR agonists, such as LPS.

Conclusion

The present study confirmed that the intraperitoneal administration of high doses of full-length recombinant flagellin caused severe acute liver function abnormality and damage. The pathological effects of flagellin were predominantly dependent upon activation of the TLR5 pathway and oxidative stress in the liver. The current data provide insight into the pathophysiological mechanism(s) of flagellin during the activation of immune responses, which further helps our understanding of the liver injury that is induced by severe acute Gram-negative bacterial infections, as well as the application of recombinant flagellin as an adjuvant or therapeutic agent. The current results demonstrated that flagellin itself could only induce liver damage at very high doses. Flagellin is safe and well tolerated as a vaccine adjuvant and anti-radiation or anti-cancer therapeutic agent when used at effective doses for clinical applications.

Acknowledgments

This work was financially supported by the National S&T Major Project on Major Infectious Diseases (Grant 2012ZX10001-008 and 2008ZX10001-010), the National Basic Research Program of China (973 Program) (Grant 2012CB518904) from the Ministry of Science and Technology of the People's Republic of China, and the National Natural Science Foundation of China (Grant 81202381). We sincerely thank Dr George Dacai Liu for his critical comments and revision of the article. We are thankful to the Core Facility and Technical Support, Wuhan Institute of Virology and Xuefang An for valuable assistance in the animal studies, as well as Ying Sun, Rong Bao and Benxia He for their help with the sample collection.

The authors have no conflict of interest to disclose.

References

  1. 1Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR et al. The innate immune response to bacterial-flagellin is mediated by Toll-like receptor 5. Nature 2001; 410: 1099–1103. [DOI] [PubMed] [Google Scholar]
  2. 2Zhao Y, Yang J, Shi J, Gong YN, Lu Q, Xu H et al. The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus. Nature 2011; 477: 596–600. [DOI] [PubMed] [Google Scholar]
  3. 3Kofoed EM, Vance RE. Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity. Nature 2011; 477: 592–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. 4Ramos HC, Rumbo M, Sirard JC. Bacterial flagellins: mediators of pathogenicity and host immune responses in mucosa. Trends Microbiol 2004; 12: 509–517. [DOI] [PubMed] [Google Scholar]
  5. 5Berin MC, Darfeuille-Michaud A, Egan LJ, Miyamoto Y, Kagnoff MF. Role of EHEC O157: H7 virulence factors in the activation of intestinal epithelial cell NF-kappa B and MAP kinase pathways and the upregulated expression of interleukin 8. Cell Microbiol 2002; 4: 635–647. [DOI] [PubMed] [Google Scholar]
  6. 6Burdelya LG, Krivokrysenko VI, Tallant TC, Strom E, Gleiberman AS, Gupta D et al. An agonist of Toll-like receptor 5 has radioprotective activity in mouse and primate models. Science 2008; 320: 226–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. 7Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 2002; 10: 417–426. [DOI] [PubMed] [Google Scholar]
  8. 8Bergsbaken T, Fink SL, Cookson BT. Pyroptosis: host cell death and inflammation. Nat Rev Microbiol 2009; 7: 99–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. 9Donnelly MA. Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of Toll-like receptor 5. J Biol Chem 2002; 277: 40456–40461. [DOI] [PubMed] [Google Scholar]
  10. 10Mortimer C, Gharbia SE, Logan JM, Peters TM, Arnold C. Flagellin gene sequence evolution in Salmonella. Infect Genet Evol 2007; 7: 411–415. [DOI] [PubMed] [Google Scholar]
  11. 11Malapaka RR, Adebayo LO, Tripp BC. A deletion variant study of the functional role of the Salmonella flagellin hypervariable domain region in motility. J Mol Biol 2007; 365: 1102–1116. [DOI] [PubMed] [Google Scholar]
  12. 12Yoon SI, Kurnasov O, Natarajan V, Hong M, Gudkov AV, Osterman AL et al. Structural basis of TLR5-flagellin recognition and signaling. Science 2012; 335: 859–864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. 13Smith KD. Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nature 2003; 4: 1247–1253. [DOI] [PubMed] [Google Scholar]
  14. 14Lightfield KL, Persson J, Brubaker SW, Witte CE, von Moltke J, Dunipace EA et al. Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin. Nat Immunol 2008; 9: 1171–1178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. 15Mizel SB and Bates JT. Flagellin as an adjuvant: cellular mechanisms and potential. J Immunol 2010; 185: 5677–5682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. 16Vijay-Kumar M, Aitken JD, Sanders CJ, Frias A, Sloane VM, Xu J et al. Flagellin treatment protects against chemicals, bacteria, viruses, and radiation. J Immunol 2008; 180: 8280–8285. [DOI] [PubMed] [Google Scholar]
  17. 17Rolli J, Loukili N, Levrand S, Rosenblatt-Velin N, Rignault-Clerc S, Waeber B et al. Bacterial flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like systemic inflammatory response in mice. Crit Care 2010; 14: R160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. 18Lodes MJ, Cong Y, Elson CO, Mohamath R, Landers CJ, Targan SR et al. Bacterial flagellin is a dominant antigen in Crohn disease. J Clin Invest 2004; 113: 1296–1306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. 19Rhee SH, Im E, Riegler M, Kokkotou E, O'Brien M, Pothoulakis C. Pathophysiological role of Toll-like receptor 5 engagement by bacterial flagellin in colonic inflammation. Proc Natl Acad Sci USA 2005; 102: 13610–13615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. 20Liaudet L, Szabó C, Evgenov OV, Murthy KG, Pacher P, Virág L et al. Flagellin from Gram-negative bacteria is a potent mediator of acute pulmonary inflammation in sepsis. Shock 2003; 19: 131–137. [DOI] [PubMed] [Google Scholar]
  21. 21Blohmke CJ, Victor RE, Hirschfeld AF, Elias IM, Hancock DG, Lane CR et al. Innate immunity mediated by TLR5 as a novel antiinflammatory target for cystic fibrosis lung disease. J Immunol 2008; 180: 7764–7773. [DOI] [PubMed] [Google Scholar]
  22. 22Rolli J, Rosenblatt-Velin N, Li J, Loukili N, Levrand S, Pacher P et al. Bacterial flagellin triggers cardiac innate immune responses and acute contractile dysfunction. PLoS One 2010; 5: e12687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. 23Liaudet L, Murthy KG, Mabley JG, Pacher P, Soriano FG, Salzman AL et al. Comparison of inflammation, organ damage, and oxidant stress induced by Salmonella enterica serovar Muenchen flagellin and serovar enteritidis lipopolysaccharide. Infect Immun 2002; 70: 192–198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. 24Gustot T, Lemmers A, Moreno C, Nagy N, Quertinmont E, Nicaise C et al. Differential liver sensitization to Toll-like receptor pathways in mice with alcoholic fatty liver. Hepatology 2006; 43: 989–1000. [DOI] [PubMed] [Google Scholar]
  25. 25Yang J, Zhong M, Zhang Y, Zhang E, Sun Y, Cao Y et al. Antigen replacement of domains D2 and D3 in flagellin promotes mucosal IgA production and attenuates flagellin-induced inflammatory response after intranasal immunization. Hum Vaccin Immunother 2013; 9: 1084–1092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. 26Mizel SB, Graff AH, Sriranganathan N, Ervin S, Lees CJ, Lively MO et al. Flagellin-F1-V fusion protein is an effective plague vaccine in mice and two species of nonhuman primates. Clin Vaccine Immunol 2009; 16: 21–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. 27Dalpke AH, Lehner MD, Hartung T, Heeg K. Differential effects of CpG-DNA in Toll-like receptor-2/-4/-9 tolerance and cross-tolerance. Immunology 2005; 116: 203–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. 28Liu F, Yang J, Zhang Y, Zhou D, Chen Y, Gai W et al. Recombinant flagellins with partial deletions of the hypervariable domain lose antigenicity but not mucosal adjuvancy. Biochem Biophys Res Commun 2010; 392: 582–587. [DOI] [PubMed] [Google Scholar]
  29. 29Buzzo CL, Campopiano JC, Massis LM, Lage SL, Cassado AA, Leme-Souza R et al. A novel pathway for inducible nitric-oxide synthase activation through inflammasomes. J Biol Chem 2010; 285: 32087–32095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. 30Yang JY, Zhang E, Liu F, Zhang Y, Zhong M, Li Y et al. Flagellins of Salmonella typhi and nonpathogenic Escherichia coli are differentially recognized through the NLRC4 pathway in macrophages. J Innate Immun 2014; 6: 47–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. 31Burdelya LG, Brackett CM, Kojouharov B, Gitlin II, Leonova KI, Gleiberman AS et al. Central role of liver in anticancer and radioprotective activities of Toll-like receptor 5 agonist. Proc Natl Acad Sci USA 2013; 110: E1857–E1866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. 32Simberg D, Weisman S, Talmon Y, Barenholz Y. DOTAP (and other cationic lipids): chemistry, biophysics, and transfection. Crit Rev Ther Drug Carrier Syst 2004; 21: 257–317. [DOI] [PubMed] [Google Scholar]
  33. 33Daley JM, Thomay AA, Connolly MD, Reichner JS, Albina JE. Use of Ly6G-specific monoclonal antibody to deplete neutrophils in mice. J Leuk Biol 2008; 83: 64–70. [DOI] [PubMed] [Google Scholar]
  34. 34Spapen H, Zhang HB, Vincent JL. Potential therapeutic value of lazaroids in endotoxemia and other forms of sepsis. Shock 1997; 8: 321–327. [DOI] [PubMed] [Google Scholar]
  35. 35Cederbaum AI, Lu YK, Wu DF. Role of oxidative stress in alcohol-induced liver injury. Arch Toxicol 2009. 83: 519–548. [DOI] [PubMed] [Google Scholar]
  36. 36Lai MM. Hepatitis C virus proteins: direct link to hepatic oxidative stress, steatosis, carcinogenesis and more. Gastroenterology 2002; 122: 568–571. [DOI] [PubMed] [Google Scholar]
  37. 37Stancliffe RA, Thorpe T, Zemel MB. Dairy attentuates oxidative and inflammatory stress in metabolic syndrome. Am J Clin Nutr 2011; 94: 422–430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. 38Sebastiani G, Leveque G, Larivière L, Laroche L, Skamene E, Gros P et al. Cloning and characterization of the murine Toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics 2000; 64: 230–240. [DOI] [PubMed] [Google Scholar]
  39. 39Schwabe RF, Seki E, Brenner DA. Toll-like receptor signaling in the liver. Gastroenterology 2006; 130: 1886–1900. [DOI] [PubMed] [Google Scholar]
  40. 40Seki E, Brenner DA. Toll-like receptors and adaptor molecules in liver disease: update. Hepatology 2008; 48: 322–335. [DOI] [PubMed] [Google Scholar]
  41. 41Ring A, Stremmel W. The hepatic microvascular responses to sepsis. Semin Thromb Hemost 2000; 26: 589–594. [DOI] [PubMed] [Google Scholar]
  42. 42Sadallah F, Brighouse G, del Giudice G, Drager-Dayal R, Hocine M, Lambert PH. Production of specific monoclonal-antibodies to Salmonella-typhi flagellin and possible application to immunodiagnosis of typhoid-fever. J Infect Dis 1990; 161: 59–64. [DOI] [PubMed] [Google Scholar]
  43. 43Villa P, Saccani A, Sica A, Ghezzi P. Glutathione protects mice from lethal sepsis by limiting inflammation and potentiating host defense. J Infect Dis 2002; 185: 1115–1120. [DOI] [PubMed] [Google Scholar]
  44. 44Yuan LY, Kaplowitz N. Glutathione in liver diseases and hepatotoxicity. Mol Aspects Med 2009; 30: 29–41. [DOI] [PubMed] [Google Scholar]
  45. 45Knight TR, Ho YS, Farhood A, Jaeschke H. Peroxynitrite is a critical mediator of acetaminophen hepatotoxicity in murine livers: protection by glutathione. J Pharmacol Exp Ther 2002; 303: 468–475. [DOI] [PubMed] [Google Scholar]
  46. 46Cazanave S, Berson A, Haouzi D, Vadrot N, Fau D, Grodet A et al. High hepatic glutathione stores alleviate Fas-induced apoptosis in mice. J Hepatol 2007; 46: 858–868. [DOI] [PubMed] [Google Scholar]
  47. 47Ramaiah S, Jaeschke H. Role of neutrophils in the pathogenesis of acute inflammatory liver injury. Toxicol Pathol 2007; 35: 757–766. [DOI] [PubMed] [Google Scholar]
  48. 48Hao J, Zhang C, Liang T, Song J, Hou G. rFliC prolongs allograft survival in association with the activation of recipient Tregs in a TLR5-dependent manner. Cell Mol Immunol 2014; 11: 206–214. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES