Skip to main content
NCBI home page
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2014 Dec 29;12(6):750–756. doi: 10.1038/cmi.2014.129

Nasopharyngeal cancer-derived microRNA-21 promotes immune suppressive B cells

Bei-Ping Miao 1, Rui-Shi Zhang 1, Meng Li 2, Yun-Ting Fu 2,3,4, Miao Zhao 2,3,4, Zhi-Gang Liu 2, Ping-Chang Yang 2,4
PMCID: PMC4716626  PMID: 25544502

Abstract

The prevalence of nasopharyngeal cancer (NPC) is high in the southern area of China and some other districts in the world. The pathogenesis of NPC is unclear. It is reported that some microRNAs (miR) are involved in the progression of NPC. This study aims to investigate the role of miR-21 in the induction of immune tolerance of NPC. In this study, NPC tissue was collected from patients with NPC. Assessment of miR was performed with real time quantitative RT-PCR. Western blotting was used to assess proteins of interleukin 10 and nuclear factor I-A (NFI-A). Immune cells were analyzed by flow cytometry. The results showed that NPC cell line C666-1 and surgically removed NPC tissue expressed miR-21, which was upregulated by the presence of the Toll-like receptor 3 ligand, Poly I: C. Exposure to miR-21 increased the expression of NFI-A and interleukin (IL)-10 in naive B cells. High frequency of IL-10+ B cells was detected in the NPC tissue. The NPC- or miR-21-primed B cells suppressed cytotoxic CD8+ T cell activities. We conclude that NPC-derived miR-21 induces IL-10+ B cells; the latter is capable of suppressing CD8+ T-cell activities. miR-21 may be a potential target in the treatment of NPC.

Keywords: B lymphocyte, immune regulation, interleukin-10, microRNA, nasopharyngeal cancer

Introduction

The pathogenesis of nasopharyngeal cancer (NPC) is unclear. Currently, the therapeutic effect of NPC relies on the early diagnosis and early treatment.1 However, because the anatomical feature of the nasopharyngx, many NPC cases are diagnosed at the advanced stages with metastasis has already occurred.2 The therapeutic effect on those advanced NPC cases is still poor currently.3 Thus, it is necessary to identify novel therapeutic targets to enhance the therapeutic effect for NPC.

It is proposed that immune regulatory cells, such as regulatory T cells and regulatory B cells, play an important role in facilitating cancer cells to escape from the immune surveillance.4 The immune regulatory cells release immune regulatory molecules, including transforming growth factor-β,5 interleukin (IL)-10,6 etc. to inhibit the functions of antitumor cells, such as CD8+ cytotoxic T cells.7 However, the generation of the regulatory immune cells remains to be further understood.

MicroRNAs (miR) are small non-coding RNA molecules (containing about 22 nucleotides) found in plants, animals, and some viruses, which functions in RNA silencing and post-transcriptional regulation of gene expression.8 A number of miRs have been recognized to be involved in the cancer progression9 and to be considered being potential biomarkers and therapeutic targets for gastric cancer.10 Several miRs have been detected in NPC, such as miR-21, which may play a role in NPC metastasis.11 MiR-21 is also significantly upregulated in many cancers, which may play an important role in cancer cell survival, apoptosis and invasion.12 Recent reports indicate that miR-21 modulates the expression of a large number of cancer-related genes including phosphatase and tensin homolog, TPM1 and programmed cell death protein 4, etc.12 It is reported that miR-21 regulates lymphocyte function.13 Based on the above information, we hypothesize that miR-21 facilitate the development of regulatory immune cells. In this study, we observed that NPC cells produced miR-21, which induced the development of IL-10-producing B cells; the latter showed the capacity to suppress cytotoxic CD8+ T-cell activities.

Materials and methods

Reagents

The antibody and shRNA kit of IL-10 (E-10) were purchased from Santa Cruz Biotech (Santa Cruz, CA, USA). The fluorochrome-labeled antibodies (for flow cytometry) were purchased from BD Biosciences (Shanghai, China). The Poly I:C, gemcitabine hydrochloride were purchased from Sigma-Aldrich (Shanghai, China). The ELISA kits were purchased from R&D Systems (Shanghai, China). The antisense of miR-21 was synthesized by GenScript (Guangzhou, China). The reagents for real-time quantitative RT-PCR (RT-qPCR) and western blotting were purchased from Invitrogen (Shanghai, China).

Ethic statement

The using human tissue in the present study was approved by the Human Research Ethic Committee at Shenzhen University in accordance of the guidelines. An informed, written consent was obtained from each subject.

NPC and adenoid gland tissue collection and single cell isolation

The diagnosis and the surgical operation of NPC or chronic adenoiditis were performed by the otolaryngologists following the routine procedures of our department. The surgically removed NPC or adenoid gland tissue was collected from the operation rooms, cut into small pieces (2×2×2 mm) and incubated with 0.5% Collagenase IV for 2 h at 37 °C. The cells were filtered through a cell strainer (70 µm). The single cells were collected by centrifugation. The mixing immune cells, including CD3+ T cells, CD19+ B cells, CD11c+ dendritic cells and CD14+ monocytes, were removed by the magnetic cell sorting (MACS; see below). The viability of the isolated cells was 98.8% as assessed by the trypan blue exclusion assay.

Preparation of peripheral blood mononuclear cells (PBMCs)

Twenty millilitres of peripheral blood were withdrawn from the elbow vein of each NPC patient or a healthy volunteer. PBMCs were isolated by the gradient density centrifugation.14

Immune cell isolation

Following our established procedures,15 the immune cell isolation was performed by MACS with commercial reagent kits following the manufacturer's instructions. The isolated immune cell purity was greater than 98% as assessed by flow cytometry.

Flow cytometry

Following our established procedures,15 cells were fixed by 2% paraformaldehyde for 2 h. In the case of intracellular staining, the fixative contained 0.1% Tryton X-100 to enhance the cell membrane permeability. After washing with phosphate-buffered saline, the cells were blocked with 1% bovine serum albumin for 30 min and stained with fluorochrome-labeled antibodies at concentrations of 0.1–0.5 µg/ml for 1 h on ice. The cells were washed with phosphate-buffered saline again and analyzed with a flow cytometer (FACSCanto II; BD Biosciences, Shanghai, China). The data were analyzed with the FlowJo software.

C666-1 NPC cell culture

Following the routine cell culture procedures of our laboratory,16 the C666-1 cells (a human NPC cell line; purchased from ATCC) were cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM L-glutamine. Before using for further experiments, the viability of the cells was assessed by trypan blue exclusion assay; it was greater than 99%.

RT-qPCR

Following published procedures,17 the concentration of miR-21 in NPC cells was determined with RT-qPCR. The mature miRNA was reverse transcribed using miRNA-specific primers for quantification of miR-21. RT-qPCR was performed on a qPCR device (miniOpticon real-time RT-PCR System; Bio-Rad, Shanghai, China) using SYBR Green Master Mix. Small nuclear RNA U6 (snRNA U6) was used as an internal control17 and was used to normalise miR-21 results; the results were calculated using the 2−ΔΔCt method.18 The data were presented as a percentage of the U6.

Western blotting

Following our established procedures,15 the total proteins were extracted from the cells, fractioned by SDS–PAGE and transferred onto a PVDF membrane. After blocking with 5% skim milk for 30 min at room temperature, the membrane was incubated with the primary antibodies at concentrations of 0.1–0.3 µg/ml at 4 °C overnight. The membrane was washed with Tris-buffered saline Tween 20 for three times (5 min each time) and followed by incubating with the secondary antibodies (conjugated with horseradish peroxidase). The membrane was washed with Tris-buffered saline Tween 20 again. The immune complexes on the membrane were developed by ECL. The immune blots were photographed with an imaging device (Kodak Image Station 4000 mm Pro, KODAK; Shanghai, China). The density of the immune blots was determined with software Photoshop CS5, Adobe Systems Inc, San Jose, CA and presented as a percentage of the internal control β-actin.

Methylation-specific PCR

Following our established procedures,19 the DNA was extracted from the cells with a reagent kit. The DNA was treated with 2 M NaOH at 37 °C for 10 min, followed by incubating with 3 M sodium bisulphite (pH 5.0) and incubated at 50 °C overnight (covered by mineral oil). The samples were treated with 3 M NaOH for 5 min and then concentrated by ammonium precipitation and 100% ethanol, washed with 70% ethanol and resuspended in 20 µl distilled water. Methylation-specific PCR was performed with the samples to determe the amount of demethylated DNA of the IL-10 promoter. Left U primer, tttggaatatattttgtgattttgt; Right U primer, ccctcaactataaattctcattcaca. The results were normalized to a percentage of the input. Ten CpG sites between 653 and 947 of the IL-10 promoter were analyzed.

Generation of IL-10+ B cells

Following our established procedures,19 CD19+ IL-7R+ naive B cells were isolated from PBMC by MACS (the purity was greater than 98%) and cultured in the presence of anti-CD40 (20 ng/ml) and miR-21 (10 ng/ml) for 6 days. As assessed by flow cytometry, the frequency of IL-10+ B cells was more than 90%.

CD8+ T-cell proliferation assay

Following our estabolished procedures,7 CD8+CD25− T cells were isolated from the PBMCs by MACS (the purity was more than 98%), stained with CFSE and cultured for 3 days in the presence of IL-2 (20 ng/ml), PMA (20 ng/ml), an anti-CD3 antibody (coated on the well of 96-well plates) and an anti-CD28 antibody (5 µg/ml). The cells were analyzed by flow cytometry (the CFSE-dilution assay).

Enzyme-linked immunosobent assay (ELISA)

The levels of perforin and granzyme B in the culture supernatant were determined by ELISA with commercial reagent kits following the manufacturer's instructions and our established procedures.7

Nuclear factor I-A (NFI-A) gene silence

The NFI-A gene in B cells was silenced by the RNA interference using a commercial reagent kit following the manufacturer's instructions and our established procedures.15 The effect of the gene knockdown was assessed by western blotting.

Statistics

The data are presented as mean±s.d. Differences between groups were determined by ANOVA. The P<0.05 was set as a significant criterion.

Results

IL-10-producing B cells are increased in NPC

IL-10-producing B cells have the immune suppressor functions that may be associated with cancer progression.20 We infer that the intratumor IL-10+ B cells may play a role in the pathogenesis of NPC. To test the hypothesis, we prepared single cells from surgically removed NPC tissue; the cells were analyzed by flow cytometry. The results showed that about 6.32% B cells were detected in the NPC-derived cells (Figure 1a and g), of which more than 90% B cells expressed IL-10 (Figure 1b and h). Using as a control, we collected surgically removed adenoid gland tissue to be processed in the same procedures of NPC. The results showed much more B cells were detected in the adenoid gland (Figure 1c and g), but the IL-10+ B cells were much less (6.16%) (Figure 1d and h) than that in NPC. We also collected PBMC from the same NPC patients, in which the frequency of IL-10+ B cells was about 7.94% (Figure 1e–h), also much less than that in NPC. The results implicate that the microenvironment in NPC may induce the expression of IL-10 in the intra-NPC B cells.

Figure 1.

Figure 1

Open in a new tab

Assessment of IL-10+ B cells in NPC. Surgically removed NPC tissue and peripheral blood were obtained from 10 NPC patients; surgically removed adenoid tissue was obtained from 10 patients. Single cells were prepared from the NPC tissue and adenoid tissue; PBMC were isolated from the blood samples. The cells were analyzed by flow cytometry. (a, c, e) The dot plots indicate the frequency of B cells. (b, d, f) The dot plots indicate the IL-10+ cells in the gated B cells of a, c and e (pointed by arrows) respectively. (g, h) The bars indicate the summarized data of the dot plots. The gated cells in panel I are the entire cells to be analyzed in a–g. The data of bars are presented as mean±s.d. *P<0.01, compared NPC group. Samples from individual patients were processed separately. The data are a representative of 10 independent experiments. NPC, nasopharyngeal cancer; PBMC, peripheral blood mononuclear cell.

Activation of TLR3 upregulates expression of miR-21 in NPC cells

It is reported that the levels of miR-21 are elevated in NPC tissue21 and miR-21 increases the IL-10 expression.22 NPC cells express TLR3,23 Epstein–Barr virus ligates TLR3 to influence NPC cell activities (Verillaud et al., 2012). Based on the information, we hypothesize that activation of TLR3 enhances the expression of miR-21 in NPC cells; the miR-21 then modulates the expression of IL-10 in the intra-NPC B cells. To test the hypothesis, C666-1 cells (a NPC cell line) were cultured in the presence or absence of Poly I:C for 48 h. As shown by RT-qPCR data, the expression of miR-21 was detectable in C666-1 cells; exposure to Poly I:C in the culture markedly increased the levels of miR-21 in a Poly I:C dose-dependent manner. The expression of miR-21 was also detected in the surgically removed NPC tissue that was significantly higher than that in the adenoid gland tissue (Figure 2). The results indicate that NPC cells express miR-21, which can be upregulated by TLR3 activation.

Figure 2.

Figure 2

Open in a new tab

Activation of TLR3 increases miR-21 in NPC cells. C666-1 cells were cultured with Poly I:C for 48 h; the doses are denoted on the X axis. The total RNA was extracted from the C666-1 cells, NPC tissue (from three NPC patients) and adenoid gland tissue (AdG; from three patients) and analyzed by RT-qPCR. The bars indicate the levels of miR-21 (normalized to a percentage of the control U6). The data of bars are presented as mean±s.d. *P<0.01, compared the dose ‘0' group. The data are a representative of three independent experiments. miR, microRNA; NPC, nasopharyngeal cancer; RT-qPCR, real-time quantitative RT-PCR.

NPC-derived miR-21 upregulates expression of IL-10 in B cells

We then cultured C666-1 cells with naive B cells in the presence of Poly I:C. The cells were then analyzed by flow cytometry. The results showed that the expression of IL-10 was hardly detectable in the B cells cultured in medium alone (Figure 3a and l). Cultured with NPC cells increased the frequency of IL-10+ B cells (Figure 3b and l), which was further increased after the addition of Poly I:C to the culture (Figure 3c and l). To test the role of the NPC-derived miR-21 in the increase in the IL-10 expression in the B cells, an antisense of miR-21 was added to the culture in a separate experiment with the same procedures above; indeed, the expression of IL-10 was abolished (Figure 3d and l). To elucidate if the ‘cell–cell-contact' was required in the process of NPC-induced IL-10 expression in B cells, in a separate experiment, cells were cultured in a transwell system with NPC cells in the inserts and B cells in the basal chambers in addition to the same procedures above. The expression of IL-10 in the B cells was still induced (Figure 3e and l). To strengthen the results, we added miR-21 to the culture of B cells; it also increased the expression of IL-10 in the B cells (Figure 3f and l). Since the transcription factor NFI-A is involved in the miR-21-induced IL-10 expression, we knocked down the gene of NFI-A in B cells (Figure 3k). After exposure to the PolyIC-activated NPC, the NFI-A-deficient B cells did not increase the expression of IL-10 (Figure 3h–i). The results indicate that the NPC-derived miR-21 enhances the expression of IL-10 in B cells.

Figure 3.

Figure 3

Open in a new tab

NPC-derived miR-21 induces IL-10 expression in B cells. Naive B cells were isolated from PBMC of healthy subjects and cultured with or without NPC at a ratio of 1∶1 in the presence of anti-CD40 Ab (20 ng/ml) for 6 days. The additional treatment was denoted above each subpanel. (a–i) The gated dot plots indicate the frequency of IL-10+ B cells. (l) The bars indicate the summarized data of a–i. Tran: the experiments were performed in a transwell system. Inh: inhibitor of demethylation, gemicitabine (150 nM). The gated cells in j are the entire cells to be analyzed in a–i. Ats: antisense of miR-21 (200 ng/ml). BC-b: FAI-A-null B cells. BC-c: B cells were treated with control shRNA. The data of bars are presented as mean±s.d. *P<0.01, compared with group B. The data are a representative of three independent experiments. Ab, antibody; miR, microRNA; NPC, nasopharyngeal cancer.

To take further insight into the underlying mechanism by which miR-21 upregulates the IL-10 expression in B cells, in the same procedures above, we added gemcitabine, an inhibitor of demethylation, to the culture; it abolished the increase in the NPC-induced IL-10 expression in the B cells (Figure 3g and l). The results implicate that miR-21 may alter the methylation status of the IL-10 promoter in the B cells. To test the hypothesis, we assessed the methylation status of the IL-10 promoter of the B cells after the treatment of Figure 3. The results showed that a marked increase in the demethylated DNA of the IL-10 promoter (Figure 4a–c) as well as increases in mRNA (Figure 4d) and proteins of IL-10 (Figure 4e and f) in the B cells were observed. The results confirm that miR-21 can upregulate the IL-10 promoter demethylation in the B cells.

Figure 4.

Figure 4

Open in a new tab

Assessment of IL-10 expression in B cells. The experimental procedures are the same as Figure 3. B cells were isolated by MACS. (a) The bars indicate the demethylated DNA levels of IL-10 promoter. (b) The DNA bands show the demethylated IL-10 promoter (D-IL-10 promoter) in B cells. (c) The bars indicate the integrated density of the DNA bands in panel B. (d) The bars indicate the mRNA levels of IL-10. (e) The immune blots indicate the protein levels of IL-10. (f) The bars indicate the integrated density of the immune blots of e. The data of bars are presented as mean±s.d. *P<0.01, compared with group B. The data are a representative of three independent experiments. The group labels are the same as Figure 3. MACS, magnetic cell sorting.

NFI-A is involved in the miR-21-induced expression of IL-10 in B cells

The transcription factor NFI-A is a downstream target of miR-21 in the regulation of IL-10 expression in dendritic cell.24 We inferred that the NFI-A might be also involved in the induction of IL-10 in B cells. To this end, we added miR-21 to the B-cell culture and analyzed the levels of NFI-A in the B-cell extracts. The results showed that NFI-A was detectable in naïve B cells. Exposure to miR-21 significantly increased the levels of NFI-A. Similar results were obtained when B cells were cultured with NPC cells (Figure 5). To strengthen the data, we silenced the NFI-A gene in B cells (Figure 3k); then the NFI-A-null B cells were exposed to miR-21 in the culture. Indeed, the induction of IL-10 in the B cells was abolished (Figure 3h and i). The results suggest that NFI-A was in the signal transnduction pathway by which miR-21 induces IL-10 expression in B cells.

Figure 5.

Figure 5

Open in a new tab

miR-21 upregulates NFI-A expression in B cells. CD19+ BCs) were isolated from PBMC by MACS. NPC cells were isolated from surgically removed NPC tissue. The culture conditions of BC are denoted below the western blots. miR-21=200 ng/ml. #Anti-sense of miR-21 (200 ng/ml). Ratio of NPC/BC=1∶1. The culture time was 48 h. (a) The western blots indicate the levels of NFI-A in the B-cell extracts. (b) The bars indicate the integrated density of the western blots of a. The data of bars are presented as mean±s.d. *P<0.01, compared with the BC group. The data represent three independent experiments. BC, B cell; MACS, magnetic cell sorting; miR, microRNA; NFI-A, nuclear factor I-A; NPC, nasopharyngeal cancer; PBMC, peripheral blood mononuclear cell.

Assessment of the immune suppressor functions of NPC-induced IL-10+ B cells

Published data indicate that IL-10+ B cells have immune suppressor functions.25 We then tested the capacity of the NPC-induced IL-10+ B cells in the suppression of the cytotoxic CD8+ T-cell activities. The experiments were performed in a transwell system with NPC cells and B cells in the inserts and CD8+CD25− T cells in the basal chambers. The results showed that no apparent proliferation was detected when the CD8+ T cells cultured alone (Figure 6a and 5e); the presence of anti-CD3/CD28 Ab markedly increased the CD8+ T-cell proliferation (Figure 6b and 5e). The presence of miR-21-primed B cells significantly suppressed the CD8+ T-cell proliferation (Figure 6c and 5e); culture with naive B cells did not inhibit the proliferation of CD8+ T cells (Figure 6d and 5e). In addition, we also assessed the production of perforin and granzyme B in the culture supernatant. The levels of perforin (Figure 6f) and granzyme B (Figure 6g) in the supernatant were in parallel to the changes of CD8+ T-cell proliferation. The results indicate that the miR-21-induced IL-10+ B cells have the capacity to suppress the CD8+ T-cell activities.

Figure 6.

Figure 6

Open in a new tab

Assessment of the immune suppressor functions of the NPC-induced IL-10+ B cells. CD8+CD25− T cells (labeled with CFSE) were isolated from PBMC of healthy subjects and cultured with NPC-primed IL-10+ B cells for 3 days in the presence of PMA (20 ng/ml) and anti-CD3/CD28 Ab. The cells were analyzed by flow cytometry. (a–d) The histograms indicate the frequency of proliferating CD8+ T cells. (e) The bars indicate the summarized data of a–d. (f–g) The bars indicate the levels of perforin (f) and granzyme B (g) (determined by ELISA). The data of bars are presented as mean±s.d. *P<0.01, compared with group A. The data are a representative of three independent experiments. Ab, antibody; BC, B cell; NPC, nasopharyngeal cancer; PBMC, peripheral blood mononuclear cell; TC, T cell.

Discussion

The intratumor immune regulatory cells play an important role in the tumor tolerance. The development of the intratumor regulatory cells has not been fully understood yet. The present data have revealed that the NPC-derived miR-21 plays a role in the induction of IL-10-production B cells.

The infection of Epstein–Barr virus is associated with the pathogenesis of NPC. A number of methods of detecting the Epstein–Barr virus infection have been developed and used in the NPC clinic as one of the diagnostic markers.26 Epstein–Barr virus-encoded latent membrane protein 1 is associated with tumor relapse and poor prognosis of nasopharyngeal carcinoma.27 It is proposed that the genetic polymorphisms of TLR3 are associated with nasopharyngeal carcinoma risk.28 Our data are in line with these previous studies by showing that the exposure to TLR3 ligands, the Poly I:C, activates NPC cells; such an activation induces the expression of miR-21 by NPC cells.

Published data have shown that the production of miR-21 is associated with NPC cell activities. Yang et al.29 indicate that NPC upregulates miR-21 to promote the resistance of nasopharyngeal carcinoma cells to cisplatin-induced apoptosis.29 Li et al.11 report that miR-21 inhibitor suppresses proliferation and migration of nasopharyngeal carcinoma cells through down-regulation of BCL2 expression. Our data have added novel information to this point by showing that NPC-derived miR-21 can induce the expression of IL-10 in B cells to confer the B cells with immune regulatory properties. This finding implicate that the NPC-derived miR-21 may contribute to the NPC-tolerance in the body since IL-10+ B cells are one of the important immune tolerant cells in autoimmunity, infections, and cancer.30,31

Apart from NPC cells and inducing the IL-10 expression in B cells, other tissue and cells also produce miR-21 with various activities. Hu et al.32 indicate that administration with miR-21 decreases in programmed cell death 4 mRNA and caspase-3, caspase-8 protein expressions, and thus, inhibits apoptosis and reduces tissue injury.32 The reduction of apoptosis is an important pathological feature of cancer. Whether the NPC-derived miR-21 plays any roles in interfering with cell apoptosis in NPC is worth being further investigated.

Cancer tolerance is a critical mechanism by which cancer cells escape from the immune surveillance. Thus, to elucidate the underlying mechanism by which the cancer tolerance is developed is of significance. The present data demonstrate that the NPC-derived miR-21 is one of the factors to facilitate the development of cancer tolerance. The evidence to support this notion includes that NPC-derived miR-21 can activate NFI-A and induce IL-10+ B cells; these B cells have the immune suppressor function to inhibit the cytotoxic CD8+ T cells. Thus, to inhibit NPC-derived miR-21 has the therapeutic potential in the treatment of NPC.

Authors' contribution

BPM, RSZ, ML, YTF and MZ performed experiments, analyzed data and reviewed the manuscript. ZGL and PCY supervised the study and organized the experiments. PCY designed the project and wrote the manuscript.

Acknowledgments

This study was supported by grants from the innovation of science and Technology Commission of Shenzhen Municipality (JCYJ20120613161724279 and JCYJ20120613172559904).

None to declare.

References

  1. 1Zhang L, Chen QY, Liu H, Tang LQ, Mai HQ. Emerging treatment options for nasopharyngeal carcinoma. Drug Des Devel Ther 2013; 7: 37–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. 2Pan CC, Lu J, Yu JR, Chen P, Li W, Huang ZL et al. Challenges in the modification of the M1 stage of the TNM staging system for nasopharyngeal carcinoma: a study of 1027 cases and review of the literature. Exp Ther Med 2012; 4: 334–338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. 3Alon EE, Lipschitz N, Bedrin L, Gluck I, Talmi Y, Wolf M et al. Delayed sino-nasal complications of radiotherapy for nasopharyngeal carcinoma. Otolaryngol Head Neck Surg 2014; 151: 354–358. [DOI] [PubMed] [Google Scholar]
  4. 4Nishikawa H, Sakaguchi S. Regulatory T cells in cancer immunotherapy. Curr Opin Immunol 2014; 27: 1–7. [DOI] [PubMed] [Google Scholar]
  5. 5Mahalingam J, Lin CY, Chiang JM, Su PJ, Chu YY, Lai HY et al. CD4+ T cells expressing latency-associated peptide and Foxp3 are an activated subgroup of regulatory T cells enriched in patients with colorectal cancer. PLoS One 2014; 9: e108554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. 6Chung AY, Li Q, Blair SJ, de Jesus M, Dennis KL, LeVea C et al. Oral interleukin-10 alleviates polyposis via neutralization of pathogenic T-regulatory cells. Cancer Res 2014; 74: 5377–5385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. 7Wang BQ, Zhang CM, Gao W, Wang XF, Zhang HL, Yang PC. Cancer-derived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol 2011; 137: 1525–1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. 8Ambros V. The functions of animal microRNAs. Nature 2004; 431: 350–355. [DOI] [PubMed] [Google Scholar]
  9. 9Vincent K, Pichler M, Lee GW, Ling H. MicroRNAs, genomic instability and cancer. Int J Mol Sci 2014; 15: 14475–14491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. 10Shin VY, Chu KM. MiRNA as potential biomarkers and therapeutic targets for gastric cancer. World J Gastroenterol 2014; 20: 10432–10439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. 11Li Y, Yan L, Zhang W, Wang H, Chen W, Hu N et al. miR-21 inhibitor suppresses proliferation and migration of nasopharyngeal carcinoma cells through down-regulation of BCL2 expression. Int J Clin Exp Pathol 2014; 7: 3478–3487. [PMC free article] [PubMed] [Google Scholar]
  12. 12Sekar D, Hairul Islam VI, Thirugnanasambantham K, Saravanan S. Relevance of miR-21 in HIV and non-HIV-related lymphomas. Tumour Biol 2014; 35: 8387–8393. [DOI] [PubMed] [Google Scholar]
  13. 13Wang L, He L, Zhang R, Liu X, Ren Y, Liu Z et al. Regulation of T lymphocyte activation by microRNA-21. Mol Immunol 2014; 59: 163–171. [DOI] [PubMed] [Google Scholar]
  14. 14Liu T, He SH, Zheng PY, Zhang TY, Wang BQ, Yang PC. Staphylococcal enterotoxin B increases TIM4 expression in human dendritic cells that drives naive CD4 T cells to differentiate into Th2 cells. Mol Immunol 2007; 44: 3580–3587. [DOI] [PubMed] [Google Scholar]
  15. 15Zhang HP, Wu Y, Liu J, Jiang J, Geng XR, Yang G et al. TSP1-producing B cells show immune regulatory property and suppress allergy-related mucosal inflammation. Sci Rep 2013; 3: 3345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. 16Berin MC, Yang PC, Ciok L, Waserman S, Perdue MH. Role for IL-4 in macromolecular transport across human intestinal epithelium. Am J Physiol 1999; 276: C1046–C1052. [DOI] [PubMed] [Google Scholar]
  17. 17Wang M, Gu H, Wang S, Qian H, Zhu W, Zhang L et al. Circulating miR-17-5p and miR-20a: molecular markers for gastric cancer. Mol Med Rep 2012; 5:1514–20. [DOI] [PubMed] [Google Scholar]
  18. 18Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 2008; 3: 1101–1108. [DOI] [PubMed] [Google Scholar]
  19. 19Geng XR, Yang G, Li M, Song JP, Liu ZQ, Qiu S et al. Insulin-like growth factor-2 enhances functions of antigen (Ag)-specific regulatory B cells. J Biol Chem 2014; 289: 17941–17950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. 20Czarneski J, Lin YC, Chong S, McCarthy B, Fernandes H, Parker G et al. Studies in NZB IL-10 knockout mice of the requirement of IL-10 for progression of B-cell lymphoma. Leukemia 2004; 18: 597–606. [DOI] [PubMed] [Google Scholar]
  21. 21Liu X, Luo HN, Tian WD, Lu J, Li G, Wang L et al. Diagnostic and prognostic value of plasma microRNA deregulation in nasopharyngeal carcinoma. Cancer Biol Ther 2013; 14: 1133–1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. 22Quinn SR, O'Neill LA. The role of microRNAs in the control and mechanism of action of IL-10. Curr Top Microbiol Immunol 2014; 380: 145–155. [DOI] [PubMed] [Google Scholar]
  23. 23Zhang Y, Sun R, Liu B, Deng M, Zhang W, Li Y et al. TLR3 activation inhibits nasopharyngeal carcinoma metastasis via downregulation of chemokine receptor CXCR4. Cancer Biol Ther 2009; 8: 1826–1830. [DOI] [PubMed] [Google Scholar]
  24. 24McClure C, Brudecki L, Ferguson DA, Yao ZQ, Moorman JP, McCall CE et al. MicroRNA 21 (miR-21) and miR-181b couple with NFI-A to generate myeloid-derived suppressor cells and promote immunosuppression in late sepsis. Infect Immun 2014; 82: 3816–3825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. 25Jin G, Hamaguchi Y, Matsushita T, Hasegawa M, Le Huu D, Ishiura N et al. B-cell linker protein expression contributes to controlling allergic and autoimmune diseases by mediating IL-10 production in regulatory B cells. J Allergy Clin Immunol 2013; 131: 1674–1682. [DOI] [PubMed] [Google Scholar]
  26. 26Karray H, Ayadi W, Fki L, Hammami A, Daoud J, Drira MM et al. Comparison of three different serological techniques for primary diagnosis and monitoring of nasopharyngeal carcinoma in two age groups from Tunisia. J Med Virol 2005; 75: 593–602. [DOI] [PubMed] [Google Scholar]
  27. 27Yang CF, Peng LX, Huang TJ, Yang GD, Chu QQ, Liang YY et al. Cancer stem-like cell characteristics induced by EB virus-encoded LMP1 contribute to radioresistance in nasopharyngeal carcinoma by suppressing the p53-mediated apoptosis pathway. Cancer Lett 2014; 344: 260–271. [DOI] [PubMed] [Google Scholar]
  28. 28He JF, Jia WH, Fan Q, Zhou XX, Qin HD, Shugart YY et al. Genetic polymorphisms of TLR3 are associated with nasopharyngeal carcinoma risk in Cantonese population. BMC Cancer 2007; 7:194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. 29Yang GD, Huang TJ, Peng LX, Yang CF, Liu RY, Huang HB et al. Epstein–Barr virus-encoded LMP1 upregulates microRNA-21 to promote the resistance of nasopharyngeal carcinoma cells to cisplatin-induced Apoptosis by suppressing PDCD4 and Fas-L. PLoS One 2013; 8: e78355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. 30Wisniewski J, Agrawal R, Woodfolk JA. Mechanisms of tolerance induction in allergic disease: integrating current and emerging concepts. Clin Exp Allergy 2013; 43: 164–176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. 31Mauri C, Ehrenstein MR. The ‘short' history of regulatory B cells. Trends Immunol 2008; 29: 34–40. [DOI] [PubMed] [Google Scholar]
  32. 32Hu H, Jiang W, Xi X, Zou C, Ye Z. MicroRNA-21 Attenuates renal ischemia reperfusion injury via targeting caspase signaling in mice. Am J Nephrol 2014; 40: 215–223. [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES