Abstract
Premise of the study:
Microsatellite markers were developed in Fosterella christophii (Bromeliaceae) to investigate the genetic diversity and population structure within the F. micrantha group, comprising F. christophii, F. micrantha, and F. villosula.
Methods and Results:
Full-length cDNAs were isolated from F. christophii and sequenced on a Pacific Biosciences RS platform. A total of 1590 high-quality consensus isoforms were assembled into 971 unigenes containing 421 perfect microsatellites. Thirty primer sets were designed, of which 13 revealed a high level of polymorphism in three populations of F. christophii, with four to nine alleles per locus. Each of these 13 loci cross-amplified in the closely related species F. micrantha and F. villosula, with one to six and one to 11 alleles per locus, respectively.
Conclusions:
The new markers are promising tools to study the population genetics of F. christophii and to discover species boundaries within the F. micrantha group.
Keywords: Bromeliaceae, Fosterella christophii, microsatellites, Pacific Biosciences, single-molecule real-time (SMRT) sequencing, transcriptome
Fosterella christophii Ibisch, R. Vásquez & J. Peters, F. micrantha (Lindl.) L. B. Sm., and F. villosula (Harms) L. B. Sm. form a well-circumscribed species group within the genus Fosterella L. B. Sm., known as the F. micrantha group (Pitcairnioideae; Bromeliaceae) (Wagner et al., 2013). The three species are morphologically very similar terrestrial rosette plants with small, whitish, insect-pollinated flowers (Peters, 2009). Such high levels of similarity are surprising, given that F. micrantha is endemic to Central America, whereas the other two species reside in the Bolivian Andes. Controlled pollination experiments indicated that all three species are self-compatible but also form viable hybrids (Wagner et al., 2015). To investigate the genetic diversity and differentiation in this closely related species complex, we used Pacific Biosciences’ single-molecule real-time (SMRT) technology (Eid et al., 2009) to develop a set of genic microsatellite markers in F. christophii.
METHODS AND RESULTS
Total RNA was isolated from fresh leaves of one F. christophii plant (NW09.030-11) using the RNeasy Plus Micro Kit (QIAGEN, Venlo, The Netherlands). RNA quality and quantity were assessed by capillary electrophoresis on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California, USA). Polyadenylated RNA was isolated with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, Massachusetts, USA), followed by an integrity check via capillary electrophoresis. An aliquot of 1 ng of poly(A) RNA was selected as an input for cDNA synthesis with a SMARTer PCR cDNA Synthesis Kit (Clontech Laboratories, Mountain View, California, USA). A SMRTbell library was prepared as recommended by Pacific Biosciences (PacBio, Menlo Park, California, USA). The amplified cDNA was size-fractionated on agarose gels, and fragments with insert sizes >1.5 kb were recovered. SMRTbell templates were bound to polymerases using the PacBio DNA/polymerase binding kit P4 and v2 primers. Polymerase-template complexes were bound to magnetic beads using a MagBead Kit (PacBio, part #100-133-600). Sequencing was carried out on the PacBio RS II sequencer using C2 sequencing reagents with a movie length of 180 min. Full-length cDNAs were identified with the PacBio SMRT analysis software (version 2.2.0). High-quality sequences were achieved by running the protocol with a filter for a minimum of three full passes of a cDNA and discarding all non–full length cDNAs and chimeric products. The read output was further trimmed and assembled into unigenes using CAP3 (Huang and Madan, 1999).
A total of 1590 high-quality consensus isoforms with an average size of 1322 bp were assembled into 971 unigenes. BatchPrimer3 (You et al., 2008) was applied to detect perfect microsatellites, accepting minimum thresholds of seven repeat units for di-, six for tri-, five for tetra-, and four for penta- and hexanucleotide repeats, respectively. A total of 421 microsatellites were present in 275 unigenes. Motif types are compiled in Appendix S1 (122KB, doc) . Flanking sequences of appropriate quality and length were present at 335 microsatellite loci.
Microsatellite-flanking primers were designed using the BatchPrimer3 interface (You et al., 2008), applying the following criteria: length ranging from 18 to 23 nucleotides, product size ranging from 100 to 300 bp, annealing temperature from 50°C to 70°C, and GC content from 30% to 70%. Based on optimal primer characteristics, 30 loci representing all repeat types (12 di-, 10 tri-, two tetra-, three penta-, and three hexanucleotide repeats) were selected for further analysis. Primer functionality was validated by genotyping 29 F. christophii plants from three natural populations, with nine to 11 individuals each (Appendix 1). DNA was extracted from dried leaves according to Tel-zur et al. (1999). PCR amplifications were conducted in 12.5-μL final volumes in a T-Gradient thermocycler (Biometra, Göttingen, Germany), following the touchdown protocol previously described (Wöhrmann et al., 2012).
For the initial screens, PCR products from three F. christophii individuals (including NW09.030-11 as a positive control) and two plants each of F. micrantha and F. villosula were electrophoresed on an automated sequencer (LI-COR 4300 IR2; LI-COR Biosciences, Lincoln, Nebraska, USA). Fragment sizes were scored manually as described by Wöhrmann et al. (2012). Twenty-two of the 30 primer pairs yielded one or two distinct bands of the expected size range in each tested individual, depending on the homo- or heterozygous state of the respective amplicon. Locus characteristics, primer sequences, GenBank accession numbers, and the results of a BLASTX similarity search in GenBank of these 22 loci are summarized in Table 1. Eight primer pairs failed to amplify in any of the specimens and were not considered further.
Table 1.
Characteristics of 22 microsatellite loci and flanking primer pairs developed for Fosterella christophii.
| Locusa,b | Primer sequences (5′–3′) | Repeat motif | Allele size (bp) | Ta (°C) | GenBank accession no. | BLASTX description | %c | SSR location |
| Foc_01 | F: CCTCACTATCGCTCACTACAT | (AG)15 | 146 | 55.2 | KT036677 | PREDICTED: cinnamoyl-CoA reductase 1-like isoform X1 [Phoenix dactylifera] | 80 | 5′UTR |
| R: GTCACGCACACCAACTTC | ||||||||
| Foc_02 | F: GAGGCATTGGGTTTTTCT | (TC)17 | 147 | 55.3 | KT036678 | No match found | — | — |
| R: AGATCTGCGGCTACATCTC | ||||||||
| Foc_03 | F: CCTTATTCCCCAAATCATAAA | (AG)17 | 148 | 55.8 | KT036679 | PREDICTED: tetraspanin-3-like [Musa acuminata subsp. malaccensis] | 80 | 5′UTR |
| R: CTACCTCCTCTTCCTCTTCCT | ||||||||
| Foc_04 | F: GCCATTGAGTTCACCAAGT | (AG)20 | 145 | 55.5 | KT036680 | PREDICTED: tricetin 3′,4′,5′-O-trimethyltransferase [Phoenix dactylifera] | 77 | 3′UTR |
| R: ACAACCCAAGCAATAATAACA | ||||||||
| Foc_05 | F: CTTCTCCTTCTCCTCCATCT | (TCG)7 | 136 | 55.4 | KT036681 | PREDICTED: ribonuclease 2 [Musa acuminata subsp. malaccensis] | 78 | 5′UTR |
| R: AATAGGTCAGAGGATTTGAGC | ||||||||
| Foc_06 | F: CGTCAATCTCAATCCCTTC | (CCT)7 | 138 | 55.3 | KT036682 | PREDICTED: secretory carrier-associated membrane protein 2-like isoform X1 [Elaeis guineensis] | 88 | 5′UTR |
| R: ACCTGCACTACTCAGAGGAA | ||||||||
| Foc_07 | F: TTCATCGCCTCTCGTTTAT | (CTC)7 | 130 | 57.9 | KT036683 | PREDICTED: uncharacterized protein LOC103707719 isoform X2 [Phoenix dactylifera] | 86 | 5′UTR |
| R: CTTCGCCGTACCTCCAGTAG | ||||||||
| Foc_09* | F: TAAAGGGAGAGAGAGGAAGAA | (AGA)8 | 168 | 55.3 | KT581625 | PREDICTED: phosphoribulokinase, chloroplastic [Pyrus ×bretschneideri] | 93 | 5′UTR |
| R: GATGAGCTGCTGCTTCTG | ||||||||
| Foc_10* | F: CTCCTTTTTCCTTTTCCTTTA | (AGG)8 | 140 | 54.6 | KT581626 | Ubiquitin-conjugating enzyme 32 [Theobroma cacao] | 87 | 5′UTR |
| R: CCGTGTTCTTCTTGTTGTACT | ||||||||
| Foc_11* | F: GAGGGTAAATTTCTCTGCTTC | (GAA)9 | 204 | 55.2 | KT581627 | Best match <75% sequence similarity | — | — |
| R: TACGATGTACAGCTAGGGATG | ||||||||
| Foc_12 | F: CACAAATGTGCTCTTCTGG | (TCT)14 | 153 | 55.0 | KT036684 | Best match <75% sequence similarity | — | — |
| R: CGTGGGATCTCTATCGTG | ||||||||
| Foc_15* | F: GAGGACTTCGGTGTAATTTGT | (ATTTT)4 | 185 | 55.2 | KT581628 | Best match <75% sequence similarity | — | — |
| R: CCAACGGAAGAGTTCATAATA | ||||||||
| Foc_16** | F: CTCAGCTGAACAATTCTGAG | (GAAGA)5 | 194 | 54.3 | KT581629 | PREDICTED: sec-independent protein translocase protein TATC, chloroplastic-like [Oryza brachyantha] | 90 | 5′UTR |
| R: ACTTGGAGATGGAAGATAAGG | ||||||||
| Foc_17* | F: GCCATTGTCCAGAAGTCC | (TCCTC)4 | 153 | 55.1 | KT581630 | PREDICTED: carboxyvinyl-carboxyphosphonate phosphorylmutase, chloroplastic [Amborella trichopoda] | 82 | CDS |
| R: TAATAATTAGGGGATGAGCAG | ||||||||
| Foc_18 | F: CATCGTCCTCTACCTCTACG | (CCGCTC)4 | 193 | 54.8 | KT036685 | Best match <75% sequence similarity | — | — |
| R: GCCCTCCTTGTAGTCCTC | ||||||||
| Foc_19* | F: GAAAGAGGAAGAAACCGTAGA | (TCTCCT)5 | 156 | 55.6 | KT581631 | PREDICTED: PTI1-like tyrosine-protein kinase 1 isoform X1 [Elaeis guineensis] | 91 | 5′UTR |
| R: ATCAAAAGATGGAGGAGGAG | ||||||||
| Foc_20** | F: GAGGAAGAGAGAGGAAGAGAG | (TCTTCC)5 | 134 | 54.4 | KT581632 | RING/FYVE/PHD zinc finger superfamily protein [Theobroma cacao] | 80 | 5′UTR |
| R: AGGAGTAGAGGCGTCTCAG | ||||||||
| Foc_21** | F: CTCCAAAACGAACCCAAC | (GA)12 | 134 | 55.9 | KT581633 | PREDICTED: cation transport regulator-like protein 2 [Musa acuminata subsp. malaccensis] | 76 | 5′UTR |
| R: CGAATCTAGGGCTGTATTTTT | ||||||||
| Foc_25 | F: CTCTCTCCCCATCGACAC | (AG)12 | 159 | 55.8 | KT036686 | PREDICTED: UPF0235 protein At5g63440 isoform X1 [Elaeis guineensis] | 95 | 5′UTR |
| R: GCTTGCAGTAGTAGACGAAGA | ||||||||
| Foc_27 | F: TACTCACTTCCAAGCACTCTC | (AG)16 | 122 | 56.0 | KT036687 | Membrane steroid-binding protein 1, partial [Oryza sativa Indica group] | 84 | 5′UTR |
| R: CTTCAGCGTCTCCCACAT | ||||||||
| Foc_28 | F: AAAGGGAAGTACAGAATCAGG | (GCA)10 | 147 | 54.9 | KT036688 | Best match <75% sequence similarity | — | — |
| R: GGGACAAGTCATTATCAAGTG | ||||||||
| Foc_30 | F: CATTTCCATTTTAACGAAGC | (CT)14 | 150 | 55.2 | KT036689 | PREDICTED: uncharacterized protein LOC102721803 [Oryza brachyantha] | 79 | 5′UTR |
| R: TCATTCTCTTCTTCCTCTTCC |
Note: 5′UTR = 5′ untranslated region; 3′UTR = 3′ untranslated region; CDS = coding region; Ta = annealing temperature.
All loci were amplified using a standard touchdown PCR.
Loci that were monomorphic (*) among the seven initially tested individuals of F. christophii, F. villosula, and F. micrantha; loci that were monomorphic (**) within each of the three tested species but showed some potential to differentiate between species.
Sequence similarities of unigenes with more than 75% identity (%) to known genes obtained using BLASTX (Altschul et al., 1990).
Thirteen markers proved to be polymorphic among the three tested F. christophii specimens and were used to genotype the full set of samples listed in Appendix 1. Allele numbers and observed and expected heterozygosity values were calculated with Arlequin 3.5.1.2 (Excoffier et al., 2005). GENEPOP 1.2 (Raymond and Rousset, 1995) was used to perform exact tests of Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium. All 13 loci were polymorphic, exhibiting four to nine alleles per locus among the 29 analyzed F. christophii plants (Table 2). Observed and expected heterozygosity values ranged from zero to 1 and from 0.17 to 0.83, respectively. Significant deviations from HWE in terms of heterozygote deficiency were detected at three loci (Foc_01, Foc_05, Foc_12) in population NW09.005 and at one locus (Foc_18) in population NW09.034, which is possibly explained by the potential of Fosterella species to self-pollinate (Wagner et al., 2015). With one exception (Foc_04), all 13 loci were also polymorphic in F. micrantha (two to 11 alleles) and in F. villosula (two to six alleles) (Table 2). Significant linkage disequilibrium was only found between two loci (Foc_12 and Foc_18).
Table 2.
Results of primer screening for 13 polymorphic loci developed for Fosterella christophii.a
| Locus | NW09.005 (N = 11) | NW09.030 (N = 9) | NW09.034 (N = 9) | F. christophii (N = 29) | F. micrantha (N = 31) | F. villosula (N = 21) | Total (N = 81) | ||||||
| A | Ho | He | A | Ho | He | A | Ho | He | A | A | A | Atotal | |
| Foc_01 | 4 | 0.09* | 0.59 | 5 | 0.44 | 0.72 | 4 | 0.78 | 0.78 | 7 | 9 | 4 | 13 |
| Foc_02 | 2 | 0.00 | 0.42 | 5 | 0.78 | 0.75 | 5 | 1.00 | 0.83 | 8 | 4 | 6 | 13 |
| Foc_03 | 3 | 0.09 | 0.50 | 4 | 0.56 | 0.60 | 4 | 0.22 | 0.47 | 9 | 8 | 2 | 16 |
| Foc_04 | 1 | — | — | 2 | 0.22 | 0.52 | 6 | 0.89 | 0.80 | 9 | 1 | 1 | 9 |
| Foc_05 | 2 | 0.00* | 0.52 | 5 | 0.78 | 0.71 | 3 | 0.11 | 0.57 | 7 | 2 | 2 | 9 |
| Foc_06 | 1 | — | — | 4 | 0.89 | 0.66 | 3 | 0.56 | 0.57 | 6 | 4 | 2 | 8 |
| Foc_07 | 2 | 0.00 | 0.42 | 2 | 0.22 | 0.21 | 4 | 0.67 | 0.75 | 4 | 2 | 2 | 4 |
| Foc_12 | 2 | 0.00* | 0.52 | 4 | 0.56 | 0.61 | 4 | 0.67 | 0.70 | 7 | 11 | 3 | 15 |
| Foc_18 | 2 | 0.00 | 0.17 | 5 | 0.44 | 0.66 | 4 | 0.00* | 0.65 | 7 | 4 | 2 | 11 |
| Foc_25 | 2 | 0.09 | 0.25 | 1 | — | — | 3 | 0.89 | 0.69 | 4 | 3 | 2 | 6 |
| Foc_27 | 3 | 0.09 | 0.18 | 4 | 0.78 | 0.71 | 4 | 0.67 | 0.75 | 7 | 5 | 4 | 8 |
| Foc_28 | 1 | — | — | 3 | 0.56 | 0.60 | 2 | 0.33 | 0.29 | 4 | 4 | 2 | 6 |
| Foc_30 | 2 | 0.00 | 0.51 | 2 | 0.67 | 0.52 | 4 | 0.22 | 0.78 | 6 | 4 | 5 | 9 |
| Mean | 2.08 | 0.04 | 0.41 | 3.54 | 0.57 | 0.61 | 3.85 | 0.54 | 0.66 | 6.54 | 4.69 | 2.85 | 9.77 |
Note: A = number of alleles; Atotal = number of alleles across all tested accessions; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled.
See Appendix 1 for locality and voucher information.
*Highly significant deviation from Hardy–Weinberg equilibrium (P ≤ 0.001).
NTSYSpc version 2.1 (Rohlf, 2000) was used to perform principal coordinate analyses (PCoA) based on a square-root transformed distance matrix calculated with the index of Bray and Curtis (1957). Distinct groups were formed by PCoA (Appendix S2 (432.5KB, pdf) ), illustrating the potential of the markers to differentiate between the three closely related species of the F. micrantha group. Four individuals with identical multilocus genotypes were found in F. villosula and three in F. christophii, indicating clonal growth within populations.
Cross-amplification in more distant Bromeliaceae was analyzed with one individual each of F. rusbyi (Mez) L. B. Sm., Deuterocohnia longipetala (Baker) Mez, Dyckia marnier-lapostollei L. B. Sm. var. estevesii Rauh, Encholirium spp. Mart. ex Schult. f. (all Pitcairnioideae), Ananas comosus (L.) Merr. (Bromelioideae), Catopsis morreniana Mez (Tillandsioideae), and Puya mirabilis (Mez) L. B. Sm. (Puyoideae) (Appendices 1 and 2). Although physically linked to expressed genes, only three of the markers were particularly well conserved and showed consistent amplification of one or two distinct bands in the expected size range in four or more of the seven species included in the test panel (Appendix 2).
CONCLUSIONS
So far, PacBio’s SMRT technology has only rarely been applied to microsatellite marker development (e.g., Grohme et al., 2013; Wei et al., 2014). To our knowledge, the present report is the first using cDNAs as source material for this purpose. The increasing popularity of the PacBio RS II system compared with earlier sequencing technologies is primarily attributed to its high sequence accuracy obtained by circular consensus sequencing and the extraordinarily long reads of up to 20 kb. The analysis of full-length cDNAs is appealing not only for detecting genic microsatellite markers but also for many other applications such as gene mapping or gene expression profiling. The cDNA-based microsatellite markers developed for F. christophii represent promising tools for population genetic analyses and species delimitation within the F. micrantha group and presumably other species complexes of the Pitcairnioideae.
Supplementary Material
Appendix 1.
Plant material analyzed in this study. Representative samples of F. christophii, F. villosula, and F. micrantha populations were collected with the largest possible distances from each other (between 20 cm and 3–4 m, depending on the total size of the patch).
| N | Species | Location | Plant ID/Voucher (Herbarium)a | GPS coordinates | ||
| Latitude | Longitude | |||||
| 11 | Fosterella christophii Ibisch, R. Vásquez & J. Peters | Florida, Santa Cruz (BOL) | NW09.005 (LPB) | −18.09952 | −63.60210 | |
| 9 | Fosterella christophii | Larecaja, La Paz (BOL) | NW09.030 (LPB) | −15.66240 | −67.71320 | |
| 9 | Fosterella christophii | Larecaja, La Paz (BOL) | NW09.034 (LPB) | −15.46787 | −67.97005 | |
| 5 | Fosterella villosula (Harms) L. B. Sm. | Caranavi, La Paz (BOL) | NW09.012 (LPB) | −16.03293 | −67.63168 | |
| 3 | Fosterella villosula | Sud Yungas, La Paz (BOL) | NW09.019 (LPB) | −15.45160 | −67.17057 | |
| 7 | Fosterella villosula | José Ballivián, Beni (BOL) | NW09.024 (LPB) | −14.54075 | −67.49963 | |
| 6 | Fosterella villosula | Larecaja, La Paz (BOL) | NW09.035 (LPB) | −15.30580 | −67.36843 | |
| 5 | Fosterella micrantha (Lindl.) L. B. Sm. | Veracruz (MEX) | Schütz 11.04 (KAS) | 18.41262 | −95.09468 | |
| 10 | Fosterella micrantha | Oaxaca (MEX) | Schütz 11.05 (KAS) | 17.85203 | −96.21658 | |
| 6 | Fosterella micrantha | Oaxaca (MEX) | Schütz 11.06 (KAS) | 17.73767 | −96.32755 | |
| 4 | Fosterella micrantha | Oaxaca (MEX) | Schütz 11.17 (KAS) | 16.79033 | −95.35933 | |
| 6 | Fosterella micrantha | Oaxaca (MEX) | Schütz 11.19 (KAS) | 15.86467 | −96.47219 | |
| 1 | Fosterella rusbyi (Mez) L. B. Sm. | South Yungas, La Paz (BOL) | JP 06.0078 (LPB) | −16.36167 | −67.46333 | |
| 1 | Dyckia marnier-lapostollei L. B. Sm. var. estevesii Rauh | Goias (BRA) | BGHD 130151 | −16.66667 | −49.26667 | |
| 1 | Deuterocohnia longipetala (Baker) Mez | Tarija (BOL) | Schütz 06.068 (KAS) | −22.57043 | −64.41242 | |
| 1 | Encholirium spp. Mart. ex Schult. f. | NA (BRA) | BGHD 125585 | NA | NA | |
| 1 | Ananas comosus (L.) Merr. | NA (NA) | HERRH 0000-G-33 | NA | NA | |
| 1 | Catopsis morreniana Mez | Veracruz (MEX) | BGHD 131731 | NA | NA | |
| 1 | Puya mirabilis (Mez) L. B. Sm. | Salta (ARG) | BGHD 130040 | NA | NA | |
Note: ARG = Argentina; BGHD = Botanical Garden Heidelberg; BOL = Bolivia; HERRH = Botanical Garden Hannover; MEX = Mexico; N = number of individuals per sampling location; NA = not available; PE = Peru.
Herbarium abbrevations are according to Index Herbariorum (http://sweetgum.nybg.org/science/ih/).
Appendix 2.
Cross-species amplification of 13 microsatellite markers developed for Fosterella christophii in seven heterologous bromeliad species.
| Species | Foc_01 | Foc_02 | Foc_03 | Foc_04 | Foc_05 | Foc_06 | Foc_07 | Foc_12 | Foc_18 | Foc_25 | Foc_27 | Foc_28 | Foc_30 |
| Fosterella rusbyi | + | — | + | + | + | + | — | — | — | + | + | + | — |
| Dyckia marnier-lapostollei var. estevesii | + | — | + | + | + | — | — | — | — | + | — | + | — |
| Deuterocohnia longipetala | — | — | — | — | + | — | — | — | — | + | — | + | — |
| Encholirium spp. | — | — | + | — | + | — | — | — | — | + | — | + | — |
| Ananas comosus | — | — | — | + | + | + | — | — | — | — | — | + | — |
| Catopsis morreniana | — | — | — | — | — | — | — | — | — | — | — | — | — |
| Puya mirabilis | + | — | — | — | + | — | — | — | — | — | — | + | — |
Note: + = successful amplification as evidenced by the occurrence of distinct single or double bands on sequencing gels; — = no amplification.
LITERATURE CITED
- Altschul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403–410. [DOI] [PubMed] [Google Scholar]
- Bray J. R., Curtis J. T. 1957. An ordination of the upland forest communities of southern Wisconsin. Ecological Monographs 27: 325–349. [Google Scholar]
- Eid J., Fehr A., Gray J., Luong K., Lyle J., Otto G., Peluso P., et al. 2009. Real-time DNA sequencing from single polymerase molecules. Science 323: 133–138. [DOI] [PubMed] [Google Scholar]
- Excoffier L., Laval G., Schneider S. 2005. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47–50. [PMC free article] [PubMed] [Google Scholar]
- Grohme M. A., Soler R. F., Wink M., Frohme M. 2013. Microsatellite marker discovery using single-molecule real-time circular consensus sequencing on the Pacific Biosciences RS. BioTechniques 55: 253–256. [DOI] [PubMed] [Google Scholar]
- Huang X., Madan A. 1999. CAP3: A DNA sequence assembly program. Genome Research 9: 868–877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peters J.2009. Revision of the genus Fosterella (Bromeliaceae). PhD Thesis, University of Kassel, Kassel, Germany.
- Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
- Rohlf F. J. 2000. NTSYSpc: Numerical taxonomy and multivariate analysis system, ver. 2.1. Applied Biostatistics Inc., Port Jefferson, New York, USA. [Google Scholar]
- Tel-Zur N., Abbo S., Myslabodski D., Mizrahi Y. 1999. Modified CTAB procedure for DNA isolation from epiphytic cacti of the genera Hylocereus and Selenicereus (Cactaceae). Plant Molecular Biology Reporter 17: 249–254. [Google Scholar]
- Wagner N., Silvestro D., Brie D., Ibisch P. L., Zizka G., Weising K., Schulte K. 2013. Spatio-temporal evolution of Fosterella (Bromeliaceae) in the Central Andean biodiversity hotspot. Journal of Biogeography 40: 869–880. [Google Scholar]
- Wagner N. D., Wöhrmann T., Öder V., Burmeister A., Weising K. 2015. Reproduction biology and chloroplast inheritance in Bromeliaceae: A case study in Fosterella (Pitcairnioideae). Plant Systematics and Evolution 301: 2231–2246. [Google Scholar]
- Wei N., Bemmels J. B., Dick C. W. 2014. The effects of read-length, quality and quantity on microsatellite discovery and primer development: From Illumina to PacBio. Molecular Ecology Resources 14: 953–965. [DOI] [PubMed] [Google Scholar]
- Wöhrmann T., Wagner N., Krapp F., Huettel B., Weising K. 2012. Development of microsatellite markers in Fosterella rusbyi (Bromeliaceae) using 454-pyrosequencing. American Journal of Botany 99: e160–e163. [DOI] [PubMed] [Google Scholar]
- You F. M., Huo N., Gu Y. Q., Luo M.-C., Ma Y., Hane D., Lazo G. R., et al. 2008. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinformatics 9: 253. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.