Abstract
Pulmonary arterial hypertension (PAH) is characterized by excessive pulmonary arterial smooth muscle cells (PASMCs) growth, partially in response to PDGF-BB but whether this is dependent on β-catenin (βC) activation is unclear. Compared to healthy cells, PAH PASMCs demonstrate higher levels of proliferation both at baseline and with PDGF-BB that correlate with GSK3β dependent βC activation. We show that βC knockdown but not Wnt5a stimulation reduces PDGF-BB dependent growth and normalizes PAH PASMCs proliferation. These findings support that cross talk between PDGF and Wnt signaling modulates PASMC proliferation and suggest that βC targeted therapies could treat abnormal vascular remodeling in PAH.
Keywords: pulmonary hypertension, smooth muscle cells, Wnt signaling, PDGF, vascular remodeling, pulmonary disease
INTRODUCTION
Pulmonary arterial hypertension (PAH) is a vascular disease characterized by a progressive increase in pulmonary vascular resistance that, if untreated, leads to right ventricular failure and premature death. PAH is attributed to the obstruction of small (<50μm) peripheral pulmonary arteries resulting from aberrant growth of smooth muscle cells (PASMCs) within the medial layer(1-3). Previous studies have demonstrated that PAH PASMCs exhibit increased expression of both platelet derived growth factor (PDGF) BB and receptors(4, 5). Abnormal PDGF signaling is known to contribute to abnormal vascular remodeling associated with atherosclerosis and peripheral vascular disease(6) by triggering inappropriate vascular SMC growth thereby altering the properties of the vascular wall. To date, several studies using animal models of pulmonary hypertension have shown that pharmacological inhibition of the PDGF receptor can reduce the severity of PAH by preventing excessive PASMC growth in the pulmonary arteries(7, 8). However, despite the therapeutic benefit observed with use of agents that target the PDGF receptor(9, 10), the degree of clinical improvement among patients is still variable, likely as a result of incomplete reversal of PA remodeling. Given these findings, it is possible that targeting other components of the PDGF signaling pathway downstream of the receptor may help repress signaling activity and lead to increased reversal and/or prevention of disease progression.
Among downstream targets of PDGF signaling, β-catenin (βC) stands out as being one of the most dynamic and important regulators of cell growth, differentiation and survival. Originally described as the key mediator of the canonical Wnt signaling pathway, βC levels are tightly regulated in mammalian cells by a multiprotein complex composed of the proteins Axin, APC and GSK3β that, in the absence of Wnt activation, targets βC for degradation(11). In the absence of an active degradation complex, cytoplasmic βC levels rise and then shift to the nucleus where they become part of a transcription complex, which influence expression patterns of target genes(11, 12). In the pulmonary circulation, our group has shown that transient activation of βC is required for proper PASMC mobilization to sites of vascular injury but, in the setting of excessive βC activation, abnormal PASMC accumulation can be seen arguing that dysregulation of this pathway plays a substantial role in the vascular remodeling seen in PAH(13). Given the similarities between the biological effects of PDGF and βC on PASMC growth and pulmonary vascular remodeling, we postulated the existence of a novel signaling circuit involving these two pathways in PASMCs whose purpose is to regulate cell growth response in the setting of vascular injury. Evidence for interaction between these two signaling pathways has been suggested in studies performed in other mammalian cells but whether such a signaling mechanism is present in PASMCs is unknown.
In this study, we show for the first time that PDGF induced growth response in PASMCs is dependent on βC activation via direct inhibition of GSK3β and that the higher proliferation rate of PASMCs from PAH patients can be associated to higher levels of active βC both at baseline and in response to PDGF-BB stimulation. We also provide evidence that targeted suppression of βC activation can partially reverse the abnormal growth of PAH PASMCs in response to PDGF raising the possibility that targeting βC in addition to PDGF may provide a novel therapeutic option for management of PAH.
MATERIALS AND METHODS
Cell Culture
Healthy human and idiopathic PAH PASMCs were extracted from fresh lung tissue obtained at the time of transplant via the Pulmonary Hypertension Breakthrough Initiative (PHBI, IRB#5443). Cells were grown in ScienCell SMC growth medium (cat#1101) and used between passages 3 and 6. Clinical data is presented in Supplement Table 1.
Western Immunobloting
PASMCs were grown in 10cm plates until confluent and then either incubated in starvation medium (0.1% FBS) alone or supplemented with agonists. Cells were washed three times with ice-cold 1× PBS and lysates were prepared by adding ice-cold lysis buffer (RIPA buffer and 0.1mM PMSF), scraping into a 1.5mL microcentrifuge tube, and homogenizing by 22 gauge needle and syringe before centrifugation. Protein concentrations were determined by the DC protein assay (#500-0112, Bio-Rad Laboratories). Samples were subjected to electrophoresis under reducing conditions and transferred to a PVDF membrane, which was then blocked for 1h in buffer (nonfat milk powder 5% in PBST) and incubated with primary antibodies overnight at 4°C. Membranes were probed using antibodies for active βC (05-665, Millipore), total βC (9562, Cell Signaling Technologies), phospho-GSK3β (9336S, Cell Signaling Technology), and total GSK3β (610201, BD Biosciences). A loading control was evaluated by reprobing the membrane with a mouse monoclonal antibody to α-tubulin (T9026, Sigma-Aldrich).
Densitometry of Western blots were performed using Image J (National Institutes of Health). The background density of the blot was measured and subtracted from each band measurement to give net densitometry. The same procedure was then repeated with the corresponding loading controls. Once the net densitometry values for experimental and loading controls were obtained, a ratio of experimental/loading control was calculated.
Immunofluorescence
PASMCs were plated in eight-chamber polystyrene glass slides with 7,500 cells per chamber. Cells were starved for 48h and stimulated with PDGF-BB (#220-BB-010, R&D systems) over a period of 6 hours. At time points 0h and 6h, cells were fixed for 10 minutes in 4% paraformaldehyde and stored in PBS. Fixed cells were permeabilized and blocked for 1h with PBS containing 0.3% Triton X-100 and 5% goat serum. After washing, cells were then incubated overnight with the active βC antibody (05-665, Millipore) in antibody dilution buffer (PBS, 1% BSA, 0.3% Triton X-100). Cells were then washed three times in PBS and incubated in the dark for 1h with the anti-mouse 488nm fluorochrome-conjugated antibody, also in antibody dilution buffer. Slides were treated with Gold Antifade solution containing DAPI and stored at 4°C in the dark until analysis. Analysis was performed on an inverted microscope with epifluorescence (Leica DMI6000 B) using the 40× objective. For fluorescence measurements, the cursor was used to draw a region of interest (ROI) followed by pixel quantification using Image J.
Proliferation assays
Cells were seeded at 25 × 103 cells per well on 24-well plates in SMC growth medium and allowed to adhere overnight. The next day, cells were washed and incubated in SMC starvation medium (0.1% FBS) for 48h followed by stimulation with PDGF BB (#220-BB-010, R&D systems) or Wnt5a (#645-WN-010, R&D systems) for 72h. Cells were then trypsinized and counted in a hemocytometer. All assays were performed in triplicate with separate cell harvests assessed. Cell proliferation was also measured using the BrdU Cell Proliferation ELISA Kit (colorimetric) according to the manufacturer’s instructions (ab126556, Abcam).
Promoter-reporter assays, plasmids, and transfection methods
For measurements of βC-mediated changes in transcriptional activity, we used the TOPflash/FOPflash T cell factor/lymphoid enhancer factor reporter assay (#21-170, Millipore). The TOPflash construct contains a promoter with eight T cell factor/LEF1-binding domains found in the promoters of βC target genes linked to a luciferase gene, whereas the FOPflash construct has mutated binding sites and serves as a negative control. Cells were transfected with 2μg of a plasmid in a transfection device (Nucleofector II Program A-033; Lonza) using the basic SMC Nucleofector kit (VPI-1004, Lonza). After 24h in starvation media, cells were stimulated with agonists, and luciferase production was measured 6h later in a luminometer (Turner Biosystems) using the Dual-Luciferase Reporter Assay kit (#E1910, Promega) according to the manufacturer’s instructions. Renilla plasmid (Promega) co-transfection was used to control for transfection efficiency.
RNA interference
The siRNA duplex specific for βC (Ambion; Invitrogen; catalog no. 4390824) and scrambled RNA controls (Ambion; Invitrogen; catalog no. 4390844) were transfected into SMCs using nucleofection as described above.
Quantitative PCR
Quantitation of mRNA expression was determined in the StepOne Plus machine (Applied Biosystems) using Brilliant II SYBR Green qPCR Master Mix (Agilent,cat# 600828) following the manufacturer’s protocol. Briefly, 25 ng of mRNA was used for each reaction. The PCR reaction mixture was denatured at 95°C for 10 minutes and then run for 40 cycles (94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 30 seconds). Melting curve analysis was run at the same time to rule out nonspecific reactions or contamination. Beta-actin was used for normalization. All quantitative PCR was run in triplicate. The difference in mRNA expression was determined by ΔΔCT. The RNeasy Mini Kit from Qiagen was used to extract mRNA from cells. The reverse-transcription kit was purchased from Fermentas PCR primer sets were as follows: Beta-Actin IDT custom oligo, fwd: 5′AAGAGCTATGAGCTGCCTGA3′ and rev: 5′TACGGATGTCAACGTCACAC3′; Wnt3a Qiagen QuantiTect Primer Assay (cat# QT01028237); Wnt5a IDT custom oligo, fwd: 5′GACCTGGTCTACATCGACCCC3′ and rev: 5′GCAGCACCAGTGGAACTTGCA3′; Wnt7a IDT custom oligo, fwd: 5′CCCACCTTCCTGAAGATCAA3′ and rev: 5′ACAGCACATGAGGTCACAGC3′; Wnt11 Qiagen QuantiTect Primer Assay (cat# QT00018270).
Statistical analysis
The number of samples studied per experiment is indicated in the Figure Legends. Values from multiple experiments are expressed as mean ± SEM. Statistical significance was determined using unpaired t-test or one-way ANOVA followed by Bonferroni’s multiple comparison tests unless stated otherwise. A value of P<0.05 was considered significant.
RESULTS
PAH patient-derived PASMCs exhibit increased βC levels at baseline and in response to PDGF-BB
Our previous studies have shown that stimulation of healthy PASMCs with bone morphogenetic protein (BMP) ligands induces βC accumulation and transcriptional activity (14) but whether PAH PASMCs demonstrate endogenous dysregulation of βC at baseline and/or in response to PDGF-BB is unknown. To study the effect of PDGF-BB on βC activation, we stimulated healthy and PAH PASMCs with PDGF-BB (20ng/ml) and measured active βC levels in protein lysates at various time points using western immunobloting (WB). At baseline, PAH PASMCs demonstrated significantly higher levels in active βC compared to healthy cells and stimulation with PDGF-BB resulted in a further increase over 24 hours (Fig. 1). Interestingly, changes in total beta catenin did not parallel those seen with active beta catenin, although a similar elevation in baseline βC level was present in PAH PASMCs (Supp. Fig. 1).
Figure 1. PDGF-BB stimulation increases levels of active βC, which are already elevated at baseline in PAH PASMCs.
β-catenin activation and GSK3β phosphorylation (p) were measured in lysates from healthy donor (HD) and PAH PASMCs stimulated with 20 ng/mL PDGF-BB over a period of 24h. Corresponding densitometry values are shown. Loading was compared against α-tubulin. Cells were starved before stimulation for 48h in 0.1% FBS. CON, unstimulated control. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated healthy donor, ###P<0.0001 vs. corresponding healthy donor using one-way ANOVA with Bonferroni post-test, (N=3).
Previous studies have shown that βC activation relies on disruption of the GSK3β-Axin-βC degradation complex through phosphorylation of GSK3β(11), leading us to propose a similar mechanism for PDGF-BB induced βC activation in PASMCs. Indeed, WB performed on both unstimulated and PDGF-BB stimulated PASMC lysates demonstrated an increase in GSK3β phosphorylation, which temporally correlated with βC activation (Fig. 1). Of note, we found no significant changes in total GSK3β expression over this time course (Supp. Fig. 2).
PDGF-BB stimulation is associated with increased βC nuclear translocation and transcriptional activity in healthy and PAH PASMCs
Given that the biological effects of βC are dependent on its ability to translocate to the nucleus and influence gene expression via transcriptional activation, we proceeded to verify whether PDGF-BB could induce βC nuclear translocation patient-derived healthy donor and PAH PASMC via immunofluorescence (IF). We chose to look at six hours based on our prior studies that showed this time to be associated with βC nuclear shuttling and transcriptional activation in BMP-2 stimulated PASMCs(13). As predicted, we found an increase in nuclear βC six hours after PDGF-BB stimulation in both healthy and PAH PASMCs that was significantly greater in the latter (Fig. 2A).
Figure 2. PDGF-BB stimulation increases nuclear translocation of βC and transcriptional activity.
(A) Immunofluorescence images showing active βC in healthy (top) and PAH (bottom) PASMCs. Cells were starved 48h in 0.1% FBS and then stimulated with 20 ng/mL PDGF-BB over a period of 6h. DAPI (blue) stain was used to label cell nuclei. Green nuclear fluorescence was measured and compared using one-way ANOVA with Bonferroni post-test. Bar=10 μm. (B) TOPflash luciferase assays in PDGF-stimulated healthy donor (HD) and PAH PASMCs. Cells were transfected with TOPflash or FOPflash (negative control) luciferase reporter plasmids, or Renilla as a control for transfection efficiency. Cells were stimulated with 20 ng/mL PDGF-BB for 6h. Lysates were analyzed for luciferase activity relative to Renilla (Relative luciferase activity or RLU: a measure of βC mediated changes in transcriptional activity). HD=healthy donors. Bars represent means ± SEM. *P<0.01, **P<0.001, ***P <0.0001 compared to unstimulated controls, ###P<0.0001 vs. corresponding HD using one-way ANOVA with Bonferroni post-test (N=3).
To correlate the observed PDGF-BB mediated increase in nuclear βC to changes in transcriptional activity, we transfected cells with either TOPflash, a reporter plasmid that contains the βC specific promoter linked to luciferase, or with the corresponding negative control (FOPflash). Compared to healthy cells, we found that PAH PASMC demonstrated greater luciferase production at baseline and after six hours of PDGF stimulation (Fig. 2B). However, it is important to point out that the increase in PAH was proportionally the same as in healthy cells.
Reduction of βC reduces growth potential of PAH PASMC at baseline and in response to PDGF-BB
Previous studies have shown that βC activation is associated with increased vascular SMC proliferation in the systemic circulation(15, 16) and that increased GSK3β phosphorylation is significantly increased in PAH PASMCs(17) but whether increased βC activation is directly responsible for the increased rate of PAH PASMC proliferation is unclear. In order to demonstrate that βC activation is associated with the elevated PAH PASMC proliferation, we transfected both healthy and PAH PASMCs with either scrambled (SC) or βC-specific RNA interfering molecules (RNAi, Supplement Fig. 3) and measured their growth response in the presence or absence of PDGF-BB. In cells transfected with SC RNAi, proliferation rates were significantly higher in unstimulated and PDGF-stimulated PAH cells compared to controls (Fig. 3). However, βC knockdown caused a significant reduction in the PDGF-BB mediated growth response and normalized PAH PASMC baseline growth levels to values comparable to those seen in healthy PASMCs without PDGF stimulation (Fig. 3).
Figure 3. RNAi knockdown of βC reduces the PDGF-mediated growth response in PASMCs and normalizes baseline growth in PAH PASMCs.
PASMCs from healthy and PAH patients were transfected for RNAi specific for βC or scrambled RNA as a negative control. Cells were seeded in 24-well plates at 25,000 cells per well and starved for 48h in 0.1% FBS. Cells were then grown 72h in either starvation media alone or supplemented with 20 ng/mL PDGF-BB. SC=scrambled RNAi control. Bars represent means ± SEM. *** P<0.0001 compared to unstimulated SC, ##P<0.001 vs. corresponding SC using one-way ANOVA with Bonferroni post-test (N=3).
In conclusion, we confirmed that PAH PASMCs demonstrate greater levels of βC activation both at baseline and in response to PDGF-BB stimulation. We next sought to investigate whether stimulation with βC suppressing Wnt ligands could also mimic the effect of RNAi on PAH PASMCs proliferation.
Wnt5a prevents PDGF-stimulated growth, βC activation, and transcriptional activity in healthy but not PAH PASMCs
βC activation is usually regulated by Wnt ligands produced locally that interact with the surface receptors Frizzled and LRP 5/6 to trigger GSK3β phosphorylation. To determine whether healthy donor and PAH PASMCs demonstrate different Wnt ligand expression, we decided to look at the expression of well-established Wnt ligands involved in the regulation of βC using quantitative (q) PCR. Of the 19 known Wnt ligands, Wnt5a had the highest expression in both healthy and PAH PASMCs, with the latter displaying significantly higher levels (Supp. Fig. 4). This finding is particularly relevant since Wnt5a has been associated with suppression of βC activation in a number of mammalian cells(18, 19) and was recently shown to suppress hypoxia induced PASMC proliferation via reduction of βC activity(20). Based on these findings, we sought to characterize the biological effects of Wnt5a on healthy donor and PAH PASMCs.
To study the effects of Wnt5a on βC activation in PASMCs, we conducted cell and BrdU proliferation assays of healthy and PAH cells exposed to a dose range of recombinant Wnt5a (10-100ng/ml) in the presence or absence of PDGF-BB co-stimulation. While co-stimulation with recombinant Wnt5a led to significant reduction in PDGF-BB mediated growth in healthy cells (Fig 4A), it failed to suppress the growth of PAH PASMCs independent of PDGF-BB stimulation (Fig. 4B). Similar results were also obtained with a BrdU assay to rule out possible contribution of apoptosis (Supp. Fig. 5). Also, it is important to point out that Wnt5a stimulation alone had no significant effect on cell proliferation on either cell type.
Figure 4. Wnt5a stimulation prevents proliferation in PDGF BB-stimulated control PASMCs and fails to stimulate a response in PAH PASMCs.
Cell proliferation assays using healthy donor (A) and PAH (B) PASMCs. Cells were seeded in 24-well plates at 25,000 cells per well and starved for 48h in 0.1% FBS. Cells were then grown 72h in either starvation media alone or supplemented with 20 ng/mL PDGF-BB and/or concentrations of Wnt5a described in the figure. Cells stimulated with Wnt5a and PDGF-BB were pre-incubated with Wnt5a for 30 minutes prior to the addition of PDGF-BB. CON, control. Bars represent means ± SEM from three different experiments. ***P<0.0001 compared to unstimulated controls, ###P <0.0001 compared to PDGF-BB stimulation using one-way ANOVA test with Bonferroni post-test.
To correlate our proliferation data with changes in levels of βC activation and transcriptional activity, we measured active βC levels and transcriptional activity under the same conditions as those used in the proliferation assays. We found that, while Wnt5a stimulation alone failed to alter βC activation on either cell type, it prevented PDGF-BB induced elevation in βC levels (Fig. 5A) and transcriptional activity (Fig. 5B) in healthy PASMCs. However, as with the proliferation response, Wnt5a failed to influence βC activation (Fig. 5C) or its transcriptional activity in PAH PASMCs (Fig. 5D).
Figure 5. Wnt5a stimulation prevents PDGF-mediated βC activation and transcriptional activity in healthy PASMCs and fails to stimulate a response in PAH PASMCs.
(A and C) β-catenin activation was measured in lysates from healthy donor (top) and PAH (bottom) PASMCs stimulated with 50 ng/mL Wnt5a alone or supplemented with 20 ng/mL PDGF-BB over a period of 6h. Corresponding densitometry values against α-tubulin are shown below. (B and D) TOPflash luciferase assays in healthy donor (top) and PAH (bottom) PASMCs. Cells were stimulated with 50 ng/mL Wnt5a alone or supplemented with 20 ng/mL PDGF-BB for 6h. All co-stimulation samples were pre-incubated for 30 minutes with Wnt5a before the addition of PDGF-BB. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated controls using one-way ANOVA with Bonferroni post-test.
Taken together, our findings strongly support a role for Wnt5a in the regulation of PDGF mediated PASMC growth by suppressing excess βC activation in healthy PASMCs but this mechanism appears to be lost in PAH PASMCs.
DISCUSSION
Using healthy and PAH PASMCs, we show for the first time to our knowledge that increased proliferation in PAH PASMCs is associated with increased baseline βC activation that is responsive to local PDGF-BB stimulation. These studies expand findings reported by other groups that have described elevated βC levels within vascular obliterative lesions in PAH lungs(21) and endogenous GSK3β inhibition as a feature of PASMC proliferation in both human and monocrotaline treated rats, a well-established animal model of experimental PAH(17). Our findings also support a mechanism in which PDGF-BB and βC may be acting together to promoting abnormal vascular remodeling and obliteration of healthy vessels by promoting excessive PASMC accumulation allowing us to speculate that agents that target both PDGF and βC activation may lead to a better treatment response in patients suffering from PAH.
Studies looking at PAH PASMCs in cell culture have shown that, when compared to healthy counterparts, these cells are hyperproliferative both at baseline and when exposed to growth factors such as PDGF-BB(8, 22, 23). When treated with tyrosine kinase receptor inhibitors such as imatinib or sorafenib, PAH PASMC hyperproliferation can be effectively suppressed(8, 24) which argues that other agents that target downstream mediators of PDGF-BB signaling could also have beneficial roles in PAH. Previous studies have suggested that PDGF-BB could influence βC activation, a known inducer of cell proliferation in PASMCs(13), by triggering several downstream signaling mediators such as ERK, Akt, and GSK3β(25). Our studies show that PDGF-mediated βC activation correlates with phosphorylation of GSK3β, an event that could result in βC accumulation by disrupting the GSK3β/APC/Axin/βC destruction complex arguing that this mechanism may be relevant to PASMCs. However, it may not be the only one since other investigators have found alternate mechanism by which PDGF-BB could modulate βC activation. For example, Yang et al. have demonstrated that PDGF-BB can trigger βC accumulation via the p68 helicase, which also disrupts GSK3β and sequesters βC in the nucleus(26, 27). Based on these findings, it is very likely that there are more signaling pathways involved in PDGF mediated regulation of βC that could serve as targets for novel therapeutics in PAH.
The finding that PDGF-BB mediated βC activation is linked to PASMC proliferation has implications for PAH pathobiology and drug development. We show with RNAi transfection and proliferation assays that knockdown of βC both reduces the PDGF-BB mediated growth response and normalizes baseline proliferation of PAH PASMCs to levels comparable to those seen in healthy unstimulated controls. Therefore, we speculate that novel pharmaceuticals that target both PDGF-BB and βC may be able to reverse or slow the progression of pulmonary hypertension. We anticipate that studies using established animal models of PAH such as the monocrotaline, hypoxia or SUGEN-hypoxia murine models(28) will allow further characterization of the impact that inhibition of both PDGF and βC will have on preventing and/or reversing obliterative vascular lesions and whether it could also improve survival.
In agreement with published reports(20), we found that Wnt5a was capable of suppressing PDGF-BB dependent PASMC proliferation and βC activation. However, our experiments also showed that Wnt5a failed to suppress PDGF-BB dependent βC in PAH PASMCs, suggesting the presence of additional abnormalities that could prevent modulation of the activity of the PDGF/βC axis in PAH PASMCs. Wnt5a is capable of both suppression and activation of βC in a context dependent manner and the observed events could be the result of a number of variables such as abundance of specific receptors and activity of signaling mediators that bypass dependence on ligand dependent receptor activation to trigger βC activation(12, 18-20). Our findings justify that more studies on the PDGF-βC pathway are needed, as well as studies on the role of Wnt5a in βC degradation in PAH PASMCs.
In conclusion, we present a model in which PDGF-BB and βC contribute to abnormal PASMC growth in PAH and that targeting βC could help restrain these pathological events. Our findings have implications for the development of future therapeutics that could complement available PAH therapies and serve to change the natural history of this devastating disease.
Supplementary Material
Supplement Figure 1. Densitometry measurements of active vs. total β-catenin in healthy and PAH PASMCs. Loading was compared against α-tubulin. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated controls, #, P<0.1, ##P<0.01, ###P<0.001 vs. corresponding HD using one-way ANOVA with Bonferroni post-test, N=3 independent studies.
Supplement Figure 2. Densitometry measurements of total GSK3β in healthy and PAH PASMCs. Loading was compared against α-tubulin. Bars represent means ± SEM. N=3 independent studies.
Supplement Figure 3. Densitometry measurements of active β-catenin in healthy and PAH PASMCs treated with either scrambled (SC) or β-catenin RNAi. Loading was compared against α-tubulin. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated controls using t-test, N=3 independent studies.
Supplement Figure 4. Quantitative PCR for Wnt3a, Wnt5a, Wnt7a and Wnt11 in healthy door (HD) and PAH PASMCs. Values are expressed as fold change in HD vs. PAH.
Supplement Figure 5. BrdU proliferation assays using healthy donor (A) and PAH (B) PASMCs. Cells were seeded in 24-well plates at 25,000 cells per well and starved for 48h in 0.1% FBS. Cells were then grown 72h in either starvation media alone or supplemented with 20 ng/mL PDGF-BB and/or concentrations of Wnt5a described in the figure. Cells stimulated with Wnt5a and PDGF-BB were pre-incubated with Wnt5a for 30 minutes prior to the addition of PDGF. CON, control. Bars represent means ± SEM from three different experiments. ***P <0.0001 compared to unstimulated controls, ###P <0.0001 Wnt5a+PDGF vs. Wnt5a alone using one-way ANOVA test with Bonferroni post-test.
Supplement Table 1. Clinical characteristics of patients who acted as a source of PASMCs used in the study.
ACKNOWLEDGEMENTS
Lung tissues from healthy and PAH patients were provided by the Pulmonary Hypertension Breakthrough Initiative, which is funded by the Cardiovascular Medical Research and Education Fund.
FUNDING SOURCES
This work was supported by a career development award from the Robert Wood Johnson Foundation, an NIH K08 HL105884-01 and a Pulmonary Hypertension Association grant to V. de Jesus Perez.
Abbreviations
- PDGF-BB
platelet derived growth factor BB
- βC
βcatenin
- PASMCs
pulmonary artery smooth muscle cells
- GSK3β
glycogen synthase kinase β
References
- 1.de Jesus Perez VA, Yuan K, Orcholski ME, Sawada H, Zhao M, Li CG, Tojais NF, Nickel NP, Rajagopalan V, Spiekerkoetter E, Wang L, Dutta R, Bernstein D, Rabinovitch M. Loss of adenomatous poliposis coli-alpha3 integrin interaction promotes endothelial apoptosis in mice and humans. Circ Res. 2012 doi: 10.1161/CIRCRESAHA.112.267849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Michelakis ED, Wilkins MR, Rabinovitch M. Emerging concepts and translational priorities in pulmonary arterial hypertension. Circulation. 2008;118:1486–1495. doi: 10.1161/CIRCULATIONAHA.106.673988. [DOI] [PubMed] [Google Scholar]
- 3.Rabinovitch M. Molecular pathogenesis of pulmonary arterial hypertension. J Clin Invest. 2008;118:2372–2379. doi: 10.1172/JCI33452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Perros F, Montani D, Dorfmuller P, Durand-Gasselin I, Tcherakian C, Le Pavec J, Mazmanian M, Fadel E, Mussot S, Mercier O, Herve P, Emilie D, Eddahibi S, Simonneau G, Souza R, Humbert M. Platelet-derived growth factor expression and function in idiopathic pulmonary arterial hypertension. Am J Respir Crit Care Med. 2008;178:81–88. doi: 10.1164/rccm.200707-1037OC. [DOI] [PubMed] [Google Scholar]
- 5.Antoniu SA. Targeting pdgf pathway in pulmonary arterial hypertension. Expert Opin Ther Targets. 2012;16:1055–1063. doi: 10.1517/14728222.2012.719500. [DOI] [PubMed] [Google Scholar]
- 6.Cimminiello C, Arpaia G, Aloisio M, Uberti T, Rossi F, Pozzi F, Bonfardeci G. Platelet-derived growth factor (pdgf) in patients with different degrees of chronic arterial obstructive disease. Angiology. 1994;45:289–293. doi: 10.1177/000331979404500405. [DOI] [PubMed] [Google Scholar]
- 7.Klein M, Schermuly RT, Ellinghaus P, Milting H, Riedl B, Nikolova S, Pullamsetti SS, Weissmann N, Dony E, Savai R, Ghofrani HA, Grimminger F, Busch AE, Schafer S. Combined tyrosine and serine/threonine kinase inhibition by sorafenib prevents progression of experimental pulmonary hypertension and myocardial remodeling. Circulation. 2008;118:2081–2090. doi: 10.1161/CIRCULATIONAHA.108.779751. [DOI] [PubMed] [Google Scholar]
- 8.Schermuly RT, Dony E, Ghofrani HA, Pullamsetti S, Savai R, Roth M, Sydykov A, Lai YJ, Weissmann N, Seeger W, Grimminger F. Reversal of experimental pulmonary hypertension by pdgf inhibition. J Clin Invest. 2005;115:2811–2821. doi: 10.1172/JCI24838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ghofrani HA, Morrell NW, Hoeper MM, Olschewski H, Peacock AJ, Barst RJ, Shapiro S, Golpon H, Toshner M, Grimminger F, Pascoe S. Imatinib in pulmonary arterial hypertension patients with inadequate response to established therapy. Am J Respir Crit Care Med. 2010;182:1171–1177. doi: 10.1164/rccm.201001-0123OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hoeper MM, Barst RJ, Bourge RC, Feldman J, Frost AE, Galie N, Gomez-Sanchez MA, Grimminger F, Grunig E, Hassoun PM, Morrell NW, Peacock AJ, Satoh T, Simonneau G, Tapson VF, Torres F, Lawrence D, Quinn DA, Ghofrani HA. Imatinib mesylate as add-on therapy for pulmonary arterial hypertension: Results of the randomized impres study. Circulation. 2013;127:1128–1138. doi: 10.1161/CIRCULATIONAHA.112.000765. [DOI] [PubMed] [Google Scholar]
- 11.Clevers H, Nusse R. Wnt/beta-catenin signaling and disease. Cell. 2012;149:1192–1205. doi: 10.1016/j.cell.2012.05.012. [DOI] [PubMed] [Google Scholar]
- 12.Willert K, Nusse R. Wnt proteins. Cold Spring Harb Perspect Biol. 2012;4:a007864. doi: 10.1101/cshperspect.a007864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Perez VA, Ali Z, Alastalo TP, Ikeno F, Sawada H, Lai YJ, Kleisli T, Spiekerkoetter E, Qu X, Rubinos LH, Ashley E, Amieva M, Dedhar S, Rabinovitch M. Bmp promotes motility and represses growth of smooth muscle cells by activation of tandem wnt pathways. J Cell Biol. 2011;192:171–188. doi: 10.1083/jcb.201008060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Perez VA, Ali Z, Alastalo TP, Ikeno F, Sawada H, Lai YJ, Kleisli T, Spiekerkoetter E, Qu X, Rubinos LH, Ashley E, Amieva M, Dedhar S, Rabinovitch M. Bmp promotes motility and represses growth of smooth muscle cells by activation of tandem wnt pathways. J Cell Biol. 2011;192:171–188. doi: 10.1083/jcb.201008060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hua J, Xu Y, He Y, Jiang X, Ye W, Pan Z. Wnt4/beta-catenin signaling pathway modulates balloon-injured carotid artery restenosis via disheveled-1. International journal of clinical and experimental pathology. 2014;7:8421–8431. [PMC free article] [PubMed] [Google Scholar]
- 16.Tsaousi A, Williams H, Lyon CA, Taylor V, Swain A, Johnson JL, George SJ. Wnt4/beta-catenin signaling induces vsmc proliferation and is associated with intimal thickening. Circ Res. 2011;108:427–436. doi: 10.1161/CIRCRESAHA.110.233999. [DOI] [PubMed] [Google Scholar]
- 17.Sklepkiewicz P, Schermuly RT, Tian X, Ghofrani HA, Weissmann N, Sedding D, Kashour T, Seeger W, Grimminger F, Pullamsetti SS. Glycogen synthase kinase 3beta contributes to proliferation of arterial smooth muscle cells in pulmonary hypertension. PloS one. 2011;6:e18883. doi: 10.1371/journal.pone.0018883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nemeth MJ, Topol L, Anderson SM, Yang Y, Bodine DM. Wnt5a inhibits canonical wnt signaling in hematopoietic stem cells and enhances repopulation. Proc Natl Acad Sci U S A. 2007;104:15436–15441. doi: 10.1073/pnas.0704747104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Topol L, Jiang X, Choi H, Garrett-Beal L, Carolan PJ, Yang Y. Wnt-5a inhibits the canonical wnt pathway by promoting gsk-3-independent beta-catenin degradation. J Cell Biol. 2003;162:899–908. doi: 10.1083/jcb.200303158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yu XM, Wang L, Li JF, Liu J, Li J, Wang W, Wang J, Wang C. Wnt5a inhibits hypoxia-induced pulmonary arterial smooth muscle cell proliferation by downregulation of beta-catenin. Am J Physiol Lung Cell Mol Physiol. 2013;304:L103–111. doi: 10.1152/ajplung.00070.2012. [DOI] [PubMed] [Google Scholar]
- 21.Rai PR, Cool CD, King JA, Stevens T, Burns N, Winn RA, Kasper M, Voelkel NF. The cancer paradigm of severe pulmonary arterial hypertension. Am J Respir Crit Care Med. 2008;178:558–564. doi: 10.1164/rccm.200709-1369PP. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Davies RJ, Holmes AM, Deighton J, Long L, Yang X, Barker L, Walker C, Budd DC, Upton PD, Morrell NW. Bmp type ii receptor deficiency confers resistance to growth inhibition by tgf-beta in pulmonary artery smooth muscle cells: Role of proinflammatory cytokines. Am J Physiol Lung Cell Mol Physiol. 2012;302:L604–615. doi: 10.1152/ajplung.00309.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hansmann G, de Jesus Perez VA, Alastalo TP, Alvira CM, Guignabert C, Bekker JM, Schellong S, Urashima T, Wang L, Morrell NW, Rabinovitch M. An antiproliferative bmp-2/ppargamma/apoe axis in human and murine smcs and its role in pulmonary hypertension. J Clin Invest. 2008;118:1846–1857. doi: 10.1172/JCI32503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Godinas L, Guignabert C, Seferian A, Perros F, Bergot E, Sibille Y, Humbert M, Montani D. Tyrosine kinase inhibitors in pulmonary arterial hypertension: A double-edge sword? Seminars in respiratory and critical care medicine. 2013;34:714–724. doi: 10.1055/s-0033-1356494. [DOI] [PubMed] [Google Scholar]
- 25.Jasinska-Stroschein M, Orszulak-Michalak D. The current approach into signaling pathways in pulmonary arterial hypertension and their implication in novel therapeutic strategies. Pharmacological reports: PR. 2014;66:552–564. doi: 10.1016/j.pharep.2014.04.001. [DOI] [PubMed] [Google Scholar]
- 26.Yang L, Lin C, Liu ZR. P68 rna helicase mediates pdgf-induced epithelial mesenchymal transition by displacing axin from beta-catenin. Cell. 2006;127:139–155. doi: 10.1016/j.cell.2006.08.036. [DOI] [PubMed] [Google Scholar]
- 27.Yang L, Lin C, Zhao S, Wang H, Liu ZR. Phosphorylation of p68 rna helicase plays a role in platelet-derived growth factor-induced cell proliferation by up-regulating cyclin d1 and cmyc expression. J Biol Chem. 2007;282:16811–16819. doi: 10.1074/jbc.M610488200. [DOI] [PubMed] [Google Scholar]
- 28.Gomez-Arroyo J, Saleem SJ, Mizuno S, Syed AA, Bogaard HJ, Abbate A, Taraseviciene-Stewart L, Sung Y, Kraskauskas D, Farkas D, Conrad DH, Nicolls MR, Voelkel NF. A brief overview of mouse models of pulmonary arterial hypertension: Problems and prospects. Am J Physiol Lung Cell Mol Physiol. 2012;302:L977–991. doi: 10.1152/ajplung.00362.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplement Figure 1. Densitometry measurements of active vs. total β-catenin in healthy and PAH PASMCs. Loading was compared against α-tubulin. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated controls, #, P<0.1, ##P<0.01, ###P<0.001 vs. corresponding HD using one-way ANOVA with Bonferroni post-test, N=3 independent studies.
Supplement Figure 2. Densitometry measurements of total GSK3β in healthy and PAH PASMCs. Loading was compared against α-tubulin. Bars represent means ± SEM. N=3 independent studies.
Supplement Figure 3. Densitometry measurements of active β-catenin in healthy and PAH PASMCs treated with either scrambled (SC) or β-catenin RNAi. Loading was compared against α-tubulin. Bars represent means ± SEM. ***P <0.0001 compared to unstimulated controls using t-test, N=3 independent studies.
Supplement Figure 4. Quantitative PCR for Wnt3a, Wnt5a, Wnt7a and Wnt11 in healthy door (HD) and PAH PASMCs. Values are expressed as fold change in HD vs. PAH.
Supplement Figure 5. BrdU proliferation assays using healthy donor (A) and PAH (B) PASMCs. Cells were seeded in 24-well plates at 25,000 cells per well and starved for 48h in 0.1% FBS. Cells were then grown 72h in either starvation media alone or supplemented with 20 ng/mL PDGF-BB and/or concentrations of Wnt5a described in the figure. Cells stimulated with Wnt5a and PDGF-BB were pre-incubated with Wnt5a for 30 minutes prior to the addition of PDGF. CON, control. Bars represent means ± SEM from three different experiments. ***P <0.0001 compared to unstimulated controls, ###P <0.0001 Wnt5a+PDGF vs. Wnt5a alone using one-way ANOVA test with Bonferroni post-test.
Supplement Table 1. Clinical characteristics of patients who acted as a source of PASMCs used in the study.