Skip to main content
Development (Cambridge, England) logoLink to Development (Cambridge, England)
. 2016 Jan 1;143(1):45–53. doi: 10.1242/dev.126813

Hypothalamic radial glia function as self-renewing neural progenitors in the absence of Wnt/β-catenin signaling

Robert N Duncan 1, Yuanyuan Xie 1, Adam D McPherson 1, Andrew V Taibi 1, Joshua L Bonkowsky 1, Adam D Douglass 1, Richard I Dorsky 1,*
PMCID: PMC4725207  PMID: 26603385

Abstract

The vertebrate hypothalamus contains persistent radial glia that have been proposed to function as neural progenitors. In zebrafish, a high level of postembryonic hypothalamic neurogenesis has been observed, but the role of radial glia in generating these new neurons is unclear. We have used inducible Cre-mediated lineage labeling to show that a population of hypothalamic radial glia undergoes self-renewal and generates multiple neuronal subtypes at larval stages. Whereas Wnt/β-catenin signaling has been demonstrated to promote the expansion of other stem and progenitor cell populations, we find that Wnt/β-catenin pathway activity inhibits this process in hypothalamic radial glia and is not required for their self-renewal. By contrast, Wnt/β-catenin signaling is required for the differentiation of a specific subset of radial glial neuronal progeny residing along the ventricular surface. We also show that partial genetic ablation of hypothalamic radial glia or their progeny causes a net increase in their proliferation, which is also independent of Wnt/β-catenin signaling. Hypothalamic radial glia in the zebrafish larva thus exhibit several key characteristics of a neural stem cell population, and our data support the idea that Wnt pathway function may not be homogeneous in all stem or progenitor cells.

KEY WORDS: Wnt signaling, Radial glia, Neural progenitors, Hypothalamus, Zebrafish


Summary: Radial glia in the larval zebrafish hypothalamus exhibit stem cell-like properties. Their self-renewal is Wnt independent, although Wnt signalling does regulate their differentiation.

INTRODUCTION

The postembryonic zebrafish brain is highly proliferative and regenerative, characteristics that have been attributed to the presence of radial glia that persist throughout the central nervous system (CNS) and generate neurons (Kizil et al., 2012; Than-Trong and Bally-Cuif, 2015). We previously characterized a population of neural progenitors in the postembryonic zebrafish hypothalamus, which produces multiple neuronal subtypes through adulthood (Wang et al., 2012). A similar process also occurs in the mammalian hypothalamus, where adult neurogenesis contributes to reproductive and feeding behaviors (Kokoeva et al., 2005; Lee et al., 2012; Cheng, 2013). However, the underlying progenitor cell populations supporting hypothalamic neurogenesis remain poorly characterized. Although radial glia have been proposed to fulfill this role in both zebrafish and mouse (Lee et al., 2012; Wang et al., 2012; Haan et al., 2013; Robins et al., 2013), their capacity for self-renewal and differentiation have not been comprehensively tested.

In addition, the molecular pathways regulating radial glial self-renewal, expansion and neurogenesis in the hypothalamus are poorly understood. Previous work from our laboratory showed that Wnt/β-catenin signaling is required for postembryonic hypothalamic neurogenesis (Wang et al., 2012), and other studies have also led to the hypothesis that pathway activity promotes radial glial differentiation (Lee et al., 2006; Wang et al., 2011, 2012; Choe and Pleasure, 2012; Varela-Nallar and Inestrosa, 2013). By contrast, Wnt/β-catenin signaling has also been shown to promote the self-renewal and expansion of neural stem cells in the mammalian telencephalic subventricular zone and dentate gyrus (Qu et al., 2010). The specific function of Wnt/β-catenin activity in hypothalamic radial glia is therefore unclear, leaving an open question as to whether a general role for the pathway exists for all neural stem and progenitor cell populations.

Here we take a genetic approach to identify the neural progenitor cell population in the larval zebrafish hypothalamus, and to characterize the response and regulation of hypothalamic radial glia during tissue growth and regeneration. Our data show that the radial glial population is both self-renewing and multipotent, and exhibits a proliferative response to partial ablation or to ablation of their neuronal progeny. In addition, we use multiple perturbations of Wnt/β-catenin signaling to test the necessity and sufficiency of pathway activity for radial glial self-renewal, expansion and neuronal differentiation. Consistent with studies of non-neural stem cells (Lowry et al., 2005; Blanpain and Fuchs, 2009; Farin et al., 2012), our data show that Wnt/β-catenin signaling is only necessary for the terminal differentiation of specific neuronal progeny. Furthermore, and as shown for radial glia in other brain regions (Wang et al., 2011), we find that ectopic Wnt/β-catenin activity inhibits the expansion of neurogenic radial glia in the hypothalamus. Together, these data suggest that the most generally conserved role for Wnt pathway activity in neural progenitors is in promoting neurogenesis, and that other functions may differ between diverse stem and progenitor cell populations.

RESULTS

Radial glia are multipotent neural progenitors in the postembryonic hypothalamus

In an effort to identify molecular markers of radial glia in the zebrafish hypothalamic posterior recess (Fig. 1A), we found that at 5 days post-fertilization (dpf), Glutamine synthetase (GS) and a her4.3:EGFP transgene (Fig. 1B) (Yeo, et al., 2007) both label radially oriented cells contacting the ventricle along with an Et(Gal4-VP16;myl7:gfp)zc1066a enhancer trap line that we previously showed to be expressed in radial glia of the posterior recess (Fig. 1C) (Wang et al., 2012). Although there was not complete co-expression, probably owing to transgene mosaicism, the majority of cells expressing GS also expressed her4.3:EGFP (Fig. 1D). A consistent minority of cells labeled by her4.3:EGFP were also GS−, potentially representing non-glial progeny due to GFP perdurance (Briona and Dorsky, 2014). By contrast, we did not observe expression of either Gfap (Wang et al., 2012) or S100β (data not shown) in this region. Combined with previous evidence supporting the specificity of GS and her4.3:EGFP in labeling radial glia throughout the zebrafish brain (Ganz et al., 2010; Grupp et al., 2010; Kroehne et al., 2011), we concluded that both markers also effectively label this population in the posterior recess.

Fig. 1.

Fig. 1.

Radial glia in the hypothalamic posterior recess are not Wnt-responsive. (A) Diagram of the hypothalamic posterior recess from a ventral view of a 5 dpf zebrafish brain. Radial glia are in green; the red box indicates the area depicted in B. (B) High-magnification optical section of her4.3:EGFP expression, showing the position of cell soma and radial processes. (C) Radial glial cells in the 5 dpf posterior recess can be labeled with anti-Glutamine synthetase (GS, blue), a her4.3:EGFP transgene (green), and a Gal4 enhancer trap line (red). Yellow box indicates the region shown beneath. A triple-labeled cell is indicated by red circles. (D) Most cells expressing GS or her4.3:EGFP also express the other marker. Error bars indicate s.e.m.; n=22 optical sections from two brains. (E) Most GS+ and her4.3:EGFP+ radial glia do not express the Wnt reporter transgene 7xTCF-Xla.Siam:GFP. Yellow box indicates region shown beneath. A reporter-negative radial glial cell is indicated by green circles, and a reporter-expressing non-glial cell is indicated by red circles. (F) GS+ cells are not reduced in number in lef1 mutants at 5 dpf. Images are single optical sections from ventral views of whole-mount brains. WT, wild type; nuclei are stained with Hoechst 33342 (blue). Scale bars: 10 µm.

Consistent with our previous work (Wang et al., 2012), we found that only 5.5±2.5% (s.e.m., n=11 optical sections from two brains) of GS+ cells expressed the Wnt reporter transgene 7xTCF-Xla.Siam:mCherry (Moro et al., 2012) (Fig. 1E). Furthermore, analysis of embryos homozygous for a null mutation in the Wnt effector lef1 (Wang et al., 2012) at 5 dpf (Fig. 1F) showed that the number of GS+ cells was in fact increased in the posterior recess relative to tissue size (29.5±1.4 in wild type versus 32.0±2.7 in lef1 mutants; s.e.m., n=3 equatorial optical sections each from four brains). These data, along with observations that her4.3:EGFP+ cells are also not decreased in lef1 mutants (data not shown), support our prior conclusion that hypothalamic radial glia do not require Wnt/β-catenin activity for their formation or maintenance.

To determine the lineage of the radial glial population, we took advantage of an existing transgenic line that uses the her4.3 promoter/enhancer to drive the expression of tamoxifen-inducible Cre recombinase (Boniface et al., 2009). By crossing this line to the Cre-inducible ubi:switch reporter (Mosimann et al., 2011), which expresses mCherry following recombination, we were able to permanently label all progeny (Fig. 2A). Addition of 5 µM 4-hydroxytamoxifen (4-OHT) from 5-6 dpf resulted in the conversion of 1-5 cells per posterior recess, and we did not observe any mCherry expression in untreated larvae. Analysis at 6 dpf showed that 97±3% of mCherry+ cells (s.e.m., n=30 optical sections from three brains) were co-labeled by GS (Fig. 2B, Fig. S1A). Six days after recombination, radial chains of labeled progeny were visible extending from the ventricle, including both GS+ and GS− cells (Fig. 2C). By 6 weeks post-fertilization (wpf), labeled progeny had expanded into large radial clones (Fig. 2D), which contained only 8.7±1.5% GS+ cells (s.e.m., n=30 optical sections from three brains; Fig. 2E, Fig. S1B). Using markers for differentiated neuronal cell types, we found that at 6 wpf the lineage included neurons labeled by HuC/D (Elavl3/4) (Fig. 2F, Fig. S1C), serotonin (Fig. 2G) (Perez et al., 2013), and a transgenic marker of dopaminergic fate [Tg(th2:Gal-VP16)zd202; McPherson et al., 2016] (Fig. 2H). These data indicate that postembryonic neurons in the zebrafish hypothalamus arise from a radial glial population that can self-renew, expand, and generate multiple types of progeny.

Fig. 2.

Fig. 2.

Hypothalamic radial glia are self-renewing neural progenitors. (A) Timeline and schematic of experiments. Cells expressing −3her4.1:ERT2-Cre-ERT and ubi:loxP-eGFP-loxP-mCherry were genetically labeled by the addition of 5 µM 4-OHT from 5-6 dpf. Labeled progeny (red) comprise expanding radial units spanning hemispheres of the posterior recess. Processes of GS+ radial glia (green) span the tissue, and nuclei occupy variable positions from the ventricle to the outer edge. Neurons (blue) are located either adjacent to the ventricle or at the outer edge. (B) Immediately following conversion, the few labeled mCherry+ cells are also GS+. Yellow boxes indicate regions shown beneath. (C) Six days after conversion, labeled cells extend radially and include GS+ (yellow box) and GS− (green box) cells. (D) Five weeks after 4-OHT addition, discrete groups of mCherry+ cells extend from the ventricle (dashed line). (E-H) mCherry+ progeny 5 weeks after recombination include GS+ radial glia (E), HuC/D+ neurons (F), 5HT+ neurons (G) and th2:gfp+ dopaminergic neurons (H). Yellow boxes indicate regions shown beneath, and double-labeled cells are indicated by red circles. Green signal in E,F is ubi:GFP from unconverted cells. Images are single optical sections from ventral views of whole-mount brains. Scale bars: 10 µm.

Wnt/β-catenin signaling is only required for the differentiation of a specific subset of neuronal progeny

We next tested whether Wnt/β-catenin signaling is necessary for the self-renewal, expansion or neuronal differentiation of radial glia. Using heat shock-mediated expression of the secreted Wnt signaling inhibitor Dkk1 (Stoick-Cooper et al., 2007), following conversion of the Cre-labeled population with 4-OHT, we examined the effects on lineage size and composition. After conversion from 5-6 dpf, Tg(hsp701:dkk1-GFP)w32 embryos were heat shocked once daily and fixed at 9 dpf. Although Dkk1 expression effectively inhibited Wnt signaling, as determined by in situ hybridization of the Wnt/β-catenin target sp5l (Weidinger et al., 2005) (Fig. S2), it did not result in a significant difference in the total number of labeled cells (Fig. 3A,D) or in the percentage of GS+ radial glia (Fig. 3B,D) in the lineage. Dkk1 expression also did not inhibit the differentiation of HuC/D+ neurons from labeled radial glia (Fig. 3C) and, in fact, caused a small but statistically insignificant increase in neurogenesis. These results suggest that radial glia can divide and produce neuronal progeny in the absence of Wnt pathway activity.

Fig. 3.

Fig. 3.

Wnt/β-catenin signaling is only required for the differentiation of a specific subset of ventricular neurons. (A,B) Following recombination of −3her4.1:ERT2-Cre-ERT+ progeny from 5-6 dpf, expression of Dkk1 from 6-9 dpf does not affect the average number of labeled cells (A) or the percentage of GS+ cells (B) in the lineage. (C) The differentiation of HuC/D+ neurons from labeled radial glia is not inhibited by Dkk1 expression. (D) Representative images of labeling for lineage and GS in control and Dkk1-expressing larvae. (E) In lef1 mutants there is no change in the percentage of GS+ cells after conversion from 5-6 dpf and analysis at 9 dpf. (F,G) lef1-dependent ventricular neurons fail to arise from the radial glial lineage, whereas other non-ventricular neurons are not significantly affected. Yellow boxes indicate areas shown to the right. Images are single optical sections from ventral views of whole-mount brains. Error bars indicate s.e.m.; n=50 confocal slices from five brains for each experiment. Scale bars: 10 µm.

As an alternative method to inhibit Wnt signaling we examined the radial glial lineage in lef1 mutants. After 4-OHT-mediated conversion from 5-6 dpf and lineage analysis at 9 dpf, we found that loss of lef1 also did not significantly change the percentage of GS+ radial glia (Fig. 3E) within mCherry-labeled progeny. As we reported previously, lef1 is required to generate a subset of HuC/D+ neurons in the posterior recess (Wang et al., 2012). Our lineage analysis confirmed that these lef1-dependent neurons arise from radial glia and showed that they specifically reside within two cell diameters of the ventricle (Fig. 3F,G). However, they comprise only a small portion of radial glial progeny, and the number of non-ventricular neurons was not decreased (Fig. 3F). Combined with the results of Dkk1 overexpression, these data led us to conclude that Wnt/β-catenin signaling is not necessary for radial glial self-renewal or expansion. In addition, whereas Lef1-mediated Wnt activity is required for the differentiation of ventricular neurons, it is not required for the majority of neurogenesis in the hypothalamic posterior recess.

Partial genetic ablation of radial glia leads to increased proliferation of GS+ cells

To test whether hypothalamic radial glia show a regenerative response similar to other neural stem cell populations, we used the Et(Gal4-VP16,myl7:gfp)zc1066a enhancer trap line in combination with the Tg(UAS-E1b:NTR-mCherry)jh17 effector line to express Nitroreductase (NTR) specifically in radial glia of the posterior recess (Otsuna et al., 2015), and thus ablate cells using metronidazole (MTZ) (Davison et al., 2007; Pisharath et al., 2007). Consistent with previous studies, incubation of non-transgenic larvae in 1 mM MTZ did not significantly affect cell proliferation or cell death (data not shown). By contrast, after incubation of NTR-expressing larvae in 1 mM MTZ from 5-6 dpf we observed partial ablation of radial glia (Fig. 4A,B, Fig. S3), and the remaining radial glia, which were labeled either by GS (Fig. 4C,D) or her4.3:EGFP, showed variable but significantly increased BrdU labeling from 7-8 dpf (Fig. 4C-F). This result suggested that radial glia can react to a decrease in their own population with a corresponding increase in self-renewal.

Fig. 4.

Fig. 4.

Hypothalamic radial glia respond to partial ablation by increasing proliferative activity. (A,B) Partial ablation of NTR-mCherry-expressing radial glia (red) by incubation in 1 mM MTZ from 5-6 dpf; DMSO provides a control. (C-F) After partial ablation from 5-6 dpf and BrdU labeling from 7-8 dpf (C,D; yellow box indicates region shown beneath), there is a significant increase in the number of BrdU+ radial glia labeled either by GS (C-E) or by her4.3:EGFP (F) expression. (G,H) Inhibition of Wnt signaling by Dkk1 expression (G), or lef1 mutation (H), does not block the increase in BrdU labeling following partial ablation. Images are maximum-intensity z-projections (A,B) or single optical sections (C,D) from ventral views of whole-mount brains. Error bars indicate s.e.m.; n=40 optical sections from four brains for each experiment. Scale bars: 10 µm.

To determine if the proliferative response of radial glia to partial ablation requires Wnt/β-catenin signaling, we repeated our experiments in the presence of Dkk1 overexpression and in lef1 mutants. In both cases we observed a similar increase in BrdU incorporation within GS+ cells, as in control animals (Fig. 4G,H). These data indicate that, just as during normal growth, the regenerative expansion of hypothalamic radial glia is also Wnt/β-catenin independent.

Radial glia proliferate in response to the genetic ablation of progeny

We next investigated whether hypothalamic radial glia exhibit a proliferative response to the loss of a progeny cell type. Since we had observed that the lineage included dopaminergic neurons labeled by the th2 enhancer/promoter (Fig. 2F), and we found that the enhancer was not expressed in GS+ cells (Fig. 5A), we used a transgenic line [Tg(th2:Gal-VP16)zd20; McPherson et al., 2016] to drive UAS:NTR-mCherry expression (Fig. 5B). Following incubation in a high dose (2.5 mM) of MTZ from 5-6 dpf to maximize the level of ablation, we observed a significant increase in BrdU labeling within the GS+ population at 8-9 dpf (Fig. 5C-E) but not 1 day earlier or later (Fig. 5C). The proliferative response coincided with a decrease in the overall number of GS+ cells at 9 dpf (Fig. 5F). Along with an increase in BrdU-labeled GS− cells (Fig. 5D), which are likely to be non-glial Sox3+ neural progenitors (Wang et al., 2012), these data are consistent with the depletion of radial glia observed during regeneration in the adult zebrafish telencephalon (Barbosa et al., 2015).

Fig. 5.

Fig. 5.

Hypothalamic radial glia proliferate in response to ablation of dopaminergic progeny. (A,B) The th2:GFP (5 dpf, A) and th2:Gal4 (9 dpf, B) transgenes do not label GS+ radial glia. Yellow boxes indicate regions shown beneath. (C) Ablation of th2:Gal4+ cells from 5-6 dpf leads to increased BrdU labeling only at 8-9 dpf. (D,E) Ablation of th2:Gal4+ cells increases the number and percentage of GS+ radial glia, as well as the number of GS− cells, labeled with BrdU from 8-9 dpf. (F) The overall number of GS+ radial glia is decreased at 9 dpf following ablation of th2:Gal4+ cells. Images are single optical sections from ventral views of whole-mount brains. Error bars indicate s.e.m.; n=50 optical sections from five brains for each experiment. Scale bars: 10 µm.

Wnt activation blocks expansion of the radial glial population

Based on evidence that ectopic Wnt/β-catenin signaling leads to a decrease in the number of radial glia (Wang et al., 2011, 2012), we examined whether pathway activity specifically inhibits the normal expansion of their progeny. Following induction of wnt8a at 5 dpf using the heat shock-inducible transgenic line Tg(hsp70l:wnt8a-GFP)w34(Weidinger et al., 2005), we observed a significant decrease in the number of GS+ cells at 6 dpf compared with controls (Fig. 6A). Continuous wnt8a expression over multiple days resulted in lethality, so to test the longer term consequences of pathway activation we incubated animals in 4 µM BIO, a pharmacological activator of Wnt/β-catenin signaling (Sato et al., 2004; Shimizu et al., 2012; Lush and Piotrowski, 2014) from 6-9 dpf. This experiment also produced a small but significant decrease in the number of GS+ cells compared with controls (Fig. 6B,C), suggesting that Wnt signaling either inhibits radial glial expansion or causes the loss of GS expression.

Fig. 6.

Fig. 6.

Wnt/β-catenin signaling activation blocks expansion of the radial glial population. (A) Induction of Wnt8a at 5 dpf leads to a decrease in the number of GS+ radial glia at 6 dpf. (B) Addition of 4 µM BIO, a Gsk3β inhibitor, daily from 6-9 dpf leads to a decrease in GS+ radial glia. (C) Representative images of labeling for GS in control and BIO-treated larvae. Images are single optical sections from ventral views of whole-mount brains. Scale bar: 10 µm. (D) Following recombination from 5-6 dpf, incubation in BIO causes a significant decrease in the number of labeled progeny at 9 dpf. (E) Incubation in BIO causes a significant increase in the percentage of GS+ cells within the labeled lineage. Error bars indicate s.e.m.; n=40 optical sections from four brains for each experiment.

To specifically test these possibilities, we next performed lineage analysis in the presence of BIO from 6-9 dpf after recombination from 5-6 dpf. We found that the total number of mCherry+ cells in animals treated with BIO was significantly decreased compared with controls (Fig. 6D), coupled with a relative increase in the proportion of GS+ cells within the labeled population (Fig. 6E). The smaller number of progeny was not due to cell death, as neither wnt8a induction (Wang et al., 2012) nor BIO treatment (data not shown) caused a significant increase in apoptosis. Our results could therefore by explained by a decrease in the number of radial glia undergoing amplifying divisions, combined with the decrease in neurogenesis that we previously demonstrated to result from constitutive Wnt activation (Wang et al., 2012).

DISCUSSION

Hypothalamic radial glia exhibit multiple features of neural stem cells

Our results demonstrate that hypothalamic radial glia in zebrafish are self-renewing neural progenitors that can undergo a regenerative response, characteristics that are hallmarks of a stem cell population. Because we were not able to follow the lineage of single cells, we cannot determine whether individual radial glia are multipotent with respect to neuronal fate. However, the expansion that we observe in the lineage over a 5-week labeling period indicates that radial glia contribute significantly to the growth in size of the posterior recess, and our marker analysis shows that the population as a whole generates several neuronal subtypes.

While previous studies from our laboratory and others have observed the presence of proliferating neural progenitors in the adult zebrafish hypothalamus (Wang et al., 2012; Perez et al., 2013), the work described here focused on an earlier period of larval development. The behavior of radial glia during this period is therefore not strictly equivalent to that of other adult stem cell populations, which are typically quiescent or support tissue homeostasis rather than growth. Future studies testing the lineage and injury response of radial glia in the adult zebrafish posterior recess will provide more insight into whether they function as true neural stem cells.

Wnt/β-catenin signaling is not necessary for hypothalamic radial glial self-renewal or expansion

Studies in the CNS (Piccin and Morshead, 2011) and other tissues (Nusse, 2008; Holland et al., 2013) have resulted in the hypothesis that Wnt/β-catenin signaling might function generally to promote stem and progenitor cell proliferation. In order to achieve the increase in population size that we observe in our lineage analysis, radial glia must undergo amplifying self-renewing divisions, and, as has been shown in the telencephalon (Barbosa et al., 2015), regeneration may require these divisions at an even higher frequency. However, our data indicate that ectopic Wnt activity in fact inhibits expansion of the hypothalamic radial glia population, while other studies suggest that signals such as FGF (Kaslin et al., 2009; Robins et al., 2013) and Sonic hedgehog (Dave et al., 2011; Shikata et al., 2011; Komada, 2012) are likely to promote this process.

We found that a specific subset of lef1-dependent neurons located near the hypothalamic ventricle arise from the radial glial lineage (Wang et al., 2012). Combined with other studies in the retina (Agathocleous et al., 2009), cerebral cortex (Munji et al., 2011; Zhang et al., 2014), hippocampus (Seib et al., 2013) and midbrain (Castelo-Branco et al., 2003), our data suggest that the most widely conserved role for Wnt/β-catenin signaling in the CNS might be to regulate the differentiation of specific subsets of committed neural progenitors.

Wnt/β-catenin activity does not act identically in all neural stem and progenitor cells

Our experiments support the idea that diverse neural stem and progenitor cell populations are likely to exhibit different responses to Wnt/β-catenin signaling. Although Wnt ligands and reporters are expressed at high levels in the hypothalamic ventricular zone (Wang et al., 2012), radial glia largely fail to respond to these signals. This low activity state could be regulated by extracellular or intracellular pathway antagonists, or radial glia might simply fail to express the appropriate receptors to transduce Wnt signals. Regardless of the mechanism, it appears that this characteristic of hypothalamic radial glia is similar to other radial glial populations in the zebrafish retina and spinal cord (Goldman, 2014; Briona et al., 2015), but differs from radial glia in the mammalian dentate gyrus (Qu et al., 2010). Other studies have similarly shown that neural progenitor populations vary dramatically in their interpretation of pathway activity (Poschl et al., 2013). Understanding these differences might help provide insight into the basis of radial glial, and neural stem/progenitor cell, heterogeneity.

MATERIALS AND METHODS

Zebrafish

Embryos were obtained from the following zebrafish lines: Tg(her4.3:EGFP)y83 (Yeo et al., 2007), Tg(ubi:loxP-eGFP-loxP-mCherry)cz1701(Mosimann et al., 2011), Tg(−3her4.1:ERT2-Cre-ERT2)vu298(Boniface et al., 2009; Mosimann et al., 2011), Et(Gal4-VP16,myl7:gfp)zc1066a (Wang et al., 2012), Tg(UAS-E1b:NTR-mCherry)jh17 (Davison et al., 2007; Pisharath et al., 2007), Tg(7xTCF-Xla.Siam:GFP)ia4 (Moro et al., 2012), Tg(hsp701:dkk1-GFP)w32 (Stoick-Cooper et al., 2007), Tg(hsp70l:wnt8a-GFP)w34(Weidinger et al., 2005), lef1zd11 (Wang et al., 2012), Tg(th2:GFP-aequorin)zd201 and Tg(th2:Gal-VP16)zd202 (McPherson et al., 2016). Embryos were staged according to Kimmel et al. (1995). All experiments were approved by the University of Utah Institutional Animal Care and Use Committee.

Transgenic embryos were identified by GFP tag expression following heat shock induction of wnt8 or dkk1, or by PCR amplification of trunk tissue for dkk1 induction in the presence of the –3.5ubi:loxP-EGFP-loxP-mCherry reporter using the following primers (5′-3′): dkk1 forward, TCGACTCAAGGATCACCACA; gfp reverse, TCCCTCAAACTTGACTTCAGC. lef1 mutant animals were identified by the absence of posterior neuromasts as labeled with DASPEI (Invitrogen) (McGraw et al., 2011; Wang et al., 2012).

Treatment of embryos and larvae

Cre-mediated recombination was performed by incubation in 5 µM 4-hydroxytamoxifen (4-OHT; Sigma, CAS RN 68047-06-3) in 1% DMSO from 5-6 dpf. Ablations were performed by incubation in 1 mM metronidazole (MTZ; Fluka, 46461) from 5-6 dpf. To activate Wnt/β-catenin signaling, larvae were incubated in 4 µM BIO (Sigma, B1686) from 6-9 dpf, with fresh solution added each day. For BrdU labeling, larvae were incubated in 10 mM BrdU for 1 day prior to fixation for all experiments. Heat shock experiments were performed by incubating larvae in 50 ml conical tubes in a 39.5°C water bath for 20 min. For experiments from 5-9 dpf, larvae were not fed.

Immunohistochemistry and in situ hybridization

Embryos were fixed in 4% paraformaldehyde with 5% sucrose overnight at 4°C. Brains were then dissected for immunohistochemistry and trunks were placed in PCR tubes for genotyping. Whole brains were washed in water, incubated in 2 M HCl for 20 min at room temperature (for BrdU detection), washed, and permeabilized with one unit of dispase (Gibco, 17105-041) for 90 min at room temperature. Primary antibodies were all used at 1:500 dilution and incubated overnight at 4°C: mouse anti-Glutamine synthetase (Millipore, MAB302), rabbit anti-DsRed (Clontech, 632496), chicken anti-GFP (Aves Labs, GFP-1020), chicken anti-BrdU (Immunology Consultants Laboratory, CBDU-65A-Z), rabbit anti-5-HT (ImmunoStar, 541016), mouse anti-HuC/D (Molecular Probes, A21271), goat anti-L-Plastin (Santa Cruz Biotechnology, sc-16657). Following washes, fluorescent secondary antibodies (Invitrogen; diluted 1:500 in solution containing Hoechst 33342) were incubated overnight at 4°C. Brains were imaged on a Nikon A1 confocal microscope with a 60× oil objective. The entire posterior recess was imaged using 3 µm steps encompassing roughly 40 µm total, cell counting was performed, and images were exported to Photoshop (Adobe), Illustrator (Adobe) and ImageJ (NIH) for figure generation.

In situ hybridization was performed as described previously (Wang et al., 2012) using an antisense probe for sp5l generated from a PCR-amplified cDNA template. A T7 RNA polymerase initiation sequence was added to the 5′ end of the reverse primer. sp5l F, GTTTCCCAGCCACATGCAAC; sp5l R, CCAAGCTTCTAATACGACTCACTATAGGGAGAATGCTCCCATCGCAACCATT.

Statistical analyses

Excel (Microsoft) was used to perform two-tailed equal variance t-tests; P<0.05 was interpreted as statistically significant.

Acknowledgements

We thank the University of Utah Centralized Zebrafish Animal Resource (CZAR) for assistance with animal care; and Wenbiao Chen (Vanderbilt University), Christian Mosimann (University of Zürich) and Ajay Chitnis (NICHD) for sharing zebrafish lines.

Footnotes

Competing interests

The authors declare no competing or financial interests.

Author contributions

Experiments were performed by R.N.D., Y.X., A.D.M. and A.V.T. Transgenic lines were made by A.D.D. [Tg(th2:GFP-aequorin)zd201] and by J.L.B. [Tg(th2:Gal-VP16)zd202]. R.N.D. wrote the manuscript. R.I.D. supervised all the experiments and edited the manuscript.

Funding

This work was supported by the National Institutes of Health [NIH T32 NS07067 to R.N.D., A.D.M. and A.V.T., NIH T32 HD07491 to A.D.M., NIH R01 NS082645 to R.I.D.]. Imaging was performed in the Fluorescence Microscopy Core Facility at the University of Utah [funded by NIH 1S10RR024761]. Deposited in PMC for release after 12 months.

Supplementary information

Supplementary information available online at http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.126813/-/DC1

References

  1. Agathocleous M., Iordanova I., Willardsen M. I., Xue X. Y., Vetter M. L., Harris W. A. and Moore K. B. (2009). A directional Wnt/beta-catenin-Sox2-proneural pathway regulates the transition from proliferation to differentiation in the Xenopus retina. Development 136, 3289-3299. 10.1242/dev.040451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barbosa J. S., Sanchez-Gonzalez R., Di Giaimo R., Baumgart E. V., Theis F. J., Gotz M. and Ninkovic J. (2015). Neurodevelopment. Live imaging of adult neural stem cell behavior in the intact and injured zebrafish brain. Science 348, 789-793. 10.1126/science.aaa2729 [DOI] [PubMed] [Google Scholar]
  3. Blanpain C. and Fuchs E. (2009). Epidermal homeostasis: a balancing act of stem cells in the skin. Nat. Rev. Mol. Cell Biol. 10, 207-217. 10.1038/nrm2636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boniface E. J., Lu J., Victoroff T., Zhu M. and Chen W. (2009). FlEx-based transgenic reporter lines for visualization of Cre and Flp activity in live zebrafish. Genesis 47, 484-491. 10.1002/dvg.20526 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Briona L. K. and Dorsky R. I. (2014). Radial glial progenitors repair the zebrafish spinal cord following transection. Exp. Neurol. 256, 81-92. 10.1016/j.expneurol.2014.03.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Briona L. K., Poulain F. E., Mosimann C. and Dorsky R. I. (2015). Wnt/β-catenin signaling is required for radial glial neurogenesis following spinal cord injury. Dev. Biol. 403, 15-21. 10.1016/j.ydbio.2015.03.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Castelo-Branco G., Wagner J., Rodriguez F. J., Kele J., Sousa K., Rawal N., Pasolli H. A., Fuchs E., Kitajewski J. and Arenas E. (2003). Differential regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and Wnt-5a. Proc. Natl. Acad. Sci. USA 100, 12747-12752. 10.1073/pnas.1534900100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cheng M.-F. (2013). Hypothalamic neurogenesis in the adult brain. Front. Neuroendocrinol. 34, 167-178. 10.1016/j.yfrne.2013.05.001 [DOI] [PubMed] [Google Scholar]
  9. Choe Y. and Pleasure S. J. (2012). Wnt signaling regulates intermediate precursor production in the postnatal dentate gyrus by regulating CXCR4 expression. Dev. Neurosci. 34, 502-514. 10.1159/000345353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dave R. K., Ellis T., Toumpas M. C., Robson J. P., Julian E., Adolphe C., Bartlett P. F., Cooper H. M., Reynolds B. A. and Wainwright B. J. (2011). Sonic hedgehog and notch signaling can cooperate to regulate neurogenic divisions of neocortical progenitors. PLoS ONE 6, e14680 10.1371/journal.pone.0014680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Davison J. M., Akitake C. M., Goll M. G., Rhee J. M., Gosse N., Baier H., Halpern M. E., Leach S. D. and Parsons M. J. (2007). Transactivation from Gal4-VP16 transgenic insertions for tissue-specific cell labeling and ablation in zebrafish. Dev. Biol. 304, 811-824. 10.1016/j.ydbio.2007.01.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Farin H. F., Van Es J. H. and Clevers H. (2012). Redundant sources of Wnt regulate intestinal stem cells and promote formation of Paneth cells. Gastroenterology 143, 1518-1529.e1517. 10.1053/j.gastro.2012.08.031 [DOI] [PubMed] [Google Scholar]
  13. Ganz J., Kaslin J., Hochmann S., Freudenreich D. and Brand M. (2010). Heterogeneity and Fgf dependence of adult neural progenitors in the zebrafish telencephalon. Glia 58, 1345-1363. 10.1002/glia.21012 [DOI] [PubMed] [Google Scholar]
  14. Goldman D. (2014). Müller glial cell reprogramming and retina regeneration. Nat. Rev. Neurosci. 15, 431-442. 10.1038/nrn3723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Grupp L., Wolburg H. and Mack A. F. (2010). Astroglial structures in the zebrafish brain. J. Comp. Neurol. 518, 4277-4287. 10.1002/cne.22481 [DOI] [PubMed] [Google Scholar]
  16. Haan N., Goodman T., Najdi-Samiei A., Stratford C. M., Rice R., El Agha E., Bellusci S. and Hajihosseini M. K. (2013). Fgf10-expressing tanycytes add new neurons to the appetite/energy-balance regulating centers of the postnatal and adult hypothalamus. J. Neurosci. 33, 6170-6180. 10.1523/JNEUROSCI.2437-12.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Holland J. D., Klaus A., Garratt A. N. and Birchmeier W. (2013). Wnt signaling in stem and cancer stem cells. Curr. Opin. Cell Biol. 25, 254-264. 10.1016/j.ceb.2013.01.004 [DOI] [PubMed] [Google Scholar]
  18. Kaslin J., Ganz J., Geffarth M., Grandel H., Hans S. and Brand M. (2009). Stem cells in the adult zebrafish cerebellum: initiation and maintenance of a novel stem cell niche. J. Neurosci. 29, 6142-6153. 10.1523/JNEUROSCI.0072-09.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kimmel C. B., Ballard W. W., Kimmel S. R., Ullmann B. and Schilling T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310. 10.1002/aja.1002030302 [DOI] [PubMed] [Google Scholar]
  20. Kizil C., Kaslin J., Kroehne V. and Brand M. (2012). Adult neurogenesis and brain regeneration in zebrafish. Dev. Neurobiol. 72, 429-461. 10.1002/dneu.20918 [DOI] [PubMed] [Google Scholar]
  21. Kokoeva M. V., Yin H. and Flier J. S. (2005). Neurogenesis in the hypothalamus of adult mice: potential role in energy balance. Science 310, 679-683. 10.1126/science.1115360 [DOI] [PubMed] [Google Scholar]
  22. Komada M. (2012). Sonic hedgehog signaling coordinates the proliferation and differentiation of neural stem/progenitor cells by regulating cell cycle kinetics during development of the neocortex. Congenit. Anomal. 52, 72-77. 10.1111/j.1741-4520.2012.00368.x [DOI] [PubMed] [Google Scholar]
  23. Kroehne V., Freudenreich D., Hans S., Kaslin J. and Brand M. (2011). Regeneration of the adult zebrafish brain from neurogenic radial glia-type progenitors. Development 138, 4831-4841. 10.1242/dev.072587 [DOI] [PubMed] [Google Scholar]
  24. Lee J. E., Wu S.-F., Goering L. M. and Dorsky R. I. (2006). Canonical Wnt signaling through Lef1 is required for hypothalamic neurogenesis. Development 133, 4451-4461. 10.1242/dev.02613 [DOI] [PubMed] [Google Scholar]
  25. Lee D. A., Bedont J. L., Pak T., Wang H., Song J., Miranda-Angulo A., Takiar V., Charubhumi V., Balordi F., Takebayashi H. et al. (2012). Tanycytes of the hypothalamic median eminence form a diet-responsive neurogenic niche. Nat. Neurosci. 15, 700-702. 10.1038/nn.3079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lowry W. E., Blanpain C., Nowak J. A., Guasch G., Lewis L. and Fuchs E. (2005). Defining the impact of beta-catenin/Tcf transactivation on epithelial stem cells. Genes Dev. 19, 1596-1611. 10.1101/gad.1324905 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lush M. E. and Piotrowski T. (2014). ErbB expressing Schwann cells control lateral line progenitor cells via non-cell-autonomous regulation of Wnt/beta-catenin. Elife 3, e01832 10.7554/eLife.01832 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. McGraw H. F., Drerup C. M., Culbertson M. D., Linbo T., Raible D. W. and Nechiporuk A. V. (2011). Lef1 is required for progenitor cell identity in the zebrafish lateral line primordium. Development 138, 3921-3930. 10.1242/dev.062554 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McPherson A. D., Barrios J. P., Luks-Morgan S. J., Manfredi J. P., Bonkowsky J. L., Douglass A. D. and Dorsky R. I. (2016). Motor behavior mediated by continuously generated dopaminergic neuron in the zebrafish hypothalamus recovers after cell ablation. Curr. Biol. 10.1016/j.cub.2015.11.064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Moro E., Ozhan-Kizil G., Mongera A., Beis D., Wierzbicki C., Young R. M., Bournele D., Domenichini A., Valdivia L. E., Lum L. et al. (2012). In vivo Wnt signaling tracing through a transgenic biosensor fish reveals novel activity domains. Dev. Biol. 366, 327-340. 10.1016/j.ydbio.2012.03.023 [DOI] [PubMed] [Google Scholar]
  31. Mosimann C., Kaufman C. K., Li P., Pugach E. K., Tamplin O. J. and Zon L. I. (2011). Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Development 138, 169-177. 10.1242/dev.059345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Munji R. N., Choe Y., Li G., Siegenthaler J. A. and Pleasure S. J. (2011). Wnt signaling regulates neuronal differentiation of cortical intermediate progenitors. J. Neurosci. 31, 1676-1687. 10.1523/JNEUROSCI.5404-10.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nusse R. (2008). Wnt signaling and stem cell control. Cell Res. 18, 523-527. 10.1038/cr.2008.47 [DOI] [PubMed] [Google Scholar]
  34. Otsuna H., Hutcheson D. A., Duncan R. N., McPherson A. D., Scoresby A. N., Gaynes B. F., Tong Z., Fujimoto E., Kwan K. M., Chien C.-B. et al. (2015). High-resolution analysis of CNS expression patterns in zebrafish Gal4 enhancer-trap lines. Dev. Dyn. 244, 785-796. 10.1002/dvdy.24260 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Perez M. R., Pellegrini E., Cano-Nicolau J., Gueguen M.-M., Menouer-Le Guillou D., Merot Y., Vaillant C., Somoza G. M. and Kah O. (2013). Relationships between radial glial progenitors and 5-HT neurons in the paraventricular organ of adult zebrafish - potential effects of serotonin on adult neurogenesis. Eur. J. Neurosci. 38, 3292-3301. 10.1111/ejn.12348 [DOI] [PubMed] [Google Scholar]
  36. Piccin D. and Morshead C. M. (2011). Wnt signaling regulates symmetry of division of neural stem cells in the adult brain and in response to injury. Stem Cells 29, 528-538. 10.1002/stem.589 [DOI] [PubMed] [Google Scholar]
  37. Pisharath H., Rhee J. M., Swanson M. A., Leach S. D. and Parsons M. J. (2007). Targeted ablation of beta cells in the embryonic zebrafish pancreas using E. coli nitroreductase. Mech. Dev. 124, 218-229. 10.1016/j.mod.2006.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Poschl J., Grammel D., Dorostkar M. M., Kretzschmar H. A. and Schüller U. (2013). Constitutive activation of beta-catenin in neural progenitors results in disrupted proliferation and migration of neurons within the central nervous system. Dev. Biol. 374, 319-332. 10.1016/j.ydbio.2012.12.001 [DOI] [PubMed] [Google Scholar]
  39. Qu Q., Sun G., Li W., Yang S., Ye P., Zhao C., Yu R. T., Gage F. H., Evans R. M. and Shi Y. (2010). Orphan nuclear receptor TLX activates Wnt/beta-catenin signalling to stimulate neural stem cell proliferation and self-renewal. Nat. Cell Biol. 12, 31-40; sup. pp 31-39 10.1038/ncb2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Robins S. C., Stewart I., McNay D. E., Taylor V., Giachino C., Goetz M., Ninkovic J., Briancon N., Maratos-Flier E., Flier J. S. et al. (2013). alpha-Tanycytes of the adult hypothalamic third ventricle include distinct populations of FGF-responsive neural progenitors. Nat. Commun. 4, 2049 10.1038/ncomms3049 [DOI] [PubMed] [Google Scholar]
  41. Sato N., Meijer L., Skaltsounis L., Greengard P. and Brivanlou A. H. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med. 10, 55-63. 10.1038/nm979 [DOI] [PubMed] [Google Scholar]
  42. Seib D. R. M., Corsini N. S., Ellwanger K., Plaas C., Mateos A., Pitzer C., Niehrs C., Celikel T. and Martin-Villalba A. (2013). Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell 12, 204-214. 10.1016/j.stem.2012.11.010 [DOI] [PubMed] [Google Scholar]
  43. Shikata Y., Okada T., Hashimoto M., Ellis T., Matsumaru D., Shiroishi T., Ogawa M., Wainwright B. and Motoyama J. (2011). Ptch1-mediated dosage-dependent action of Shh signaling regulates neural progenitor development at late gestational stages. Dev. Biol. 349, 147-159. 10.1016/j.ydbio.2010.10.014 [DOI] [PubMed] [Google Scholar]
  44. Shimizu N., Kawakami K. and Ishitani T. (2012). Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/beta-catenin signaling-reporter transgenic zebrafish. Dev. Biol. 370, 71-85. 10.1016/j.ydbio.2012.07.016 [DOI] [PubMed] [Google Scholar]
  45. Stoick-Cooper C. L., Weidinger G., Riehle K. J., Hubbert C., Major M. B., Fausto N. and Moon R. T. (2007). Distinct Wnt signaling pathways have opposing roles in appendage regeneration. Development 134, 479-489. 10.1242/dev.001123 [DOI] [PubMed] [Google Scholar]
  46. Than-Trong E. and Bally-Cuif L. (2015). Radial glia and neural progenitors in the adult zebrafish central nervous system. Glia 63, 1406-1428. 10.1002/glia.22856 [DOI] [PubMed] [Google Scholar]
  47. Varela-Nallar L. and Inestrosa N. C. (2013). Wnt signaling in the regulation of adult hippocampal neurogenesis. Front. Cell. Neurosci. 7, 100 10.3389/fncel.2013.00100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang X., Imura T., Sofroniew M. V. and Fushiki S. (2011). Loss of adenomatous polyposis coli in Bergmann glia disrupts their unique architecture and leads to cell nonautonomous neurodegeneration of cerebellar Purkinje neurons. Glia 59, 857-868. 10.1002/glia.21154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang X., Kopinke D., Lin J., McPherson A. D., Duncan R. N., Otsuna H., Moro E., Hoshijima K., Grunwald D. J., Argenton F. et al. (2012). Wnt signaling regulates postembryonic hypothalamic progenitor differentiation. Dev. Cell 23, 624-636. 10.1016/j.devcel.2012.07.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Weidinger G., Thorpe C. J., Wuennenberg-Stapleton K., Ngai J. and Moon R. T. (2005). The Sp1-related transcription factors sp5 and sp5-like act downstream of Wnt/beta-catenin signaling in mesoderm and neuroectoderm patterning. Curr. Biol. 15, 489-500. 10.1016/j.cub.2005.01.041 [DOI] [PubMed] [Google Scholar]
  51. Yeo S.-Y., Kim M., Kim H.-S., Huh T.-L. and Chitnis A. B. (2007). Fluorescent protein expression driven by her4 regulatory elements reveals the spatiotemporal pattern of Notch signaling in the nervous system of zebrafish embryos. Dev. Biol. 301, 555-567. 10.1016/j.ydbio.2006.10.020 [DOI] [PubMed] [Google Scholar]
  52. Zhang S., Li J., Lea R., Vleminckx K. and Amaya E. (2014). Fezf2 promotes neuronal differentiation through localised activation of Wnt/beta-catenin signalling during forebrain development. Development 141, 4794-4805. 10.1242/dev.115691 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Development (Cambridge, England) are provided here courtesy of Company of Biologists

RESOURCES