Abstract
The ability of hydrogen peroxide (H2O2) to increase paracellular permeability of renal epithelial cell monolayers was examined and the role of occludin in this regulation was investigated. H2O2 treatment increased the paracellular movement of calcein, a marker for the leak pathway permeability, across monolayers of two renal epithelial cell lines, MDCK and LLC-PK1, in a concentration-dependent manner. At the same concentrations, H2O2 did not alter transepithelial resistance (TER) nor increase cell death. The magnitude of the H2O2-induced increase in leak pathway permeability was inversely related to cellular occludin protein content. H2O2 treatment did not produce any major change in total cellular content or Triton X-100-soluble or –insoluble fraction content of occludin protein. Occludin protein staining at the tight junction region was diminished following H2O2 treatment. The most dramatic effect of H2O2 was on the dynamic mobility of GFP-occludin into the tight junction region. H2O2 treatment slowed lateral movement of GFP-occludin into the tight junction region but not on the apical membrane. Further, removal of the cytoplasmic C-terminal region of occludin protein eliminated the effect of H2O2 on GFP-occludin lateral movement into the tight junction region. An increase in the mobile fraction of GFP-occludin was associated with a loss of response to H2O2. These data indicate that the H2O2-induced increase in renal epithelial cell paracellular permeability is mediated, at least in part, through occludin protein, possibly through a slowing of the rate of occludin movement into the tight junction region.
Keywords: FRAP, HYDROGEN PEROXIDE, OCCLUDIN, RENAL EPITHELIAL CELL, TIGHT JUNCTION
Tight junctions are circumferential junctions joining adjacent epithelial cells at the apicolateral border. The tight junction forms the primary paracellular permeability barrier restricting the movement of solutes, water, toxins, and pathogens between epithelial cells across epithelial cell layers. It is a multiprotein complex comprised of membrane proteins, including claudins, occludin, and tricellulin, and multiple cytoplasmic proteins, including ZO-1, ZO-2, and cingulin (for reviews, see Shen et al., 2011; Szaszi and Amoozadeh, 2014). Paracellular permeability is divided into two pathways, the pore pathway characterized by the large capacity diffusion of small solutes and the leak pathway characterized by the small capacity diffusion of larger solutes.
Occludin protein has been suggested to be an important regulator of epithelial tight junction functional properties and their modulation by stimuli (see, e.g., Feldman et al., 2005; Rao, 2009; Cummins, 2012). Studies have demonstrated definitively a role for occludin protein in mediating baseline paracellular permeability of intestinal epithelial cells and renal epithelial cells by examining the effect of occludin protein knockdown or expression of mutant occludin protein on paracellular permeability parameters [Balda et al., 1996; Yu et al., 2005; Al-Sadi et al., 2011; Buschmann et al., 2013]. To date, the role of occludin protein in mediating the effect of different stimuli/manipulations on paracellular permeability is less well-defined. The ability of Tumor Necrosis Factor-α and interferon-γ to increase epithelial cell paracellular permeability required occludin protein expression in both intestinal epithelial cells [Buschmann et al., 2013] and renal epithelial cells [Van Itallie et al., 2010]. In contrast, modulation of renal epithelial cell paracellular permeability by src family kinase inhibitors was not dependent on the presence of occludin protein [Caswell et al., 2013]. These studies suggest that the role of occludin protein in mediating the effect of a stimulus on epithelial cell paracellular permeability may be dependent on both the specific stimulus and the specific cell type.
Breakdown of the renal paracellular permeability barrier contributes to pathogenesis of a number of disease states, such as renal ischemia/reperfusion injury [Kwon et al., 1998] and radiocontrast nephropathy [Cheung et al., 2008]. These disease states are associated with an increase in the renal tissue content of hydrogen peroxide, H2O2 [Haeussler et al., 2004; Devarajan, 2005]. Exposure of MDCK cell monolayers (a distal tubule-like renal epithelial cell line) to H2O2 increased paracellular permeability to small ions and/or large solutes [Meyer et al., 2001; Gonzalez et al., 2009; Yu et al., 2012], indicating that renal epithelial cells in culture may provide a model system in which to study the molecular events mediating the H2O2-induced increase in renal epithelial paracellular permeability. To date, changes in occludin protein content and/or subcellular localization have been correlated with the H2O2-induced increase in MDCK cell paracellular permeability [Meyer et al., 2001; Gonzalez et al., 2009; Yu et al., 2012] but a cause-effect relationship between occludin protein content and H2O2-induced changes in renal epithelial cell paracellular permeability has not been definitively demonstrated.
In the present study, we have tested directly the role of occludin protein in mediating the H2O2-induced increase in paracellular permeability of renal epithelial cells. The results demonstrate: (1) H2O2 treatment of renal epithelial cell monolayers at non-toxic concentrations increased the paracellular permeability to large solutes (leak pathway) without affecting the Transepithelial Resistance (TER) which usually reflects primarily the movement of small ions through the pore pathway; (2) Occludin protein knockdown enhanced the sensitivity and occludin overexpression diminished the sensitivity of MDCK cell monolayers to H2O2-induced changes in paracellular permeability; (3) H2O2 at concentrations that produced changes in paracellular permeability did not dramatically alter occludin protein content, distribution between detergent-soluble and -insoluble pools, or subcellular localization; (4) H2O2 treatment slowed the movement of GFP-occludin protein into the tight junction region without affecting the mobility of GFP-occludin protein outside of the tight junction region; and (5) This H2O2-induced slowing of GFP-occludin movement into the tight junction region was lost when the C-terminal region of occludin protein was deleted.
MATERIALS AND METHODS
REAGENTS
Antibodies for immunodetection were obtained from Life Technologies. The antibodies used in this study were: occludin C-terminal rabbit antibody (Cat. Number 404700), occludin rabbit antibody (Cat. Number 71-1500), horseradish peroxidase-conjugated goat anti-rabbit antibody (Cat. Number A-10547), and Alexa488-conjugated goat anti-rabbit antibody (Cat. Number A-11034). Rhodamine-Phalloidin was obtained from Life Technologies (Cat. Number A-12381).
CELL CULTURE
Stock cultures of renal epithelial cell lines (LLC-PK1/Cl4, MDCK, MDCK-occludin knockdown, and MDCK-occludin overexpressing) were maintained at a subconfluent density as described previously [Caswell et al., 2013]. All of the MDCK cell lines used in this study are Type II MDCK cell lines (low resistance). The parental MDCK cell line, MDCK-occludin knockdown cell line and MDCK-occludin over-expressing cell line were a gift from Dr. C. Van Itallie (NIHLB) and Dr. E.E. Schneeberger (Massachusetts General Hospital and Harvard Medical School). All MDCK cell lines were derived from the same parental MDCK cell line. The development and characterization of the occludin knockdown cell line is described in Yu et al. [2005]. The development and characterization of the occludin overexpressing cell line is described in Medina et al. [2000] and Van Itallie et al. [2010]. The LLC-PK1/Cl4 cell line used in these studies is a random subclone of the original LLC-PK1 cell strain [Amsler and Cook, 1985]. Cell cultures were checked for mycoplasma contamination upon thaw of a new stock vial and periodically thereafter (MycoAlert Mycoplasma Detection Kit, Lonza). All tests were uniformly negative. New stock cell populations were thawed after 15 passages.
Trypan Blue-exclusion of cell populations following 5 h treatment without or with H2O2 was performed as described previously [Caswell et al., 2013]. TUNEL assay was performed according to manufacturer’s instructions (Life Technologies). WST-1 assay was performed according to manufacturer’s instructions (Abcam).
PARACELLULAR PERMEABILITY
The paracellular permeability of renal epithelial cell monolayers to large solutes was determined using calcein as the solute and to small ions was determined by measuring TER as previously described [Caswell et al., 2013].
WESTERN BLOT ANALYSIS
Cell lysates were prepared from cell populations maintained under the same conditions as used for the measurement of paracellular permeability. Following 2 h treatment with varying concentrations of H2O2, a time point at which permeability was increased, lysates of total cell protein and Triton X-100-soluble and –insoluble fractions were prepared as previously described [Caswell et al., 2013]. Western blotting was performed as previously described [Caswell et al., 2013]. Occludin antibodies were used at a dilution range of 1:100–1:500. HRP-conjugated anti-rabbit antibody was used at a dilution of 1:10,000.
IMMUNOFLUORESCENCE MICROSCOPY
Cell populations grown on permeable membrane filters were treated without or with 55 μM H2O2 for 2 h and then fixed with 4% paraformaldehyde and processed for immunofluorescence microscopy as described previously [Caswell et al., 2013]. Cells were labelled either with occludin antibody followed by Alexa488-conjugated secondary antibody or with rhodamine-phalloidin. Occludin antibodies were used at a dilution range of 1:10–1:50. Alexa488-conjugated rabbit antibody was used at a dilution range of 1:100–1:500. Presented images are representative of at least three images obtained from at least two independent samples.
IMAGE ANALYSIS
Images were acquired and analyzed as described previously [Caswell et al., 2013].
ADENOVIRAL CONSTRUCT CLONING
Polymerase chain reaction (PCR) was employed to amplify full length hOccludin and a C-terminal truncated hOccludin from the EGFP-hOccludin construct (a gift from Dr. J.R. Turner) and to introduce restriction sites (KpnI and XbaI) using the following primers:
Full-Length hOccludin primers (1,500 bp)—Forward: TACAAGT-CCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACG-GTACCATGTCATCCAGGCCTCTTGA
Reverse: TGATCAGTTATCTAGATCCGGTGGATCCCGGGCCCGC-GGATAAATGTGTTCCTTGTCCCA
C-Terminal Truncated hOccludin primers (860 bp)—Forward: TACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCA-GTCGACGGTACCATGTCATCCAGGCCTCTTGA
Reverse: ACTAGATCTAGAGGTACCGGATCCTGTTTTCTGTCTAT-CATAGT
hOccludin constructs were ligated into the pAcGFP1-Hyg-C1 vector and expanded by transformation into DH5α cells. The full-length hOccludin-EGFP and the C-terminal truncated-hOccludin-EGFP coding sequences were isolated using and KpnI and XbaI restriction sites and were amplified by PCR using the following primers:
Full-Length hOccludin primers (2,500 bp)—Forward: AGATCTC-GAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCATGGTGAGCA-AGGGCGAGGAGCTG
Reverse: TGATCAGTTATCTAGATCCGGTGGATCCCGGGCCCGC-GGATAAATGTGTTCCTTGTCCCA
C-Terminal Truncated EGFP-hOccludin primers (1,500 bp)—Forward: AGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGG-TACCATGGTGAGCAAGGGCGAGGAGCTG
Reverse: ACTAGATCTAGAGGTACCGGATCCTGTTTTCTGTCTAT-CATAGT
Full-length hOccludin-EGFP and C-terminal truncated hOccludin-EGFP coding sequences were obtained using the KpnI and XbaI restriction sites and were cloned into the pAdEasy-1 adenoviral vector according to the manufacturer’s instructions (Agilent Technologies, catalog# 240010-12).
FLUORESCENCE RECOVERY AFTER PHOTOBLEACHING
Cell populations were seeded onto sterile 18 mm round cover glass pieces and placed in sterile 35 mm petri dishes. Cell populations were grown to and maintained at confluence for at least 7 days. Cell populations were transduced with an adenovirus containing full-length EGFP-hOccludin construct (pAdenovirus-hOccludin-FL-EGFP) at a 50:1 MOI. Transduced cells were serum starved overnight (αMEM, 2 mM L-glutamine, penicillin/streptomycin). FRAP experiments were performed 3–6 days after viral transduction. Transduced cell populations were treated with Ca-Mg-containing PBS ± 55 μM H2O2 for 2 hr at 37°C. Cells were then analyzed by FRAP. Cover slips containing cell populations were mounted onto a chamber and incubated in Ca-Mg-PBS maintained at 37°C. Cells were imaged using a Leica TCS SP5 inverted microscope with 63.0 × NA 1.40 oil-immersion objective. Data were collected and processed using Leica Microsystems LAS AF software. The tight junction region or a non-tight junction region of the apical membrane was selected for FRAP. The settings for the FRAP procedure were: Argon laser power = 5%; Leica-488 nm laser power = 5%–10%; pre-bleach—5 frames per 1.318 s; bleach—5 frames; post-bleach—1–5 frames per 1.318 s; post-bleach—2–20 frames per 5 s; post-bleach—3–40 frames per 10 s.
STATISTICAL ANALYSIS
Unless otherwise indicated, data are presented as mean ± standard deviation of at least three independent samples. Significance of difference between multiple groups was determined by one way ANOVA with subsequent contrast analysis using a t-test. Significance of difference between 2 samples was determined by one-tailed or two-tailed t-test. If data failed the Normality test, comparison of control and treated groups was performed by the Mann–Whitney U test. Significance was defined as P < 0.05.
RESULTS
HYDROGEN PEROXIDE TREATMENT INCREASES CALCEIN TRANSEPITHELIAL FLUX
The rate of calcein movement, a “leak” pathway marker [Caswell et al., 2013], across MDCK cell monolayers was increased by pretreatment of cell monolayers with hydrogen peroxide (H2O2) (Fig. 1a). There was no effect of 22 μM H2O2 but a statistically significant concentration-dependent increase in the movement of calcein was observed in MDCK cell monolayers treated with 44 μM H2O2 and above (P < 0.01 compared to 0 μM H2O2 calcein flux). A statistically significant H2O2 concentration-dependent increase in paracellular calcein flux was also observed with LLC-PK1 cells at H2O2 concentrations above 50 μM (Fig. 1b; P < 0.01). Treatment of MDCK or LLC-PK1 cell monolayers with H2O2 in the same concentration range did not alter significantly TER (Fig. 1c). Treatment of MDCK or LLC-PK1 cell monolayers with H2O2 in this concentration range for 5 h, the length of the pretreatment plus flux assay period, did not increase the number of Trypan Blue-positive cells in the cell populations (Fig. 1d). There was no significant increase in staining with the TUNEL assay (data not shown) or the WST-1 assay (data not shown). As expected, markedly higher H2O2 concentrations were toxic to both MDCK cells and LLC-PK1 cells (data not shown). Thus, at low concentrations, H2O2 treatment of renal epithelial cell monolayers increased paracellular permeability via the “leak” pathway.
OCCLUDIN PROTEIN CONTENT MODULATES THE ABILITY OF H2O2 TO INCREASE “LEAK” PATHWAY PERMEABILITY
Previous work has implicated occludin protein in mediating the ability of cytokines to modulate paracellular permeability [Van Itallie et al., 2010], although occludin protein was not always required to modulate paracellular permeability [Caswell et al., 2013]. To assess the involvement of occludin protein in mediating the H2O2-induced enhancement of “leak” pathway permeability, the response to H2O2 was compared in wild type MDCK cell monolayers and in monolayers of MDCK cells in which occludin protein was either over-expressed or knocked-down. Measurement of the effect of varying H2O2 concentrations on calcein flux across the three cell lines was performed in a single experiment to ensure that the cell lines were examined under identical conditions. As shown above, H2O2 treatment of wild type MDCK cell monolayers produced a concentration-dependent enhancement of calcein paracellular flux (Fig. 2a). In monolayers of MDCK cells overexpressing occludin, the response to H2O2 was substantially attenuated (Fig. 2b). Conversely, in monolayers of MDCK cells in which occludin protein expression was knocked-down, the response to H2O2 was markedly increased (Fig. 2c). To visualize the relative effect of different H2O2 concentrations on calcein flux in the different MDCK cell lines, the fold change in calcein flux rate for each H2O2 concentration compared to 0 μM H2O2 was calculated for each cell line (Fig. 2d). The statistical significance of the difference between the responsiveness of either the occludin overexpressing or the occludin knockdown MDCK cell line compared to the wild type MDCK cell line was confirmed using two different approaches, i.e., by comparing calcein flux curves as a function of H2O2 concentration and cell line (P < 0.001 for all comparisons) or by comparing the amount of calcein in the apical chamber for each flux time point as a function of H2O2 concentration and cell line (P < 0.05 for all time points beyond 30 min). H2O2 treatment did not alter the TER of any of the cell lines (Fig. 2e). In our hands, occludin protein knockdown did produce a small but statistically significant decrease in TER compared to wild type MDCK cells and occludin protein overexpressing MDCK cells (wild type MDCK – 69 ± 7 Ω-cm2 (n = 12), occludin overexpressing MDCK – 70 ± 10 Ω-cm2 (n = 12; P > 0.86 versus wild type MDCK), occludin knockdown MDCK – 50±6 Ω-cm2 (n = 12; P < 0.001 versus wild type MDCK)). The expected occludin protein content in the three cell lines was confirmed by Western blot analysis (see Caswell et al., 2013). H2O2 at the concentrations used in these experiments did not produce a statistically significant increase in cell death in any of the MDCK cell lines (P > 0.1 compared to 0 μM H2O2 for wild type MDCK cells and occludin overexpressing MDCK cells; data not shown). For occludin knockdown MDCK cells, there was also no significant increase in cell death although in cell populations treated with 66 μM H2O2 there was a non-significant trend towards a small increase in cell death (P > 0.1 for 44 μM and 55 μM H2O2 and P = 0.07 for 66 μM H2O2; data not shown). These results are consistent with our observation that H2O2-induced cytotoxicity in renal epithelial cells is typically observed near to or above 70 μM H2O2.
H2O2 DOES NOT DRAMATICALLY ALTER OCCLUDIN PROTEIN CONTENT OR DISTRIBUTION
Previous studies have reported that occludin protein content and/or localization was altered by treatment of epithelial cells with compounds that increase paracellular permeability, including with H2O2 [Basuroy et al., 2003; Watson et al., 2005; Gonzalez et al., 2009]. We, therefore, examined whether or not treatment with H2O2 at the concentrations that increase “leak” pathway permeability also produced changes in occludin protein content and/or localization. First, the effect of H2O2 treatment on total occludin protein content and content in the Triton X-100-soluble fraction versus the Triton X-100-insoluble fraction were examined. Treatment of MDCK cell monolayers with 55 μM H2O2 for 2 h, a time point at which the change in “leak” pathway permeability is observed, did not alter significantly the occludin protein content in the total cell lysate, the Triton X-100-soluble fraction, or the Triton X-100-insoluble fraction (Fig. 3). The presence of 3 bands in the total cell lysate but not in either the Triton X-100-soluble or -insoluble lysates was not a consistent observation. The intensity of each band in the total cell lysate was not, however, altered by H2O2 treatment. Equal amounts of cell lysate protein were loaded in each lane, as confirmed by the equal signal strength for ERK 1/2 protein content in each lane (Fig. 3).
To assess the possibility that H2O2 treatment altered the subcellular distribution of occludin protein, occludin protein was localized by immunofluorescence confocal microscopy in untreated MDCK cells and in MDCK cells treated with 55 μM H2O2 for 2 h (Fig. 4–Occludin). The cell images were divided into thirds along the Z axis to yield an apical section, a middle section, and a basal section. In untreated MDCK cell monolayers (0 μM H2O2), occludin protein staining in the apical section was most prominent as a continuous line surrounding each cell, consistent with localization of occludin protein to the tight junction region of every cell in the monolayer (Fig. 4–Occludin/0 μM H2O2). The intracellular nuclear staining observed in these immunofluorescence images may reflect the previously reported presence of nuclear occludin [Runkle et al., 2011] or may be non-specific. In either case, the nuclear occludin staining was not demonstrably affected by treatment with H2O2. In the middle section, the occludin protein was also detected as a continuous line surrounding each cell. Somewhat brighter staining puncta within the continuous line were observed at many tricellular/multicellular junctions. Little occludin protein was detected in the basal region of the cells except for the nuclear staining. A similar pattern of occludin protein staining in each section was observed in the cell populations treated with 55 μM H2O2 with two differences. First, the intensity of the linear staining appeared somewhat weaker in the 55 μM H2O2-treated cell populations (Fig. 4–Occludin/55 μM H2O2) compared to the control cell populations. This was most evident when comparing occludin staining in the middle sections. Second, the relative staining intensity of the puncta at the tricellular/multicellular junctions compared to the bicellular linear staining intensity appeared to be somewhat stronger in the H2O2-treated cell populations compared to control cell populations.
Since the tight junction is connected to the F-actin cytoskeleton, we compared the occludin protein localization to that of F-actin using rhodamine-phalloidin (Fig. 4–F-Actin). In untreated cell populations, F-actin staining in the apical section exhibited a velveteen appearance along the apical surface of each cell, typical of the staining of the F-actin cores of apical microvilli (F-Actin/0 μM H2O2). A somewhat brighter linear staining surrounded each cell. The central dark area observed on some cells likely represents the location of the central cilium. The primary staining in the middle section was a broad linear staining surrounding each cell consistent with the cortical actin ring. The basal section exhibited streaks of staining consistent with basally-oriented stress fibers. F-Actin staining in the 55 μM H2O2-treated cell populations was similar in all sections. A modest decrease in stress fiber density was often, but not always observed.
Merging the occludin protein and F-actin images for each section (Fig. 4–Merge) reveals two differences between the untreated and 55 μM H2O2-treated populations that are most evident in the middle sections. First, the colocalization of occludin protein and F-actin at the tight junction region (yellow color) is more pronounced in the untreated cell populations than in the 55 μM H2O2-treated cell populations. Second, there is a broadening and, perhaps, even splitting of some of the bright puncta of colocalized occludin protein and F-actin staining at the tricellular junctions of the 55 μM H2O2-treated cell populations (white arrows).
H2O2 SLOWS THE MOVEMENT OF OCCLUDIN PROTEIN INTO THE TIGHT JUNCTION
Using the FRAP technique, recent work has demonstrated that tight junction proteins, including occludin protein, exhibit dynamic movement into and out of the tight junction region of cultured epithelial cells [Shen et al., 2009; Buschmann et al., 2013; Raleigh et al., 2013]. We examined the effect of H2O2 treatment on the FRAP behavior of occludin protein by expressing full-length GFP-occludin in MDCK cell monolayers. Expression of full-length GFP-occludin protein was confirmed by Western blot analysis (Fig. 5a) and fluorescence microscopy (Fig. 5b). In untreated MDCK cell monolayers expressing GFP-occludin, photobleaching of a region of the tight junction was followed by a progressive recovery of GFP fluorescence into the photobleached area (Fig. 5b). Analysis of the fluorescence recovery curve for the photobleached area (Fig. 5c) yields the two parameters, the t1/2 (the time to recover 50% of the maximal recovered fluorescence) and the Percent Immobile Fraction (the percentage of expressed GFP-occludin that is not free to move). For the presented experiment on untreated MDCK cells (Fig. 5c – 0 μM H2O2), these values are t1/2 = 42.54 s and Percent Immobile Fraction = 35%. The FRAP procedure was performed on multiple replicates of untreated MDCK cell monolayers and results were compared to fluorescence recovery in multiple replicates of MDCK cell monolayers treated with 55 μM H2O2 for 2 h (Fig. 5c – 55 μM H2O2). The t1/2 for the presented trace of MDCK cells treated with 55 μM H2O2 is 77.8 s and the Percent Immobile Fraction is 39%. The average values obtained from the multiple replicates are shown in Table I. Compared to untreated MDCK cell monolayers, treatment with H2O2 increased significantly the t1/2 for GFP-occludin fluorescence recovery into the tight junction region without affecting significantly the Percent Immobile Fraction. Higher H2O2 concentrations produced progressively greater increases in the t1/2 without affecting the Percent Immobile Fraction significantly (data not shown).
TABLE I.
[H2O2] (μM) | Recovery halftime (t1/2)(s) | Immobile fraction (%) | Number of replicates (n) | |
---|---|---|---|---|
Full-length GFP-occludin | 0 | 51.45 ± 10.53 | 45.7 ± 8.1 | 10 |
55 | 77.57 ± 10.57** | 36.6 ± 13.7 | 16 | |
Truncated GFP-occludin | 0 | 56.27 ± 18.74 | 27.2 ± 15.0 | 42 |
55 | 61.16 ± 18.24 | 25.3 ± 9.1 | 37 |
FRAP analysis was performed on post-confluent MDCK cell populations expressing either full-length GFP-occludin protein or C-terminal-truncated GFP-occludin protein. Prior to FRAP analysis, cell populations were treated without or with 55 μM H2O2 for 2 h. Derived parameters, t1/2 and % Immobile Fraction, were calculated for each experiment. Results are presented as mean ± SD of derived parameters for the indicated number of independent experiments. Results are representative of studies using at least three separate cell populations.
P < 0.05 compared to 0 μM H2O2
P < 0.01 compared to 0 μM H2O2.
To determine if this effect of H2O2 was due to a general perturbation of membrane protein mobility, we examined the FRAP behavior for GFP-occludin protein present on the apical membrane, away from the tight junction region, in untreated and 55 μM H2O2-treated MDCK cell monolayers. Representative traces of fluorescence recovery of full-length GFP-occludin within the apical membrane of untreated and H2O2-treated MDCK cell monolayers are shown (Fig. 5d). The data indicate that treatment with H2O2 had no significant effect on either the t1/2 or the Percent Immobile Fraction for full-length GFP-occludin protein expressed on the apical membrane (Table II). Even at higher H2O2 concentrations, there was no effect on the t1/2 of GFP-occludin moving within the apical membrane (data not shown). Interestingly, the Percent Immobile Fraction for full-length GFP-occludin moving within the apical membrane was significantly smaller than the Percent Immobile Fraction for full-length GFP-occludin moving into the tight junction (P < 0.001). These results argue that the observed effect of H2O2 on full-length GFP-occludin t1/2 is specific for movement of GFP-occludin into the tight junction region.
TABLE II.
[H2O2] (μM) | Recovery halftime (t1/2) (s) | Immobile fraction (%) | Number of replicates (n) |
---|---|---|---|
0 | 51.68 ± 18.23 | 28 ± 11 | 12 |
55 | 45.21 ± 21.11 | 34 ± 17 | 13 |
FRAP analysis was performed on post-confluent MDCK cell populations expressing full-length GFP-occludin protein. Prior to FRAP analysis, cell populations were treated without or with 55 μM H2O2 for 2 h. Derived parameters, t1/2 and % Immobile Fraction, were calculated for each experiment. Results are presented as mean ± SD of derived parameters for the indicated number of independent experiments. Results are representative of studies using at least two separate cell populations.
P < 0.05 compared to 0 μM H2O2
P < 0.01 compared to 0 μM H2O2
The occludin protein C-terminal tail region contains multiple interaction domains and potential phosphorylation sites that may be important in the regulation of paracellular permeability (for reviews, see Feldman et al., 2005; Rao, 2009; Cummins, 2012). To determine if this region is required for the observed H2O2-dependent slowing of full-length GFP-occludin movement into the tight junction region, we constructed a mutant GFP-occludin protein in which the entire C-terminal region was deleted. Expression of C-terminal truncated GFP-occludin protein was confirmed by Western blot analysis (Fig. 5a) and fluorescence microscopy (data not shown). The ability of H2O2 to slow the dynamic movement of this mutant GFP-occludin protein into the tight junction region was assessed. In contrast to the slowing of full-length GFP-occludin protein, H2O2 treatment for 2 hr had no significant effect on either the t1/2 or Percent Immobile Fraction of the C-terminal truncated GFP-occludin protein (Table I). Representative traces of fluorescence recovery for C-terminal truncated GFP-occludin are shown (Fig. 5e). Higher H2O2 concentrations also did not affect the t1/2 or Percent Immobile Fraction of C-terminal truncated GFP-occludin protein movement into the tight junction (data not shown). The Percent Immobile Fraction of C-terminal truncated GFP-occludin moving into the tight junction region was significantly smaller than the Percent Immobile Fraction of full-length occludin moving into the tight junction region (P < 0.001). The Percent Immobile Fractions for full-length GFP-occludin moving within the apical membrane and for C-terminal truncated GFP-occludin moving into the tight junction region were not significantly different (P = 0.285).
DISCUSSION
Our results confirm previous studies demonstrating that treatment with H2O2 increases paracellular permeability of renal epithelial cells [Collares-Buzato et al., 1998; Meyer et al., 2001; Gonzalez et al., 2009; Yu et al., 2012] and other cell types [Rao et al., 1997; Takenaga et al., 2009; Caraballo et al., 2011]. We have demonstrated that H2O2 treatment increases leak pathway permeability of renal epithelial cells without markedly affecting pore pathway permeability. Some previous studies examining the effects of H2O2 on MDCK renal epithelial cells, one of the renal epithelial cell lines used in our studies, reported parallel increases in permeability via both the leak and pore pathways [Gonzalez et al., 2009; Yu et al., 2012]. Studies from the Rao group report increases in both pore and leak pathway permeability upon treatment of Caco-2 intestinal epithelial cells with H2O2 [Rao et al., 2001; Basuroy et al., 2003; Basuroy et al., 2006]. This difference in H2O2 effects on the pore versus leak pathways may reflect technical differences between the studies and/or cell type differences in responsiveness to H2O2. For example, multiple differences between renal and intestinal cell regulation of tight junction permeability have been reported [Jepson, 2003; Shen et al., 2011; Caswell et al., 2013; unpublished data].
A role for occludin protein in mediating/regulating paracellular permeability is still controversial. Yu et al. [2010] reported that occludin knockdown did not affect steady state pore pathway permeability of MDCK cells or the permeability of large solutes but did increase permeability of moderate-sized solutes (3.6–7.2Å – a range spanning the shift from pore to leak pathway; Watson et al. [2001]). Van Itallie et al. [2010] reported no effect of occludin knockdown in MDCK cells on either pore or leak pathways. Al-Said et al. [2011] reported that partial knockdown of occludin in Caco-2 intestinal epithelial cells did not affect pore pathway permeability but increased leak pathway permeability. In contrast, Buschmann et al. [2013] reported that more extensive occludin knockdown in Caco-2 cells increased both pore and leak pathway permeability. In our hands, knockdown of occludin protein in MDCK cells did not markedly affect basal leak pathway permeability despite >90% decrease in expression of occludin protein. We did observe a modest but statistically significant increase in pore pathway permeability with occludin protein knockdown.
The focus of this study was to examine the involvement of occludin protein in the H2O2-induced increase in renal epithelial cell paracellular permeability. Our results demonstrate directly that occludin protein content affects the sensitivity of MDCK cell paracellular permeability to H2O2. This is in contrast to the lack of effect of manipulation of occludin protein content on the ability of src Family Kinase inhibitors to increase renal epithelial cell paracellular permeability [Caswell et al., 2013]. Many previous studies using a variety of epithelial cell types have correlated changes in occludin protein content and/or subcellular localization with changes in paracellular permeability produced by different stimuli [Rao et al., 2001; Bruewer et al., 2004; Sabath et al., 2008; Gonzalez et al., 2009; Caraballo et al., 2011; Yu et al., 2012]. We were unable to detect a marked change in either occludin protein content or occludin protein distribution between detergent-soluble and -insoluble fractions. This suggests that a major change in occludin protein organization state is not necessary to produce a change in paracellular permeability, at least via the leak pathway.
In this study, we demonstrate that H2O2-induced changes in paracellular permeability of renal epithelial cells were correlated with changes in the rate of lateral movement of occludin protein into the tight junction region. This effect of H2O2 was concentration dependent, was not observed for GFP-occludin protein movement into areas outside of the tight junction, and required the cytoplasmic C-terminal tail region of occludin protein. Shen et al. [2009] first demonstrated that tight junction proteins, including occludin protein, exhibited dynamic movement into and out of the tight junction region of MDCK cells. The shorter half-time for recovery of GFP-occludin fluorescence into the tight junction region measured in our study (~50 s) compared to that reported by Shen et al. [2009; ~200 s] is consistent with their finding that the measured t1/2 decreased with the length of time the cells were maintained at confluence.
Our studies indicate that H2O2 treatment of MDCK cell monolayers slowed the movement of GFP-occludin protein into the tight junction region, increasing the t1/2 from ~50 s (control) to ~80 s (55 μM H2O2). Treatment with 110 μM H2O2 increased the t1/2 further (data not shown). Treatment of Caco-2BBe cell monolayers with tumor necrosis factor (TNF), which increases paracellular permeability of Caco-2BBe cells, accelerated the movement of GFP-occludin into the tight junction [Buschmann et al., 2013]. This was correlated with a dissociation of GFP-occludin protein from the tight junction region following TNF treatment. Raleigh et al. [2013] reported that inhibition of CK2-dependent phosphorylation of occludin protein on S408 in Caco-2BBe cells increased TER and, in parallel, decreased the occludin protein mobile fraction without altering the t1/2 for occludin protein. Thus, increased paracellular permeability can be associated with either an increased or a decreased mobility of occludin protein into the tight junction. While seemingly at odds, these results may be reconciled by the possibility that changes in steady state conditions of the tight junction, either by increasing or decreasing occludin protein mobility into the junction, could disrupt junctional integrity leading to increased paracellular permeability. Alternatively, the different results obtained with Caco-2BBe (intestinal) versus MDCK (renal) cells could reflect cell type-specific differences in tight junction regulation, as have been reported previously [see, e.g., Jepson, 2003; Shen et al., 2011; Caswell et al., 2013]. The lack of H2O2 effect on mobility of GFP-occludin protein in the plane of the apical membrane away from the tight junction indicates that H2O2 is affecting selectively movement of GFP-occludin into the tight junction region, supporting a role for this action in the H2O2-induced regulation of paracellular permeability. The inability of H2O2 to alter the mobility of C-terminal truncated GFP-occludin protein also supports this hypothesis since the C-terminal region contains multiple interaction and phosphorylation domains implicated in mediating regulation of paracellular permeability [see, e.g., Cummins, 2012; Buschmann et al., 2013; Doerfel et al., 2013; Raleigh et al., 2013].
In our study, the manipulations that eliminated the ability of H2O2 to increase the t1/2 for occludin movement into the tight junction region, C-terminal truncation and movement within the apical membrane, also increased the accessible mobile fraction of occludin protein. The effect of C-terminal truncation on occludin protein mobile fraction is consistent with the findings of Buschmann et al. [2013] who reported a similar increase in occludin protein mobile fraction in intestinal epithelial cells when the OCEL domain, the distal portion of the C-terminal domain from aa 416-522, was deleted. The OCEL domain contains the ZO-1 binding site as well as multiple phosphorylation sites [Feldman et al., 2005; Li et al., 2005; Rao, 2009; Cummins, 2012]. Raleigh et al. [2011] reported that CK2-dependent phosphorylation of occludin on S408 increased the occludin protein mobile fraction and weakened the interaction of occludin with ZO-1. Since three different conditions that weaken or eliminate the interaction of occludin with ZO-1 increase the occludin protein mobile fraction, it is tempting to speculate that the extent of interaction of occludin protein with ZO-1 protein is a significant determinant of the percentage of occludin protein able to move into the tight junction.
ACKNOWLEDGMENTS
The authors would like to thank the following people for excellent technical assistance: Wai Man, Victoria Rohring, Nikita Shah, Nancy Singh, and Angelina Voronina. The authors would like to thank Dr. C. Van Itallie (NIHLB) and Dr. E.E. Schneeberger (Massachusetts General Hospital and Harvard Medical School) for providing the occludin knockdown and occludin overexpressing MDCK cells lines. The authors would like to thank Dr. Jerrold R. Turner (University of Chicago) for providing the pEGFP-hOccludin construct.
Grant sponsor: NIDDK; Grant number: R15-DK-091749-01A1.
Footnotes
Conflict of Interest: The authors declare no conflict of interest.
REFERENCES
- Al-Sadi R, Khatib K, Guo S, Ye D, Youssef M, Ma T. Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier. Am J Physiol. 2011;300:G1054–G1064. doi: 10.1152/ajpgi.00055.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amsler K, Cook JS. Linear relationship of phlorizin-binding capacity and hexose uptake during differentiation in a clone of LLC-PK1 cells. J Cell Physiol. 1985;122:254–258. doi: 10.1002/jcp.1041220214. [DOI] [PubMed] [Google Scholar]
- Balda MS, Whitney JA, Flores C, Gonzalez S, Cereijido M, Matter K. Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. J Cell Biol. 1996;134:1031–1049. doi: 10.1083/jcb.134.4.1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Basuroy S, Sheth P, Kuppuswamy D, Balasubramanian S, Ray RM, Rao RK. Expression of kinase-inactive c-src delays oxidative stress-induced disassembly and accelerates calcium-mediated reassembly of tight junctions in the Caco-2 cell monolayer. J Biol Chem. 2003;278:11916–11924. doi: 10.1074/jbc.M211710200. [DOI] [PubMed] [Google Scholar]
- Basuroy S, Seth A, Elias B, Naren AP, Rao R. MAPK interacts with occludin and mediates EGF-induced prevention of tight junction disruption by hydrogen peroxide. Biochem J. 2006;393:69–77. doi: 10.1042/BJ20050959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bruewer M, Hopkins AM, Hobert ME, Nusrat A, Madara JL. RhoA, Rac1, and Cdc42 exert distinct effects on epithelial barrier via selective structural and biochemical modulation of junctional proteins and F-actin. Am J Physiol. 2004;287:C327–C335. doi: 10.1152/ajpcell.00087.2004. [DOI] [PubMed] [Google Scholar]
- Buschmann MM, Shen L, Rajapakse H, Raleigh DR, Wang Y, Wang Y, Lingaraju A, Zha J, Abbott E, McAuley EM, Breskin LA, Wu L, Anderson K, Turner JR, Weber CR. Occludin OCEL-domain interactions are required for maintenance and regulation of the tight junction barrier to macromolecular flux Molec Biol Cell. 2013;24:3056–3068. doi: 10.1091/mbc.E12-09-0688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Caraballo JC, Yshii C, Butti ML, Westphal W, Borcherding JA, Allamargot C, Comellas AP. Hypoxia increases transepithelial electrical conductance and reduces occludin at the plasma membrane in alveolar epithelial cells via PKC-z and PP2A pathway. Am J Physiol. 2011;300:L569–L578. doi: 10.1152/ajplung.00109.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Caswell D, Jaggi S, Axis J, Amsler K. src Family kinases regulate renal epithelial paracellular permeability through an occludin-independent mechanism. J Cell Physiol. 2013;228:1210–1220. doi: 10.1002/jcp.24274. [DOI] [PubMed] [Google Scholar]
- Cheung CM, Ponnusamy A, Anderton JG. Management of acute renal failure in the elderly patient: A clinician’s guide. Drugs Aging. 2008;25:455–476. doi: 10.2165/00002512-200825060-00002. [DOI] [PubMed] [Google Scholar]
- Collares-Buzato CB, Jepson MA, Simmons NL, Hirst BH. Increased tyrosine phosphorylation causes redistribution of adherens junction and tight junction proteins and perturbs paracellular barrier function in MDCK epithelia. Eur J Cell Biol. 1998;76:85–92. doi: 10.1016/S0171-9335(98)80020-4. [DOI] [PubMed] [Google Scholar]
- Cummins PM. Occludin: One protein, many forms. Molec Cell Biol. 2012;32:242–250. doi: 10.1128/MCB.06029-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Devarajan P. Cellular and molecular derangements in acute tubular necrosis. Curr Opin Pediatr. 2005;17:193–199. doi: 10.1097/01.mop.0000152620.59425.eb. [DOI] [PubMed] [Google Scholar]
- Doerfel MJ, Westphal JK, Bellmann C, Krug SM, Cording J, Mittag S, Tauber R, Fromm M, Blasig IE, Huber O. CK2-dependent phosphorylation of occludin regulates the interaction with ZO-proteins and tight junction integrity. Cell Commun Signal. 2013;11:40. doi: 10.1186/1478-811X-11-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feldman GJ, Mullin JM, Ryan MP. Occludin: Structure, function and regulation. Adv Drug Deliv Rev. 2005;57:883–917. doi: 10.1016/j.addr.2005.01.009. [DOI] [PubMed] [Google Scholar]
- Gonzalez JE, DiGeronimo RJ, Arthur DE, King JM. Remodeling of the tight junction during recovery from exposure to hydrogen peroxide in kidney epithelial cells. Free Rad Biol Med. 2009;47:1561–1569. doi: 10.1016/j.freeradbiomed.2009.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haeussler U, Riedel M, Keller F. Free reactive oxygen species and nephrotoxicity of contrast agents. Kidney Blood Press Res. 2004;27:167–171. doi: 10.1159/000079805. [DOI] [PubMed] [Google Scholar]
- Jepson MA. Disruption of epithelial barrier function by H2 O2: Distinct responses of Caco-2 and Madin-Darby canine kidney (MDCK) strains. Cell Mol Biol (Noisy-le-grand) 2003;49:101–112. [PubMed] [Google Scholar]
- Kwon O, Nelson WJ, Sibley R, Huie P, Scandling JD, Dafoe D, Alfrey E, Myers BD. Backleak, tight junctions, and cell-cell adhesion in postischemic injury to the renal allograft. J Clin Invest. 1998;101:2054–2064. doi: 10.1172/JCI772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Fanning AS, Anderson JM, Lavie A. Structure of the conserved cytoplasmic C-terminal domain of occludin: Identification of the ZO-1 binding surface. J Mol Biol. 2005;352:151–164. doi: 10.1016/j.jmb.2005.07.017. [DOI] [PubMed] [Google Scholar]
- Medina R, Rahner C, Mitic LL, Anderson JM, Van Itallie CM. Occludin localization at the tight junction requires the second extracellular loop. J Membr Biol. 2000;178:235–247. doi: 10.1007/s002320010031. [DOI] [PubMed] [Google Scholar]
- Meyer TN, Schwesinger C, Ye J, Denker BM, Nigam SJ. Reassembly of the tight junction after oxidative stress depends on tyrosine kinase activity. J Biol Chem. 2001;278:22048–22055. doi: 10.1074/jbc.M011477200. [DOI] [PubMed] [Google Scholar]
- Raleigh DR, Boe DM, Yu D, Weber CR, Marchiando AM, Bradford EM, Wang Y, Wu L, Schneeberger EE, Shen L, Turner JR. Occludin S408 phosphorylation regulates tight junction protein interactions and barrier function. J Cell Biol. 2011;193:565–582. doi: 10.1083/jcb.201010065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rao RK, Baker RD, Baker SS, Gupta A, Holycross M. Oxidant-induced disruption of intestinal epithelial barrier function: Role of protein tyrosine phosphorylation. Am J Physiol. 1997;273:G812–G823. doi: 10.1152/ajpgi.1997.273.4.G812. [DOI] [PubMed] [Google Scholar]
- Rao RK, Basuroy S, Rao VU, Karnaky KJ, Gupta A. Tyrosine phosphorylation and dissociation of occludin-ZO-1 and E-cadherin-b-catenin complexes from the cytoskeleton by oxidative stress. Biochem J. 2001;368:471–481. doi: 10.1042/BJ20011804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rao R. Occludin phosphorylation in regulation of epithelial tight junctions. Ann NY Acad Sci. 2009;1165:62–68. doi: 10.1111/j.1749-6632.2009.04054.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Runkle EA, Sundstrom JM, Runkle KB, Liu X, Antonetti DA. Occludin localizes to centrosomes and modifies mitotic entry. J Biol Chem. 2011;286:30847–30858. doi: 10.1074/jbc.M111.262857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sabath E, Negoro H, Beaudry S, Paniagua M, Angelow S, Shah J, Grammatikakis N, Yu ASL, Denker BM. Ga12 regulates protein interactions within the MDCK cell tight junction and inhibits tight-junction assembly. J Cell Sci. 2008;121:814–824. doi: 10.1242/jcs.014878. [DOI] [PubMed] [Google Scholar]
- Shen L, Weber CR, Turner JR. The tight junction protein complex undergoes rapid and continuous molecular remodeling at steady state. J Cell Biol. 2009;181:683–695. doi: 10.1083/jcb.200711165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shen L, Weber CR, Raleigh DR, Yu D, Turner JR. Tight junction pore and leak pathways: A dynamic duo. Annu Rev Physiol. 2011;73:283–309. doi: 10.1146/annurev-physiol-012110-142150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Szaszi K, Amoozadeh Y. New insights into functions, regulation, and pathological roles of tight junctions in kidney tubular epithelium. Internat Rev Cell Molec Biol. 2014;308:205–271. doi: 10.1016/B978-0-12-800097-7.00006-3. [DOI] [PubMed] [Google Scholar]
- Takenaga Y, Takagi N, Murotomi K, Tanonaka K, Takeo S. Inhibition of src activity decreases tyrosine phosphorylation of occludin in brain capillaries and attenuates increase in permeability of the blood-brain barrier after transient focal cerebral ischemia. J Cerebr Blood Flow Metab. 2009;29:1099–1108. doi: 10.1038/jcbfm.2009.30. [DOI] [PubMed] [Google Scholar]
- Van Itallie CM, Fanning AS, Holmes J, Anderson JM. Occludin is required for cytokine-induced regulation of tight junction barriers. J Cell Sci. 2010;123:2844–2852. doi: 10.1242/jcs.065581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watson CJ, Rowland M, Warhurst G. Functional modeling of tight junctions in intestinal cell monolayers using polyethylene glycol oligomers. Am J Physiol. 2001;281:C388–C397. doi: 10.1152/ajpcell.2001.281.2.C388. [DOI] [PubMed] [Google Scholar]
- Watson CJ, Hoare CJ, Garrod DR, Carlson GL, Warhurst G. Interferon-g selectively increases epithelial permeability to large molecules by activating different populations of paracellular pores. J Cell Sci. 2005;118:5221–5230. doi: 10.1242/jcs.02630. [DOI] [PubMed] [Google Scholar]
- Yu ASL, McCarthy KM, Francis SA, McCormack JM, Lai J, Rogers RA, Lynch RD, Schneeberger EE. Knockdown of occludin expression leads to diverse phenotypic alterations in epithelial cells. Am J Physiol. 2005;288:C1231–C1241. doi: 10.1152/ajpcell.00581.2004. [DOI] [PubMed] [Google Scholar]
- Yu D, Marchiando AM, Weber CR, Raleigh DR, Wang Y, Shen L, Turner JR. MLCK-dependent exchange and actin binding region-dependent anchoring of ZO-1 regulate tight junction barrier function. Proc Natl Acad Sci USA. 2010;107:8237–8241. doi: 10.1073/pnas.0908869107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu W, Beaudry S, Negoro H, Boucher I, Tran M, Kong T, Denker BM. H2O2 activates G protein, a12 to disrupt the junctional complex and enhance ischemia reperfusion injury. Proc Natl Acad Sci USA. 2012;109:6680–6685. doi: 10.1073/pnas.1116800109. [DOI] [PMC free article] [PubMed] [Google Scholar]