Development of a Specific Diagnostic System for Detecting Turnip Yellow Mosaic Virus from Chinese Cabbage in Korea

Abstract

Turnip yellow mosaic virus (TYMV) is a plant pathogenic virus transmitted mainly through its host Brassica spp. TYMV is originated from Europe. Its infection cases have been reported in Australia, Brazil, Turkey, and Japan. Symptoms similar to those of TYMV infections were also reported in Korea in 2012. In this study, we developed RT-PCR primer pairs that were highly sensitive for detecting TYMV. The developed RT-PCR primer pairs offered about 10–100 times stronger detection sensitivity compared to primer pairs previously used in Korea. As a result, a 491 bp TYMV-specific band was identified. The specific band was confirmed to be TYMV based on sequencing results and phylogenetic analysis. The RT-PCR primer pairs developed in this study can be used to rapidly and precisely diagnose TYMV in agricultural products such as Chinese cabbage and other crops infected by TYMV.

Electronic supplementary material

The online version of this article (doi:10.1007/s12088-015-0557-1) contains supplementary material, which is available to authorized users.

Introduction

Turnip yellow mosaic virus (TYMV) is a plant pathogenic virus. It was first reported in 1949. TYMV is known to be vectored by insects such as leaf flea beetles and seeds [1, 2]. According to Descriptions of Plant Viruses and Plant Viruses Online, TYMV is mainly infecting host Brassica spp. However, many other hosts with more than 20 species including Reseda odorata have been reported to have TYMV. It is distributed mainly in Europe. Recently, TYMV infections have been reported in Australia, Japan, Brazil, and Turkey, etc. One study has been conducted to compare the entire sequences of European and Australian TYMV isolates [3]. In addition, physicochemical studies, bionanoparticles, in vitro translation, replication complexes, encapsidation of recombinant TYMV, and identification using Raman spectroscopy have been performed on TYMV [4–9].

In Korea, symptoms similar to those of TYMV infection were reported in Chinese cabbages grown in Chungcheongnam-do and Chungcheongbuk-do in 2012. Therefore, TYMV was nominated as a target virus by Pest Information System regulated by the Korean Agricultural and Livestock Quarantine Center. In addition, TYMV like symptoms were reported nationwide in Chinese cabbages, lettuces, shepherds’ purses, canola, and radishes of Korea. Therefore, the Korean Rural Development Administration (RDA) promoted the use of sound Chinese cabbage seeds and other viable seeds to prevent the spread of TYMV diseases that could be caused by leaf flea beetles. Crucifers including weeds surrounding the occurrence areas were removed in order to limit the spreading. TYMV is also potential quarantine virus in Korea for imported crops. Since user-based RT-PCR diagnosis system was introduced, various viruses have been detected at the quarantine sites [10–17]. However, inspection method for TYMV has not been clarified.

In this study, a TYMV RT-PCR primer pair was developed under the same conditions as in quarantine sites. The sensitivity of this primer pair was compared to the sensitivity with other RT-PCR primer pairs previously used by RDA of Korea. In addition, the applicability of this method was verified using hosts and vectors of viruses responsible for TYMV like symptoms raged in some areas in Jeolla-do in 2012.

Total RNAs of TYMV and reference viruses [Andean potato latent tymovirus (APLV) and Poinsettia mosaic tymovirus (PnMV)] were purchased from Bi-One (Korea). Primer3 program was used to establish the same inspection conditions as in quarantine sites [14]. Accordingly, 19 TYMV-specific primer sets were designed in forward and reverse directions (Table 1). TYMV-specific primers were used to combine fourteen RT-PCR primer pairs with amplified fragment at more than 400 nucleotides (Supplementary Table S1).

Table 1.

Information on the specific primers for the detection of TYMV

Primer	Sequence (5′ → 3′)	Start location based on NC_004063
Forward
TYMV_SLF1	AGCTCTCTTTTGACAACTGG	19
TYMV_SLF2	CACCTATACCAGAGCAGTCC	1039
TYMV_SLF3	CCCTATCCTCTCCTTCCTAA	1279
TYMV_SLF4	ACTGCTCCACAAACTGTTCT	1681
TYMV_SLF5	CTCGAAAGTTCAACCTCAAC	2012
TYMV_SLF6	CCACCTTGAATTGTCTTCTC	2430
TYMV_SLF7	ACCACTACCTTGACACCAAC	2967
TYMV_SLF8	AGACATATCCGATCCAACAG	3039
TYMV_SLF9	CCCTCAAAATGAAGAGACTG	4898
TYMV_SLF10	GGAATCACTCTGGGTCACTA	5876
Reverse
TYMV_SLR1	TAGTGACCCAGAGTGATTCC	5875
TYMV_SLR2	AGTTGTCCAGGACGATTATG	3616
TYMV_SLR3	AGGTAAGAGATGAGGCATGA	3529
TYMV_SLR4	GCTGTGAATTTGGAAGAGTC	3438
TYMV_SLR5	GTTGGTGTCAAGGTAGTGGT	2967
TYMV_SLR6	CTTTACAACTTCCAGGCAAC	3438
TYMV_SLR7	GTTGTGGAAGATGGTTTGAT	2410
TYMV_SLR8	AGAACAGTTTGTGGAGCAGT	1681
TYMV_SLR9	TCTGGGACGTAGTGAAGAGT	680

Total RNA was reverse-transcribed at 42 °C for 30 min. PCR was performed at 95 °C for 1 min followed by 35 cycles of 95 °C for 45 s, 55 °C for 1 min, and 72 °C for 1 min with a final extension at 75 °C for 5 min [16]. PCR products (4 µl) were subjected to 1.2 % agarose gel electrophoresis. Primer pairs TYMV N10 (5′-TTT CCA CCC TCA CCA CCT TCT ACC-3′) and C20 (5′-TGA GCG GTG ATG GAG ATG AGG AGT-3′) developed by RDA in Korea were used for the positive control primer to generate a product of 304 bp. To select the optimal TYMV-specific RT-PCR primer pairs, specific bands were investigated in a TYMV RNA matrix with fourteen combinations. Specific bands were formed in RT-PCR primer pairs 1, 3, 7, 8, 9, 10, 11, 12, 13, and 14, but not in pairs 2, 4, 5, and 6. Therefore, pairs 2, 4, 5, and 6 were excluded whereas pairs 1, 3, 7, 8, 9, 10, 11, 12, 13, and 14 were selected (Fig. 1). These 10 pairs of TYMV-specific RT-PCR primers were used to detect two different tymoviruses (APLV and PnMV). However, the attempt was unsuccessful (data not shown). Therefore, detection sensitivity tests were performed using the 10 selected primer pairs and the primer pairs developed by RDA. Total RNA concentration of TYMV was 363.2 ng/μl. It was diluted up to 10-7 for RT-PCR. RDA-developed primer pair had a sensitivity of 10^-5. The sensitivities of primer pair 1, 3, 7, 8, 9, 10, 11, 12, 13, and 14 were 10⁻⁵–10⁻⁶, 10⁻⁵, 10⁻⁵–10⁻⁶, 10⁻⁶–10⁻⁷, 10⁻⁵, 10⁻⁵, 10⁻⁶–10⁻⁷, 10⁻⁴–10⁻⁵, 10⁻⁵–10⁻⁶, 10⁻⁵, respectivley (Fig. 2). Primer pairs 8 (491 bp) and 11 (419 bp) offered the highest detection sensitivity at 10⁻⁶–10⁻⁷. Primer pair 8 was selected as the final TYMV-specific RT-PCR primer pair because its PCR product was relatively longer and beneficial for encoding (Table 2). RT-PCR product (491 bp) of primer pair 8 coded replicase/papain-like protease (location 95–5629 bp, NC_004063).

Fig. 1.

Specific selection of RT-PCR primer pair for detecting Turnip yellow mosaic virus. Lane M, 100 bp step DNA Ladder maker (Genepia, Korea); lane 1–14, RT-PCR primer pair for detecting TYMV; lane PC-p, Positive control primer pair (Rural development administration in Korea, 304 bp); lane NC, negative control

Fig. 2.

Sensitivity test of specific RT-PCR primer pairs for detecting TYMV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane NC, negative control

Table 2.

RT-PCR primer pair selected for the detection of Turnip yellow mosaic virus

RT-PCR primer		Sequence (5′–3′)	Length (nt)	Product size (bp)
Pair	Name
8	TYMV_SLF7	ACCACTACCTTGACACCAAC	20	491
	TYMV_SLR4	GCTGTGAATTTGGAAGAGTC	20

Disease symptoms similar to those of TYMV infections were found in Chinese cabbages, shepherds’ purses, and lettuces grown in Jeolla-do in 2012. A total of 39 experimental samples (Chinese cabbage, shepherd’s purse, lettuce, and insect) of viruses responsible for TYMV-like symptoms were collected (Supplementary Table S2). Total RNAs were extracted from these specimens using RNA-spin™ IIP RNA extraction kit (iNtRON, Korea) followed by RT-PCR using primer pair 8 (TYMV_SLF7 and TYMV_SLR4) developed in this study. PCR bands were gel-purified and submitted to Macrogen company limited (Korea) for sequencing using ABI3730XL automated sequencer (Applied Biosystems, USA). PHYDIT ver.3.1 [18] was used to analyze the similarities among TYMV gene sequences. A phylogenetic tree was constructed to investigate their relationships. Sequence listings from NCBI, TYMV, APLV, and PnMV were collected. Sequence of wheat streak mosaic virus isolate Czech (AF454454) was included as out-group. These sequences were multiple-aligned using BioEdit ver.7.1.3.0 (Supplementary Fig. S2) [19]. The alignment was used to construct neighbor-joining (Jukes and Canter distance model) and maximum-likelihood (Tamura-Nei distance model) trees using MEGA ver.6 [20] to analyze their relationships.

A total of 39 experimental samples (Chinese cabbage, shepherd’s purse, lettuce, and insect) of viruses responsible for TYMV-like symptoms were collected from Jeolla-do (Supplementary Table S2). Samples were performed RNA extraction and diagnostic RT-PCR in this study (Supplementary Fig. S1). Sequencing analysis revealed that these bands shared 93.0–95.0 % sequence identities with TYMV Blue Lake isolate complete genome (X16378), TYMV genome (X07441), and TYMV Club Lake isolate complete genome (KJ690173). In addition, they shared 97.0–100.0 % sequence identities with TYMV genomic isolates detected in this study. Based on the phylogenetic analysis results, these TYMV genomic isolates detected in this study were confirmed to be TYMVs. These genomic isolates of TYMV were found to be related to TYMV complete genome (X16378) and the TYMV genome (X07441) (Fig. 3).

Fig. 3.

Neighbor-joining (NJ) tree showing the phylogenetic position of samples based on Tymovirus sequence. Evolutionary distances were computed using Jukes and Cantor model. Closed circle indicated that the corresponding branches were also recovered in the NJ/Maximum likelihood using Tamura-Nei model. Bootstrap values (>50 %) based on 1000 replications are shown. Bar 0.2 nucleotide substitutions per nucleotide position

TYMV is potential quarantine virus in Korea. Quarantine should be carried out for imported crops. The Korean Agricultural and Livestock Quarantine Center had classified viruses into prohibited-, controlled-, and regulated- quarantine viruses according to the pest risk analysis system. Currently, imported plants are quarantined and disposed of if prohibited viruses are detected in the quarantine process. If TYMV is nominated as a controlled- or regulated- quarantine virus, imported crops with potential TYMV infections such as Chinese cabbages must go through the quarantine process.

The RT-PCR primers developed in this study can be used to rapidly detect TYMV from agricultural products such as Chinese cabbages with high sensitivity. This diagnostic method can be used in future quarantine inspections. In addition, sequencing and phylogenetic tree can be used as reference to analyze TYMV relationships.