LETTER
Norovirus infections cause acute gastroenteritis and are a major cause of foodborne and nosocomial outbreaks (1). The marked genetic diversity of emerging norovirus genotypes requires the continuous update of generic molecular diagnostic methods, which should exclude false-negative results in gastroenteritis outbreaks.
In 2009, we published a protocol for a multiplexed norovirus one-step real-time TaqMan reverse transcription (RT)-PCR for stool and vomit with a sensitivity of 2.8 × 104 virus genome equivalents/ml and 100% specificity (2). The multiplex method makes possible the discrimination between genogroup I (GI) and GII/IV. In 2013, our diagnostic laboratory participated in the first German proficiency testing (INSTAND) for norovirus, resulting in a failure in one of four specimens. Further testing of this specimen by a nested-PCR protocol (3) and sequencing identified norovirus GI.9 (4). This norovirus GI.9 sequence was deposited in GenBank (accession no. KJ675587).
Primer and probe sequences of the diagnostic real-time RT-PCR (2) were revised with the help of a multiple-sequence alignment (Fig. 1) of all human-pathogenic genotypes, including GI.9 and the recently described GII.17 strain (4–10). Therefore, the previous primers NoV-for1 and Nov-for2.2 were modified to NoV-for1B, TGGCAGGCCATGTTCCGCTGGATG, and NoV-for2.2B, CAAGAGGCCATGTTTAGGTGGATG, respectively. The NoV-probe1 was modified to NoV-probe1B, hexachloro-6-carboxyfluorescein–TCGGGCAGGAGATTGCGATCTCCTGTCCA–6-carboxytetramethylrhodamine. Except for the revised primer and probe sequences, the RT-PCR was performed as described previously (2). The melting temperatures for the revised primer and probe sequences for all genotypes were analyzed by using the MeltCalc software (10) and confirmed by amplification and detection of 15 representative genotype specimens with low and thus critical melting temperatures (Table 1).
FIG 1.
Multiple alignment (ClustalW) depicting sequences of all human norovirus genotypes and the PCR primers and probes. Represented genotypes and accession numbers are indicated on the left. Dots indicate identity to the direct primer/probe sequence above. The sequences of the reverse primer and probes are displayed as the reverse complement for easy comparison to the plus-strand norovirus sequence. Positions refer to the reference Norwalk virus sequence (accession number M87661).
TABLE 1.
Calculated melting temperatures of primers and probes for the interaction with norovirus genotype sequences
| Genotype (GenBank no.) | Tm (°C) for indicated primer/probe | ||
|---|---|---|---|
| NoV-for1B | NoV-probe1B | NoV-rev | |
| GI.1 (M87661) | 64.1 | 59.8 | 48.5 |
| GI.2a (L07418) | 51.3 | 66.0 | 48.5 |
| GI.3a (U04469) | 64.1 | 61.7 | 48.5 |
| GI.4 (AJ313030) | 57.1 | 66.0 | 48.5 |
| GI.5 (AB039774) | 57.3 | 66.0 | 48.5 |
| GI.6a (AY502007) | 51.2 | 60.3 | 48.5 |
| GI.7a (JN899243) | 57.6 | 59.0 | 48.5 |
| GI.8a (GU299761) | 64.1 | 59.4 | 48.5 |
| GI.9a (KJ675587) | 57.6 | 58.1 | 48.5 |
| NoV-for2.1 | NoV-probe2 | NoV-rev | |
| GII.1 (U07611) | 44.1 | 68.6 | 53.0 |
| GII.2a (X81879) | 39.2 | 63.2 | 53.0 |
| GII.4a (X86557) | 51.9 | 68.6 | 53.0 |
| GII.5 (AF397156) | 51.9 | 68.6 | 53.0 |
| GII.10 (AF504671) | 46.0 | 68.6 | 53.0 |
| GII.12 (AB039775) | 51.9 | 68.6 | 48.8 |
| GII.13 (JX439807) | 42.5 | 67.1 | 53.0 |
| GII.16a (AY502006) | 37.1 | 68.6 | 53.0 |
| GII.17 (AY502009) | 37.1 | 68.6 | 53.0 |
| GII.17a (LC043305) | 42.2 | 68.6 | 53.0 |
| GII.20 (EU424333) | 33.3 | 65.7 | 53.0 |
| GII.21a (JN899245) | 42.5 | 68.6 | 53.0 |
| NoV-for2.2B | NoV-probe2 | NoV-rev | |
| GII.3a (AB039781) | 43.1 | 68.6 | 53.0 |
| GII.6 (AB039778) | 56.3 | 59.8 | 53.0 |
| GII.7 (AF414409) | 53.1 | 59.8 | 53.0 |
| GII.8a (AB039780) | 39.5 | 65.7 | 53.0 |
| GII.9 (AY038599) | 56.3 | 59.8 | 53.0 |
| GII.13 (GU969058) | 46.4 | 59.8 | 53.0 |
| GII.14 (GU017908) | 46.4 | 59.8 | 53.0 |
| GII.15a (AB360387) | 39.5 | 65.7 | 44.1 |
| NoV-for4 | NoV-probe2 | NoV-rev | |
| GIV.1a (AF414426) | 51.0 | 39.0 | 48.8 |
| GIV.1a (AF414427) | 41.5 | 39.0 | 48.8 |
Genotype tested positive by the improved PCR protocol.
The revised protocol was validated with 127 diagnostic specimens. Clinical sensitivity and specificity were both 100% compared to those of the former protocol, with 94 positive specimens (81 positive for GII/IV, 13 positive for GI) and 33 negative specimens. Additionally, 32 proficiency testing specimens (INSTAND and QCMD) from 2011 to 2013 were tested retrospectively and gave the anticipated results (including the GI.9 specimen). The mean CT (threshold cycle) values decreased significantly in comparison to those of the former protocol, i.e., for GI, from 34.0 to 31.8 (P = 0.0071), and for GII/IV, from 30.3 to 25.5 (P < 0.0001), indicating improved detection of norovirus RNA (Fig. 2).
FIG 2.
Decreased CT values of the improved norovirus PCR protocol indicate enhanced detection of norovirus RNA. One hundred sixteen positive diagnostic and proficiency testing specimens were tested in both assay protocols (scatter plot; horizontal lines depict the mean, paired t test).
Serial dilutions (27 replicates) of in vitro-transcribed RNA were tested to determine the limit of detection (LOD; 95% probability) by using Probit analysis (SPSS v15.0). The LODs of the revised protocol were also found to be improved in comparison to those of the former PCR protocol (2): 32.9 (GI.3) and 5.6 (GII.4) genome equivalents per reaction, which are equivalent to 2.3 × 103 (95% confidence interval [CI95%], 1.8 × 103 to 3.4 × 103) and 4 × 102 (CI95%, 2.7 × 102 to 1.2 × 103) genome equivalents per ml of stool suspension (approximately 10% [vol/vol]), respectively.
As a control for extraction and inhibition, all specimens were spiked with and tested for mengovirus with a CT value of 35 (11). Only 31 (2.4%) of 1,287 specimens (stool and vomit from hospitalized patients with gastroenteritis) were found to be inhibited (failure of mengovirus detection), 278 were positive for GII/IV, 12 were positive for GI, and 966 were negative.
In conclusion, the improved multiplex real-time RT-PCR assay holds promise to detect all current human-pathogenic norovirus genotypes in diagnostic specimens.
ACKNOWLEDGMENTS
We thank S. Niendorf (Consultant Laboratory for Noroviruses, Robert-Koch-Institute) for providing samples and S. Hübner and S. Flucht for technical assistance.
REFERENCES
- 1.Matthews JE, Dickey BW, Miller RD, Felzer JR, Dawson BP, Lee AS, Rocks JJ, Kiel J, Montes JS, Moe CL, Eisenberg JN, Leon JS. 2012. The epidemiology of published norovirus outbreaks: a review of risk factors associated with attack rate and genogroup. Epidemiol Infect 140:1161–1172. doi: 10.1017/S0950268812000234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Henke-Gendo C, Harste G, Juergens-Saathoff B, Mattner F, Deppe H, Heim A. 2009. New real-time PCR detects prolonged norovirus excretion in highly immunosuppressed patients and children. J Clin Microbiol 47:2855–2862. doi: 10.1128/JCM.00448-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Schreier E, Doring F, Kunkel U. 2000. Molecular epidemiology of outbreaks of gastroenteritis associated with small round structured viruses in Germany in 1997/98. Arch Virol 145:443–453. doi: 10.1007/s007050050038. [DOI] [PubMed] [Google Scholar]
- 4.Nenonen NP, Hannoun C, Larsson CU, Bergstrom T. 2012. Marked genomic diversity of norovirus genogroup I strains in a waterborne outbreak. Appl Environ Microbiol 78:1846–1852. doi: 10.1128/AEM.07350-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zheng DP, Ando T, Fankhauser RL, Beard RS, Glass RI, Monroe SS. 2006. Norovirus classification and proposed strain nomenclature. Virology 346:312–323. doi: 10.1016/j.virol.2005.11.015. [DOI] [PubMed] [Google Scholar]
- 6.Kroneman A, Vega E, Vennema H, Vinje J, White PA, Hansman G, Green K, Martella V, Katayama K, Koopmans M. 2013. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol 158:2059–2068. doi: 10.1007/s00705-013-1708-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hansman GS, Biertumpfel C, Georgiev I, McLellan JS, Chen L, Zhou T, Katayama K, Kwong PD. 2011. Crystal structures of GII.10 and GII.12 norovirus protruding domains in complex with histo-blood group antigens reveal details for a potential site of vulnerability. J Virol 85:6687–6701. doi: 10.1128/JVI.00246-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Matsushima Y, Ishikawa M, Shimizu T, Komane A, Kasuo S, Shinohara M, Nagasawa K, Kimura H, Ryo A, Okabe N, Haga K, Doan YH, Katayama K, Shimizu H. 2015. Genetic analyses of GII.17 norovirus strains in diarrheal disease outbreaks from December 2014 to March 2015 in Japan reveal a novel polymerase sequence and amino acid substitutions in the capsid region. Euro Surveill 20(26):pii=21173. [DOI] [PubMed] [Google Scholar]
- 9.de Graaf M, van Beek J, Vennema H, Podkolzin AT, Hewitt J, Bucardo F, Templeton K, Mans J, Nordgren J, Reuter G, Lynch M, Rasmussen LD, Iritani N, Chan MC, Martella V, Ambert-Balay K, Vinje J, White PA, Koopmans MP. 2015. Emergence of a novel GII.17 norovirus—end of the GII.4 era? Euro Surveill 20(26):pii=21178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Schutz E, von Ahsen N. 1999. Spreadsheet software for thermodynamic melting point prediction of oligonucleotide hybridization with and without mismatches. BioTechniques 27:1218–1222, 1224. [DOI] [PubMed] [Google Scholar]
- 11.Costafreda MI, Bosch A, Pinto RM. 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Appl Environ Microbiol 72:3846–3855. doi: 10.1128/AEM.02660-05. [DOI] [PMC free article] [PubMed] [Google Scholar]