Skip to main content
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2016 Feb 9.
Published in final edited form as: Acta Univ Ups Symb Bot Ups. 2014;37(1):1–87.

Molecular systematics of the wood-inhabiting, lichen-forming genus Xylographa (Baeomycetales, Ostropomycetidae) with eight new species

Toby Spribille 1,2,*, Philipp Resl 1, Teuvo Ahti 3, Sergio Pérez-Ortega 4, Tor Tønsberg 5, Helmut Mayrhofer 1, H Thorsten Lumbsch 6
PMCID: PMC4747110  EMSID: EMS66975  PMID: 26953522

Abstract

The ascomycete genus Xylographa includes some of the most abundant species of wood-inhabiting lichenized fungi in boreal and temperate regions. It has never been monographed and little is known of its species diversity and evolutionary relationships. Based on a morphological and secondary metabolite-based assessment of material from North and South America, Europe and Asia, we generated a three-locus phylogeny based on sequences of the internal transcribed spacer, 28S nuclear rDNA and mitochondrial small subunit rDNA. We analyzed the data within the context of putatively related genera in the order Baeomycetales. Xylographa is a strongly supported monophyletic group closely related to Lithographa and Ptychographa, as well as rock-dwelling and lichenicolous species of Rimularia s.lat. The evolution of linearized ascomata in Xylographa appears to have enabled ascomata to grow laterally, and patterns of lateral growth are diagnostic. We recognize twenty species in Xylographa and provide a thorough revision of nomenclature. The following eight species are new: Xylographa bjoerkii T. Sprib., X. constricta T. Sprib., X. erratica T. Sprib., X. lagoi T. Sprib. & Pérez-Ortega, X. schofieldii T. Sprib., X. septentrionalis T. Sprib., X. stenospora T. Sprib. & Resl and X. vermicularis T. Sprib. The combinations Lambiella insularis (Nyl.) T. Sprib. and Xylographa carneopallida (Räsänen) T. Sprib. are newly proposed. Xylographa constricta from southern South America represents the first known case of secondary de-lichenization in the Baeomycetales. Xylographa parallela s.str. is confirmed as bipolar on the basis of sequenced collections from both southern Chile and the northern Hemisphere.

Keywords: Ascomycota, biodiversity, evolution, Fungi, lignicolous, phylogenetics, saproxylic, taxonomy

Introduction

Fungal-algal symbioses, also known as lichens, are thought to have arisen between two and four times in total, almost all involving fungal partners from the Ascomycota that were ancestrally saprobic (Gargas et al. 1995; Lutzoni et al. 2001; Prieto & Wedin 2013; Schoch et al. 2009). Reversions to saprobic lifestyles from lichens are however much more common than de novo lichenization in the fungal tree of life (Lutzoni et al. 2001). Lichens experienced a massive evolutionary radiation within Pezizomycotina in Lecanoromycetes (Miadlikowska et al. 2006), branching into two main groups: Lecanoromycetidae, including most recent macrolichens; and Ostropomycetidae, a group of several thousand described species from all latitudes, nearly all of which form small, crustose thalli (Lumbsch et al. 2007a). Within Lecanoromycetes the Ostropomycetidae can be considered a hub of secondary de-lichenization, with saprobic lifestyles notably in Agyrium (Pertusariales; Lumbsch et al. 2001, 2007b) and two families of the Ostropales, Odontotremataceae and Stictidaceae, the latter radiating into scores of species, including endophytic and saproxylic fungi (Sherwood 1977; Schoch et al. 2006; Baloch et al. 2010). Furthermore, at least some ostensibly lichenized members of this group exhibit a non-obligate association with algae (Wedin et al. 2004) and a degree of substrate specificity suggesting substrate involvement in the primary carbon metabolism (Spribille et al. 2008).

The Ostropomycetidae are very unequally studied, with detailed phylogenetic studies in Ostropales (Baloch et al. 2010; Rivas Plata & Lumbsch 2011; Rivas Plata et al. 2013) as well as on phylogenetics and character state development in Pertusariales (Schmitt & Lumbsch 2004; Schmitt et al. 2006; Lumbsch et al. 2006) The order Baeomycetales is by contrast undersampled, and even the higher level classification of this group remains unsettled. The 18 genera assigned to this order by Lumbsch & Huhndorf (2011) feature a wide spectrum of character innovation ranging from stalked ascomata to appressed and linear, simple to branched, laterally growing ascomata. Baeomycetales also harbour genera with levels of obligate substrate affinity anomalous in the ostensibly autotrophic lichen symbiosis, suggesting carbon metabolisms that go beyond fungal-algal interactions. Molecular evolutionary studies in Baeomycetales have focused mainly on the genus Placopsis (Schmitt et al. 2003a).

This study targets one of the widespread groups of fungi in the Baeomycetales associated with lignum, the genus Xylographa. Unlike the large majority of Lecanoromycetes which have round ascomata, Xylographa belongs to a small group of genera which form linear ascomata, sometimes called lirellae or hyster(i)othecia (Lumbsch 1997). In the Lecanoromycetes, similar ascomata can otherwise be found in Lithographa and Ptychographa, two genera postulated to be close to Xylographa (Lumbsch 1997), as well as in Graphidaceae (subclass Ostropomycetidae: Lumbsch 1997, Lumbsch et al. 2007a,b; Mangold et al. 2008), and in Elixia and Xylopsora in subclass Umbilicariomycetidae (Bendiksby & Timdal 2013). They are also known from Opegraphaceae, Arthoniomycetes (Ertz et al. 2009, Ertz & Tehler 2011) and in distantly related ascolocularous fungi of the Dothideomycetes (Mugambi & Huhndorf 2009). Like many of these groups, Xylographa species have poorly developed lichenized thalli. More than most lichenized fungi at high latitudes, Xylographa exhibits high substrate specialism for wood (Spribille et al. 2008). The obscurity of the algal affinity and the strong wood association were enough that the earliest Xylographa species were classified among non-lichenized cup fungi within the then broadly defined genera Hysterium (Persoon 1796) or Stictis (Fries 1822). The core genus Xylographa and subsequently described family Xylographaceae (Tuckerman 1888, currently not recognized) were only gradually circumscribed as a group: no single paper has been dedicated to the taxonomy of Xylographa. Altogether, between seven and ten species are now commonly recognized. Vainio (1883, 1909) and later Räsänen (in Vainio 1921, Räsänen 1939) were among the first to recognize additional species diversity in Xylographa in Finland and what is now Russian Karelia, but none of these species are recognized today. Nearly seventy years passed before the genus was again taken up for critical review by Bruce Ryan in the preparation of the Sonoran lichen flora, a treatment published posthumously (Ryan 2004a). The poor state of knowledge in Xylographa is further reflected in the fact that up until very recently only a single isolate from the genus was represented in GenBank.

Our treatment has three specific aims: 1) to identify clades and develop a phylogenetic circumscription of the genus and its species using molecular and morphological characters; 2) to recircum-scribe known taxa with recognizable characters and establish a new classification; and 3) to identify potential adaptive traits over the Xylographa phylogeny to provide a basis for future evolutionary hypothesis testing.

Material and methods

The study was initiated with a set of ca. 200 specimens mainly from western North America from the study of Bunnell et al. (2008), after it became clear that prevailing species concepts in Xylographa did not account for the range of diversity encountered. In the absence of an existing morphology-based monograph and without knowing a priori which characters are most diagnostic, we adopted a strategy of “recursive sampling”, essentially testing ad hoc hypotheses of species recognition. This involved 1) screening material using thin layer chromatography and basic morphology into candidate species, 2) sampling candidates using the internal transcribed spacer (ITS) rDNA barcoding marker and/or mitochondrial small subunit (mtSSU) rDNA, 3) returning to the material and adjusting concepts based on available sequence data and 4) when necessary, sampling new material for DNA to test our species predictions. We later added fresh material from other geographical regions for a total of 90 isolates, of which a subset of mostly multilocus-sequenced individuals are used for the present study.

DNA acquisition

Taxon sampling focused on the genus Xylographa and all available putatively related genera of Baeomycetales. Specifically, all species of Xylographa for which fresh material was available were sampled for DNA isolation. We also sampled fresh material of potentially closely related genera including Lithographa, Ptychographa and Rimularia and included these within a set of other related outgroup taxa of Trapeliaceae, Hymeneliaceae, Baeomycetaceae and Icmadophilaceae mostly obtained from GenBank. We excluded Lignoscripta, described by Ryan (2004b), which is only distantly related and will be treated elsewhere (Spribille & Resl in ed.). The only available DNA sequences for Xylographa from GenBank were downloaded and aligned with our present data set. In total 103 isolates were used for the present study (Table 1). We did not design the taxon sampling to address broader-level questions regarding family circumscription or the monophyly of Baeomycetales, and use that name here in the broad sense. Hodkinson & Lendemer (2011) recently proposed segregating from the Baeomycetales the family Trapeliaceae, based on a triangulation from several large-scale phylogenetic studies, and erected for it the new order Trapeliales. Multilocus data are scarce compared to the total number of taxa currently ascribed to this group, however, and it remains unclear if a close relationship of Trapeliaceae to Baeomycetaceae can be ruled out.

Table 1.

Material used for the molecular portion of this study, with GenBank accession numbers. Isolate reference refers to lab isolates in Graz (all numbers between 800 and 1200 and any numbers starting with P) and Chicago (numbers of the 2000 series).

Isolate Ref Species Geographical provenance Voucher specimen Original publication ITS mtSSU 28S
1088 Ainoa mooreana SWEDEN. Jämtland Nordin 7455 (UPS) here KJ462262 KJ462394 KJ462339
1089 A. mooreana JAPAN. Nagano Prefecture Thor 28340 (UPS) here KJ462263 KJ462395 KJ462340
A. mooreana CZECH REPUBLIC. Palice 5156 (hb. Palice) Schmitt et al. (2003a) - AY212850 AY212828
P78 Baeomyces rufus U.S.A. Alaska, Glacier Bay NP, Shag Cove Spribille 36414 (GZU) here KJ462264 KJ462396 KJ462341
P79 Dibaeis baeomyces U.S.A. Alaska, Glacier Bay NP, Dundas Bay Spribille 38948 (GZU) here KJ462265 KJ462397 KJ462342
Hymenelia lacustris SWEDEN. Wedin 6876 (UPS) Wedin et al. (2005) - AY853323 AY853371
1046 H. melanocarpa CANADA. Yukon, La-Biche area, Mt. Martin Spribille 28350-B (GZU) here KJ462266 KJ462398 KJ462343
P81 Icmadophila ericetorum U.S.A. Alaska, Glacier Bay NP, Bartlett Cove Spribille 36042 (GZU) here KJ462267 KJ462399 KJ462344
1091 Lambiella insularis U.S.A. Montana, Missoula Co., Salmon Lake Spribille s.n., 07/09/2012 (GZU) here KJ462268 KJ462400 KJ462345
L. psephota AUSTRALIA. Kantvilas 335/00 (HO) Lumbsch et al. (2007b) - DQ871019 DQ871012
Lithographa tesserata SWEDEN. Värmland Muhr, 1988 (UPS) Lumbsch et al. (2001) AF274079 - -
P95 L. tesserata U.S.A. Alaska, Glacier Bay NP, Dundas Bay Spribille 38950 (GZU) here KJ462269 - KJ462346
Phyllobaeis erythrella COSTA RICA. San Jose, Los Santo Forest Reserve DUKE-0047957 (AFTOL-ID 329) Miadlikowska et al. (2006) - DQ986888 DQ986780
P. imbricata COSTA RICA. San Jose, “at km 70” DUKE-0047750 (AFTOL-ID 852) Miadlikowska et al. (2006) HQ650635 DQ986895 DQ986781
Placopsis kerguelensis [FRANCE OVERSEAS TERR.] Île Kerguelen Poulsen 456 (C) Poulsen et al. (2001); Schmitt et al. (2003a) AY212813 AF381561 AF274116
P. macrophthalma [FRANCE OVERSEAS TERR.] Crozet Island (US 9303) Schmitt et al. (2003a) AY212824 AY212866 AY212844
P. rhodophthalma [FRANCE OVERSEAS TERR.] Crozet Island (US 9398) Schmitt et al. (2003a) AY212821 - AY212838
1 Placynthiella icmalea FINLAND. S. Huhtinen 05/15 (TOR) Stenroos et al. (2010) EU940236 EU940300 EU940160
2 P. icmalea GERMANY. Rheinland-Pfalz Lumbsch 12059a (hb. Lumbsch) Lumbsch et al. (2001) AF274082 AY212870 AY212846
P. uliginosa FINLAND. Uusimaa: Kirkkonummi, Porkkala, Vetokannas Stenroos 5679 (DUKE) (AFTOL-ID 1365) Miadlikowska et al. (2006) HQ650633 DQ986877 DQ986774
Ptychographa xylographoides U.S.A. Oregon. Lane Co., H. J. Andrews Exp. For.* McCune 25338 (OSC) Schmitt et al. (2003a) - AY212872 -
2388 P. xylographoides U.S.A. Washington, Skamania County, Columbia River Gorge Björk 14042 (UBC) here KJ462270 KJ462401 -
1122 P. xylographoides U.K. Scotland, West Ross, Talladale Gorge Coppins 24229 (GZU) here KJ462271 KJ462402 KJ462347
1123 P. xylographoides U.K. Scotland, Beinne Eighe Natl Nature Reserve Acton s.n. 30/04/2013 (GZU) here KJ462272 KJ462403 KJ462348
1062 Rimularia limborina U.S.A. California, Mariposa Co., Sierra National Forest Fryday 9520 (MSC) here KJ462273 KJ462404 KJ462349
1076 R. limborina U.S.A. Alaska, Glacier Bay NP, Excursion Ridge Fryday 10100 (MSC) here - - KJ462350
Thamnolia vermicularis unknown Brodo 28669-B (DUKE) (AFTOL-ID 401) Lutzoni et al. (2004) HQ650718 AY584728 HQ650718
Trapelia involuta (syn. T. glebulosa) GERMANY. Nordrhein-Westfalen Lumbsch 12057 (hb. Lumbsch) Lumbsch et al. (2001) AF274080 AF381568 AF274098
T. placodioides GERMANY. Nordrhein-Westfalen Lumbsch 12058 (hb. Lumbsch) Lumbsch et al. (2001) AF274081 AF431962 AF274103
Trapeliopsis granulosa SWEDEN. Niemann (ESS-8684) Schmitt et al. (2003b) AF274087 AF381567 AF274119
Tremolecia atrata SWEDEN. Wedin 7094 (UPS) Wedin et al. (2005) - AY853347 AY853397
2422 Xylographa bjoerkii CANADA. British Columbia, Southgate River Björk 14570 (GZU) here KJ462274 KJ462405 -
1129 X. bjoerkii U.S.A. Alaska, Taylor Bay, Cross Sound Spribille 39752 (GZU) here KJ462275 KJ462406 KJ462351
2401 X. bjoerkii U.S.A. Oregon, Douglas Co., Irwin Rocks McCune 28535 (MCCUNE) here KJ462276 KJ462407 -
1024 X. carneopallida CANADA. Yukon, LaBiche River, N of gas camp Spribille 28528 (GZU) here KJ462277 KJ462408 KJ462352
1147 X. constricta CHILE. Antártica Chilena, PN Alberto de Agostini Buck 58580 (NY, holotype) here KJ462278 KJ462409 KJ462353
2396 X. difformis CANADA. British Columbia, Kootenay River area Spribille 17238 (GZU) here KJ462279 KJ462410 -
2404 X. difformis CANADA. British Columbia, S of Carcross, Tutshi River Spribille 25050 (GZU) here KJ462280 KJ462411 KJ462354
2421 X. difformis CANADA. British Columbia, Selkirk Mtns., Silvercup Ridge Spribille 20110 (GZU) here KJ462281 KJ462412 -
2382 X. difformis U.S.A. Idaho, Coeur d’Alene Mtns., Bloom Peak Björk 12123 (UBC) here KJ462282 KJ462413 -
822 X. disseminata CANADA. New Brunswick Clayden 19609 (NBM) here KJ462283 - KJ462355
823 X. disseminata U.S.A. Tennessee, Great Smoky Mtns NP Tønsberg 37619 (BG) here KJ462284 - KJ462356
2423 X. erratica CANADA. British Columbia, Homathko Estuary Björk 14550 (UBC) here KJ462285 KJ462414 -
820 X. erratica RUSSIA. Khabarovskiy Krai, Pravaya Bureya River Spribille 32039 (GZU, holotype) here KJ462286 KJ462415 KJ462357
P99 X. erratica U.S.A. Alaska, Icy Straits, Fern Harbor Tønsberg 41775 (BG) here - KJ462416 KJ462358
818 X. hians CANADA. British Columbia, Saanich Peninsula, Observatory Hill Spribille, Češka & Češkas.n., 11 Oct 2010 (GZU) here KJ462287 - KJ462359
1140 X. hians U.S.A. Alaska, Glacier Bay, Bartlett Cove Spribille 38126 (GZU) here KJ462288 - KJ462360
1053 X. hians U.S.A. Alaska, Glacier Bay, Bartlett Cove Spribille 36071-B (GZU) here KJ462289 KJ462417 KJ462361
1052 X. hians U.S.A. Alaska, Veteran’s Hwy N of Auke Bay Spribille s.n., Sept 2010 (GZU) here KJ462290 KJ462418 KJ462362
1 X. isidiosa AUSTRALIA. Elix 31849 (CANB, isotype) Bendiksby & Timdal (2013) KF360391 KF360430 KF360461
2 X. isidiosa AUSTRALIA. Western Australia, Caernarvon Hills, 17 km NW of Narrogin Elix 39837 (O-L-171593) Bendiksby & Timdal (2013) KF360392 KF360431 KF360462
162 X. lagoi SPAIN. Asturias, Muniellos Nature Reserve Spribille 30267 here KJ462291 KJ462419 KJ462363
1068 X. opegraphella CANADA. New Brunswick, New River Beach Prov. Park Spribille & Clayden s.n., 08 Oct 2009 (GZU) here KJ462292 KJ462420 KJ462364
1069 X. opegraphella CANADA. Québec, North Shore of St. Lawrence, Godbout Spribille & Clayden s.n., 01 Oct 2009 (GZU) here KJ462293 KJ462421 KJ462365
819 X. opegraphella U.S.A. Alaska, Resurrection Bay, S of Lowell Pt Muggia s.n. (TSB) here KJ462294 - KJ462366
2411 X. opegraphella U.S.A. Alaska, Dyea Spribille 24979 (KLGO) here KJ462295 KJ462422 -
1150 X. pallens AUSTRIA. Carinthia, Gurktaler Alpen, Hochrindl Resl 1143 (GZU) here KJ462296 KJ462423 KJ462367
1153 X. pallens AUSTRIA. Carinthia, Gurktaler Alpen, Hochrindl Resl 1144 (GZU) here KJ462297 KJ462424 KJ462368
2385 X. pallens CANADA. British Columbia, Glacier National Park Goward 05-838 (UBC) here KJ462298 KJ462425 -
1133 X. pallens CANADA. British Columbia, Cassiar Hwy, Gnat Pass Spribille s.n., 13 Aug 2012 (GZU) here KJ462299 KJ462426 KJ462369
1064 X. pallens SPAIN. Navarra, Roncal Valley above Isaba Spribille 30251 (GZU) here KJ462300 KJ462427 KJ462370
1063 X. pallens TURKEY. Bolu Prov, Yedigoller National Park Spribille s.n., 05 June 2007 (GZU) here KJ462301 KJ462428 KJ462371
1060 X. pallens U.S.A. Montana, Lincoln Co., Fitzsimmons Creek Spribille s.n., 18 Sept 2011 (GZU) here KJ462302 KJ462429 KJ462372
1057 X. pallens CANADA. British Columbia, km 1148 Alaska Hwy Spribille 29559 (GZU) here KJ462303 - KJ462373
1151 X. parallela AUSTRIA. Carinthia, Gurktaler Alpen, Hochrindl Resl 1145 (GZU) here KJ462304 KJ462430 KJ462374
1061 X. parallela AUSTRIA. Styria, Präbichl Spribille s.n., 13 Nov 2010 (GZU) here KJ462305 KJ462431 KJ462375
2427 X. parallela CANADA. British Columbia, Bute Inlet area Björk 14520 (UBC) here KJ462306 KJ462432 -
2408 X. parallela CANADA. British Columbia, Quesnel Lake, Penfold River Spribille s.n., 28 Sept 2007 (GZU) here KJ462307 KJ462433 -
1144 X. parallela CHILE. Antártica Chilena, Isla Navarino Buck 60821 (NY) here KJ462308 KJ462434 KJ462376
1145 X. parallela CHILE. Antártica Chilena, Isla Navarino Buck 60821-B (NY) here KJ462309 KJ462435 KJ462377
X. parallela NORWAY. Timdal 10892 (O-L-152948) Bendiksby & Timdal (2013) KF360416 KF360445 KF360476
2430 X. parallela U.S.A. Montana, Flathead Co., Lime Creek Spribille 21171 (GZU) here KJ462310 KJ462436 -
2429 X. parallela U.S.A. Montana, Lake Co., St. Mary’s Lake Spribille 20604 (GZU) here KJ462311 KJ462437 -
1049 X. parallela (‘minutula’) RUSSIA. Khabarovskiy Krai, Pravaya Bureya River Spribille 32037 (GZU) here KJ462312 - KJ462378
P106 X. rubescens RUSSIA. Altai Republic, Cherga, Sema River basin Resl 1142 (GZU) here KJ462313 - KJ462379
1065 X. rubescens SPAIN. Navarra, Roncal Valley above Isaba Spribille 30255 (GZU) here KJ462314 KJ462438 KJ462380
2389 X. rubescens U.S.A. Montana, Lincoln Co., Sterling Creek Spribille & Wagner s.n., 21 Oct 2007 (GZU) here KJ462315 KJ462439 KJ462381
1103 X. schofieldii U.S.A. Alaska, Gustavus, Falls Creek Spribille 39088 (GZU, holotype) here - KJ462440 -
1056 X. septentrionalis s.lat. U.S.A. Montana, Lincoln Co., Grave Creek Spribille s.n., 28 Aug 2011 (GZU) here KJ462316 KJ462441 -
2402 X. septentrionalis CANADA. British Columbia, Cassiar Hwy Spribille 25133 (CANL, holotype) here KJ462317 KJ462442 KJ462382
2438 X. septentrionalis CANADA. British Columbia, East Kootenays, White River Spribille 16905 (GZU) here KJ462318 - -
X. soralifera ** TURKEY. Rize vilayet, Kaçkar Mts, village Ayder Palice 8610 (ESS-21522) Schmitt et al. (2003a) - AY212878 AY212849
1117 X. soralifera U.S.A. Montana, Lincoln Co., Edna Creek Spribille s.n., 09 Sept 2012 (GZU) here KJ462319 KJ462443 KJ462383
2415 X. soralifera U.S.A. Montana, Lincoln Co., Gray Creek Spribille 21812 (GZU) here - KJ462444 KJ462384
2416 X. soralifera U.S.A. Montana, Sanders Co., Bull River Spribille 20754 (GZU) here KJ462320 KJ462445 -
1070 X. soralifera U.S.A. Washington, Skamania Co., Elk Pass Spribille 29853 (GZU) here KJ462321 KJ462446 KJ462385
1058 X. stenospora CANADA. British Columbia, Selkirk Mtns., Dennis Cr. Spribille 20224 (GZU) here KJ462322 KJ462447 KJ462386
2400 X. stenospora CANADA. British Columbia, near Canal Flats, White River Spribille 16951 (GZU) here KJ462323 KJ462448 -
2428 X. stenospora CANADA. British Columbia, Incomappleux River Spribille 18256 (GZU) here KJ462324 KJ462449 -
1059 X. stenospora U.S.A. Montana, Glacier Co., Upper Two Medicine L. Spribille & Wagner s.n., 15 Oct 2007 (GZU) here KJ462325 KJ462450 KJ462387
2424 X. stenospora U.S.A. Washington, Spokane Co., Riverside State Park Björk 14172 (UBC) here KJ462326 KJ462451 -
817 X. trunciseda U.S.A. Alaska, Resurrection Bay, S of Lowell Pt Muggia s.n. (TSB) here KJ462327 KJ462452 KJ462388
2387 X. trunciseda CANADA. British Columbia, Clearwater River Björk 12399 (UBC) here KJ462328 KJ462453 -
1051 X. trunciseda NORWAY, Troms, Torsken, Senja Tønsberg 40446 (BG) here KJ462329 KJ462454 -
1050 X. trunciseda U.S.A. Montana, Lincoln Co., Grave Creek Spribille s.n., 25 Aug 2011 (GZU) here KJ462330 KJ462455 KJ462389
1146 X. vermicularis CHILE. Antártica Chilena, Isla Navarino Buck 60823 (NY) here KJ462337 - KJ462392
1130 X. vermicularis RUSSIA. Khabarovskiy Krai, 33 km W of Lazarev Spribille 30992 (GZU) here KJ462331 KJ462456 -
2399 X. vermicularis RUSSIA. Primorskiy Krai, Mt. Oblachnaya Spribille 23687 (GZU) here KJ462332 KJ462457 -
821 X. vermicularis U.S.A. Alaska, Chulitna River, Parks Hwy Spribille 27762 (GZU) here KJ462333 - KJ462390
1152 X. vitiligo AUSTRIA. Carinthia, Gurktaler Alpen, Hochrindl Resl 1146, 2013 (GZU) here KJ462334 KJ462458 KJ462391
2403 X. vitiligo CANADA. British Columbia, Quesnel Lake, Penfold River Spribille s.n., 28 Sept 2007 (GZU) here KJ462335 KJ462459 -
2417 X. vitiligo CANADA. British Columbia, Glacier National Park Goward 05-918 (UBC) here KJ462336 KJ462460 -
1066 X. vitiligo U.S.A. Alaska, Glacier Bay, Bartlett L trail Spribille 36071-C (GZU) here KJ462338 KJ462461 KJ462393
*

locality data provided by B. McCune (pers. comm., 2013)

**

Published as X. vitiligo but since re-identified; collection data provided by Z. Palice (pers. comm., 2011 & 2013).

Genomic DNA was extracted using a DNeasy Plant Mini kit (Qiagen, Hilden, Germany). Especially tiny or recalcitrant samples were extracted using the QIAamp DNA Investigator Kit (Qiagen, Hilden, Germany). Samples were eluted in 50 to 75 μl elution buffer and on account of the low DNA concentrations were typically used undiluted for PCR template. DNA was amplified from three loci for the core part of our study. We sequenced the internal transcribed spacer 1 and 2 and associated 5.8S ribosomal rDNA (hereafter ITS), the downstream 28S ribosomal DNA (28S), and mitochondrial small subunit ribosomal DNA (mtSSU) using the primers listed in Table 2. Most of the sequences from the primer combination mrssu1 and MSU7 were however not subsequently used, or were resampled with mrssu1 and mrssu3R, as they were too short to capture the main polymorphic sites in mtSSU in our taxon sample.

Table 2.

Primers used in this study.

Name Sequence 5′-3′ Citation
ITS1F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns 1993
ITS4 TCCTCCGCTTATTGATATGC White et al. 1990
LR0R ACCCGCTGAACTTAAGC Cubeta et al. 1991
LR3 CCGTGTTTCAAGACGGG Vilgalys & Hester 1990
LR5 TCCTGAGGGAAACTTCG Vilgalys & Hester 1990
LR7 TACTACCACCAAGATCT Vilgalys & Hester 1990
LR4_Trap TTTGCACGTCAGAACCGCTGCG this study
mrssu1 AGCAGTGAGGAATATTGGTC Zoller et al. 1999
mrssu3R ATGTGGCACGTCTATAGCCC Zoller et al. 1999
MSU7 GTCGAGTTACAGACTACAATCC Zhou & Stanosz 2001

Sequence data were assembled in BioEdit 7.1.3.0 (Hall 1999), aligned using the ClustalW algorithm (Thompson et al. 1994) and manually adjusted. The data contained large introns occurring in few sequences, especially in 28S, and thus the raw alignments required culling for analysis. Missing data and non-conserved positions were filtered using Gblocks 0.91b (Castresana 2000). We set the filter options to the most inclusive possible, with the minimum number of sequences for both conserved and flank positions 52/103, the maximum number of contiguous non-conserved positions set to eight, the minimum length of a block set to two, and gap positions allowed throughout.

We checked for incongruence, defined as strong support for two different relationships, by first analyzing the topology of each locus separately and checking for supported incongruence. A node was considered to be incongruent when an alternative relationship was supported in different topologies. Nucleotide substitution models were tested on the loci individually using jModelTest v0.1.1 (Posada 2008).

Phylogenetic analyses

ML estimation

We performed ML phylogenetic estimations of tree topologies and branch lengths using RAxML (Stamatakis 2006) v7.4.2 (release 23 Nov 2012) implemented in raxmlGUI v1.3 (Silvestro & Michalak 2011). We implemented the GTRGAMMA substitution model and calculated 1000 bootstrap replicates. The best-scoring tree over ten runs was selected based on its log likelihood score. A strongly supported relationship was taken as those nodes with a bootstrap value of 70% or greater.

Bayesian inference

We performed Bayesian inference analysis of our DNA sequence data set using the Markov chain Monte Carlo (MCMC) algorithm of MrBayes 3.2 (Ronquist & Huelsenbeck 2003) implemented in MrBayes_gpu v2.1.1 (Bao et al. 2013). Prior distributions included allowing for equal probabilities of all tree topologies (“uniform”), a uniform distribution over a range of alpha values for the shape parameter of the gamma distribution of rate variation, a uniform distribution of invariable sites, a (1, 1, 1, 1, 1, 1) Dirichlet distribution for the rate matrix, a (1, 1, 1, 1) Dirichlet distribution for the state frequencies, a beta distribution for the transition/transversion ratio, and an exponential, unconstrained branch length prior with the parameter set to 10.0. The number of discrete gamma categories was set to four. The analysis was carried out with two parallel runs with four chains each with one cold and three heated chains. The temperature setting was tested at 0.2 (default), 0.1 and 0.05 to check for chain mixing under a single swap default. Analyses were run initially for 2.5 million generations with tree sampling every 1000th generation for a total of 2501 trees, of which the first 1500 were discarded as burn-in. After checking run behavior and convergence diagnostics a final run of 10 million generations was performed with sampling every 1000th tree and a burn-in of 5001 trees for a posterior sample of 5000 trees from which the consensus topology was calculated. Convergence was assessed with Tracer v1.5 (tree.bio.ed.ac.uk/software/tracer/). A node was considered strongly supported when the posterior probability value was 0.95 or greater. Both ML and Bayesian inference trees were visualized with FigTree v1.4.0 (tree.bio.ed.ac.uk/software/figtree/).

Chemistry

We employed thin layer chromatography (TLC) to study secondary metabolites, as described for lichens by Culberson (1972) with modifications (Culberson & Johnson 1982). The nomenclature of secondary metabolites follows Huneck & Yoshimura (1996), except for confriesiic and friesiic acids, which follow Elix et al. (2004) and Elix (2005). Friesiic acid is a rare, trinuclear, secondary metabolic product in lichenized fungi, with both depside and depsidone moieties (a depsido-depsone). Originally described from Xylopsora friesii (= Hypocenomyce friesii; Bendiksby & Timdal 2013), it is also found in Xylographa isidiosa (Elix 2005, as Hypocenomyce isidiosa) and Trapeliopsis colensoi (Elix 2011). Confriesiic acid was originally described by Elix (2005) as a homologue of friesiic acid. In all Xylographa species including the one originally studied by Elix (2005), confriesiic acid is the major substance and friesiic acid, if present at all, occurs in trace amounts. Confriesiic acid can be recognized in TLC by its Rf values of (A)0.12, (B’)0.23 and (C)0.16, fluorescing blue in UV356nm prior to heating and treatment with H2SO4. It corresponds to the substance called Xhn-1 in Brodo (1992).

Morphology

Morphological characters were studied in water, in potassium hydroxide (KOH), in Lugol’s potassium iodide solution (Roth N052.1, hereafter ILugols) and in lactophenol cotton blue (LCB; Merck 1.13741.0100). Ascomatal length and width takes into consideration living, current-generation ascomata and excludes dead excipular shells and mixed complexes of young and old ascomata; measurements were carried out on dry ascomata and indicate smallest absolute measurement-largest absolute measurement unless otherwise specified. Hymenial amyloidity was assessed after Baral (1987). Ascospores were measured by preferentially selecting random loose (outside of the ascus) ascospores; where this was not possible, a single ascospore per ascus was selected. Means were calculated individually per specimen and measurements are provided as (smallest absolute value-) smallest mean-largest mean (−largest absolute value) over all measured specimens, unless otherwise specified.

Scanning electron microscopy was conducted on dry thalli fixed to aluminum stubs with carbon impregnated double sided tape, using an FEI XL-30 scanning electron microscope. Samples were sputtercoated with gold (AGAR Sputter Coater) and studied in high vacuum mode using secondary electron detection.

In past work on Xylographa, the terms soredia, isidia and goniocyst have been inconsistently applied. Soredia are generally defined as a more or less globose, fungal-algal cyst produced in soralia or forming the majority of a thallus (Tønsberg 1992). In the lichenological literature, this term has in practice almost only been applied when the cyst in question has a roughened surface or somehow appears “soft” (Figs. 20F, 24D). In Xylographa vitiligo, the structures called soredia by Tønsberg (1992) and Ryan (2004a) were termed goniocysts by Lumbsch (1997). The term goniocyst was applied by Coppins (1983, for Micarea) and Ryan (2004a), by contrast, to loose “soredia” not associated with soralia. When the cyst has a smooth surface, appears “hard”, and in some cases is affixed at one end to the thallus, the term isidia has been used (Elix 2005, in Xylographa isidiosa: Figs. 9E, F), though the structures Elix (2005) refers to as isidia are clearly identical to the goniocysts of Ryan (2004a). When morphologically otherwise identical structures adhere to the substrate, they have been called granules. Two key points of relevance to the evolutionary biology of this group may become buried in the semantics: 1) in all cases we are dealing with extremely similar structures, sometimes scattered, sometimes in special receptacles; using different terms creates the impression of character states more different from each other than they actually are. Whether or not these cysts are “soft” or “hard” in appearance may have as much to do with whether they contain crystallized, surficial secondary metabolites as with any difference in cell structure. 2) More problematically, cysts identical to “soredia” and “isidia” occur below the surface in well known species universally stated to lack soredia and isidia: in Xylographa, hard and soft cysts are frequently scattered both on and in the thallus in the X. parallela complex; and hard cysts indistinguishable from those in X. isidiosa are found e.g. in X. trunciseda (Fig. 22E), albeit embedded in grains of wood, or scattered over the surface.

Fig. 20. Xylographa soralifera Holien & Tønsberg.

Fig. 20

A, B, habit dry (A) and moistened (B); C, squash preparation of whole soralium and D, individual goniocysts in water; E, soralium in SEM; F, close-up of goniocysts in SEM, showing conglutination of goniocysts. All photos: U.S.A., Washington, Spribille 29853 (DNA voucher 1070). Scale bars: A, B, 1 mm; C, 50 μm; D, 10 μm; E, 200 μm; F, 50 μm.

Fig. 24. Xylographa vitiligo (Ach.) J.R. Laundon.

Fig. 24

A, habit; B, section of ascomatum showing exciple, asci and ascospores; C, whole soralium, showing concave habit, in SEM; D, detail of goniocysts, in SEM. All photos: Switzerland, Graubünden, Poelt s.n. (M). Scale bars: A, 1 mm; B, 10 μm; C, 100 μm; D: 20 μm.

Fig. 9. Xylographa isidiosa (Elix) Bendiksby & Timdal.

Fig. 9

A, B, habit; C, D, goniocysts in water viewed with light microscope; E, F, goniocysts viewed in SEM. All photos from Australia, Elix 39837 (O). Scale bars: A, 1 mm; B, 0.5 mm; C, E, 50 μm; D, 10 μm; F, 20 μm.

Fig. 22. Xylographa trunciseda (Th. Fr.) Minks ex Redinger.

Fig. 22

A, B, habit dry (A) and moistened (B); C, habit of ascomata, in water, showing spent “shells” of dead exciples; D, section of ascoma, showing regenerative ascoma beneath “shell” of spent exciple, in LCB; E, goniocysts lined up inside xylem, in water; F, asci, in ILugols after pretreatment with KOH. A, B, C: Tønsberg 40446 (BG, DNA voucher 1051); D, Muggia s.n. (TSB, DNA voucher 817); E, F: Canada, British Columbia, Björk 12399 (UBC, DNA voucher 2387). Scale bars: A, B, 2 mm; C, 50 μm; D, 20 μm; E, F, 10 μm.

Soredia and isidia are both terms that have come to embody specific concepts, especially in macrolichens. This is not the place to weigh in about the use of these terms in those groups. We chose here to use goniocyst as an umbrella term to encompass soredioid and isidioid structures formed anywhere on the thallus and in any constellation. We thus define goniocyst in a broader sense than Coppins (1983) or Lumbsch (1997): goniocysts are a basic unit of fungal-algal interaction consisting of a single layer of fungal hyphae wrapped around one or more photobiont cells; they encompass all forms of cysts discussed here, including soredia. They can occur endosubstratally, scattered over the surface of the substrate or on more extensive fungal-algal matrices (thallus), in delimited surficial clusters (which we continue to call soredia and soralia), or can form a continuous surficial crust.

Studied Material

Over 1000 specimens were studied from the 23 herbaria listed in the acknowledgments, as well as previously unaccessioned material from CANL, LE and UBC. Fresh material was collected during field work in western North America (2007-2012), eastern North America (2009), Austria (2013), Spain (2009), Turkey (2007) and the Russian Far East (2007, 2009). Specimen citation follows standard protocols with romanization of Cyrillic place names following the BGN/PCGN system.

Results

We obtained a total of 204 new DNA sequences including 168 of members of Xylographa from 68 new isolates as well as 36 of outgroup taxa from 13 new isolates. For Xylographa, three-locus coverage was complete for 33 individuals, while two loci were obtained for a further 34 individuals. Two single-locus individuals are included here but a further 21 single-locus individuals were obtained that were excluded from further analysis. Twenty-one isolates were also incorporated from GenBank, for a total data set of 103 isolates and 261 sequences (96 ITS, 90 mtSSU and 75 28S sequences). The raw data matrix consists of 6143 positions, including long introns between the ITS1F primer binding site and the beginning of the ITS, and in the middle of the 28S subunit. Obtaining full-length 28S fragments was made difficult through the frequent presence of introns in and adjacent to primer binding sites, and 28S was not possible to obtain for some samples. Following removal of introns, flanking regions and non-conserved sites, the ITS data set consisted of 610 BP, mtSSU 711 BP and 28S 750 BP for a total length of 2071 positions. Testing of substitution models yielded GTR+I+G for ITS, TIM2+I+G for mtSSU and TIM1+I+G for 28S excluding introns. Comparison of individual gene trees revealed no supported topological conflict between any of the sampled loci and loci were thus combined for all further analyses.

Bayesian analysis

The two runs of the MCMC analysis converged on similar solutions after less than 500,000 generations. The mean standard deviation of frequencies of splits (SDSF) with a value of 0.1 or higher across both runs was 0.009271 after 2.5 million generations, and 0.003879 after 10 million generations. The best results for chain mixing were obtained with single chain swapping and the heat parameter set to 0.2. Parallel runs with the heat parameter set to 0.025 and 0.1 yielded less chain mixing and higher SDSF values.

Maximum likelihood

The topology obtained by the maximum likelihood analysis was similar to that of the MCMC/Bayesian inference approach and there were no supported conflicts. The final best scoring tree had a log likelihood of −18691.91.

Relationships among sampled taxa

The Bayesian and maximum likelihood analyses yielded similar topologies (Fig. 1). Among the sampled outgroup taxa, Dibaeis and Icmadophila, Baeomycetaceae (Baeomyces and Phyllobaeis) and Hymeneliaceae (Hymenelia and Tremolecia) are well supported while the genus Ainoa is recovered as its own monophyletic group. Genera traditionally assigned to Trapeliaceae are recovered in a single strongly supported clade, which consists of two non-supported, multigeneric clades. The first contains Rimularia s.str. (R. limborina, the type species), Trapeliopsis, Placynthiella, Trapelia and Placopsis; the second contains Lithographa, Ptychographa, Rimularia psephota/R. insularis (= Lambiella, see below) and Xylographa. Relationships among isolates of genera in the first clade are strongly supported with the exception of the relationship of Rimularia s.str. to the remaining genera. In the second clade, none of the genus-level relationships are strongly supported. Furthermore, there is strong support for the monophyly of Lithographa, Ptychographa and the Rimularia psephota/R. insularis group based on our taxon sample.

Fig. 1.

Fig. 1

Fig. 1

a. Phylogenetic relationships within Xylographa and its relationships to other genera of Baeomycetales. Concatenated ITS, 28S and mtSSU rDNA (2071 characters). Consensus tree calculated from 5000 tree posterior sample of Bayesian MCMC analysis. Node labels indicate posterior probability/bootstrap values of maximum likelihood analysis.

b. Continuation of Fig. 1a.

All pre-existing, described taxa previously assigned to Xylographa and included in our sample are strongly supported as a monophyletic group. In total, we recovered 15 low-level clades, corresponding to morpho-chemical units identified in the initial screening, as monophyletic and strongly supported in both the Bayesian and maximum likelihood analyses. Eight of these, including several single-individual tip clades, are described here as new species (see Taxonomic section). Of the morphospecies we analysed, only two, X. vitiligo and “X. vermicularis” are not strongly reciprocally monophyletic. Sequences from the single isolate of X. minutula were identical to and recovered within X. parallela.

Within Xylographa, several higher level multi-species relationships are strongly supported in the Bayesian analysis but not in the maximum likelihood analysis (species described as new later in this paper are given in quotation marks): (1) the monophyly of the X. opegraphella group, including X. opegraphella, X. hians and “X. erratica”; (2) the monophyly of the X. vitiligo group including X. vitiligo and “X. vermicularis”; and (3) the monophyly of the X. parallela group, including six species: X. parallela, “X. septentrionalis”, X. difformis, “X. stenospora”, X. rubescens and X. pallens. These three groups plus X. soralifera form a well-supported monophyletic group together with our single sample of X. carneopallida and a genetically aberrant sample of X. septentrionalis s. lat., again only in the Bayesian analysis. No resolution, by contrast, was obtained for a group of basal taxa including X. disseminata, X. trunciseda, X. isidiosa and “X. bjoerkii”, which form a polytomy, or the relationship of “X. lagoi” to the rest of the species of the genus.

Discussion

The subclass Ostropomycetidae has seen considerable investment in recent decades to resolve species diversity and relationships, particularly in the orders Ostropales and Pertusariales (Schmitt & Lumbsch 2004; Rivas Plata & Lumbsch 2011). Large sampling gaps however still stand in the way of understanding evolution in this subclass. Filling these gaps is a prohibitive task: not only is investment needed in material acquisition and DNA sequencing, but the taxonomy and nomenclature are in many cases still stuck in the 19th century. In the present paper, we present a first molecular and morphological reassessment of the genus Xylographa with support for roughly doubling the number of currently accepted species.

Our phylogenetic sampling is comprehensive in that it covers nearly all previously accepted species with the exception of the Sonoran Xylographa crassithallia and X. pruinodisca (Ryan 2004a), both of which are known only from their holotype specimens. We recovered strong support for the six widely recognized species X. disseminata, X. hians, X. opegraphella, X. parallela, X. trunciseda and X. vitiligo as well as the recently described X. isidiosa (Elix 2005; Bendiksby & Timdal 2013) and X. soralifera (Holien & Tønsberg 2008). Of species recognized in recent taxonomic works, only X. minutula (recognized by Wirth et al. 2013) is not supported and is clearly conspecific with X. parallela. In addition to these eight clades for previously accepted species, we recovered an additional eight well-supported multi-individual clades. Close examination of the specimen material behind these clades showed that all eight could be distinguished by morphological and/or chemical characters. Three of the clades corresponded to type specimens of historically recognized taxa (X. difformis, Vainio 1883; X. pallens, Harmand 1900; X. rubescens, Vainio 1921) and five are described below as new species (X. bjoerkii, X. erratica, X. septentrionalis, X. stenospora, X. vermicularis). Finally, we sequenced several putative new species known only from a single or few specimens that were so morphologically distinct as to not be reconcilable with any presently accepted species. We recovered these single individuals as tip clades distinct from other sampled species and take this in combination with their divergent morphology to support their recognition. One of these corresponds to an earlier described variety (X. carneopallida, Räsänen 1939, as a variety of X. rubescens) while two others we describe as new species: X. constricta, a distinctive species forming ascomatal rings, and the first verified non-lichenized member of Baeomycetales, from extreme southern Chile; and X. lagoi, the first species of the genus with thamnolic acid, from northern Spain. Finally, one species, X. schofieldii, was recognized as chemically and morphologically distinct based on three specimens but only a single locus (mtSSU) could be obtained, which only narrowed its assignment to Xylographa. The inclusion of this sequence in the phylogenetic analyses significantly weakened backbone support for other relationships due to the multiple equally supported options for its placement, and thus it was excluded from our final analyses.

Backbone support for relationships between species and species groups in Xylographa is weak, as is support for relationships between Xylographa and Lambiella, Lithographa and Ptychographa, respectively. The reason for this is most likely twofold: 1) The data set contains gaps and missing data, particularly for the 28S locus. This can be ascribed to the extreme difficulty in some cases of obtaining PCR products from samples with low total nucleic acid concentrations (often <5 ng/μl) and also the abundance of long Group I introns in 28S primer binding sites in Xylographa and Rimularia s.lat.. We were able to partly alleviate this problem by designing a Trapeliaceae-specific 28S reverse primer that could be used in conjunction with ITS1F for obtaining the first 600-700 BP of the 28S ribosomal subunit (primer LR4_Trap, Table 2), though sometimes we obtained only shorter fragments using ITS1F in combination with LR3. Ultimately, fragment length varied enough after about position 650 of 28S that we ended up excluding ca. 2/3 of our original alignment positions (most but not all introns and flanking regions) in our Gblocks analysis, as well as numerous individuals with particularly lacunose sequence data. 2) The three loci were not equally informative, with the amount of parsimony-informative sites decreasing in the order ITS>28S>mtSSU. This meant that behaviour of many ITS-mtSSU two-locus individuals in the phylogenetic analyses was largely driven by the ITS data and particularly accentuated the problem of missing 28S data. This was not clear at the beginning of our sequencing effort and might have been offset had we been able to replace mtSSU with a more informative protein-coding locus.

Evolution of ascomata in xylographoid lichens

Early authors assumed that all crustose lichens with “lirellae”, or linearized ascomata, are closely related, and placed unrelated genera such as Graphis, Opegrapha, Ptychographa and Xylographa in Graphidaceae (e.g., Zahlbruckner 1922; Redinger 1938). Implicit is the assumption that linearized ascomata must have arisen only once in evolution. While some early authors expressed skepticism and pointed to similarities between Xylographa and species with roundish ascomata, e.g. what is now called Placynthiella (Hedlund 1892), it was not until comparatively recently that these species groups began to be formally reassigned, and thus their multiple origins at least tacitly conceded. Our molecular phylogeny confirms that three of these genera, Lithographa, Ptychographa and Xylographa, evolved from a single common ancestor, though the exact sister group relationships remain unclear. It also shows that Rimularia, a genus recognized to be closely related to Lithographa already by Hertel & Rambold (1990), is indeed closely related but consists of disparate elements. The type species of the genus, R. limborina, was recovered in our study as sister to the clade including Trapelia, Placynthiella, Trapeliopsis and Placopsis, though unsupported (Fig. 1), while two other species (R. psephota, R. insularis) are recovered in the vicinity of Lithographa, Ptychographa and Xylographa. These species, recognized as Lambiella (Hertel 1984 and Taxonomic section, below), have angular to roundish ascomata and insert further ascomatal variation into the clade with Xylographa. The elucidation of the phylogenetic relationship of Lambiella to Xylographa will probably be key in understanding the evolution of the extraordinary substrate specificity in the latter genus. However, reconstructing the ancestral state will not be possible until statistical support can be achieved for the backbone relationships of these main groups.

The ascomatal architecture in our species lineup suggests that constraints on ascoma form must be relaxed in the xylographoid genera, allowing a considerable range of variation, and fixation of advantageous forms in different species groups. In Xylographa, this range of variation encompasses both the shape and regenerative ability of the ascomata, with the evolution of growth forms that appear to enable lateral growth or “creep” of the ascomata. Specific growth patterns are strongly correlated with the clades and species recovered here. Several apparently basal species of Xylographa have striking ascomatal development patterns including ring formation (X. constricta) and peri-ascomatal budding, without much evident lateral creep (X. bjoerkii, X. lagoi). In the remaining species, two broad patterns can be distinguished: 1) “trunciseda-type” ascomata, which regenerate from tips of necrotic former ascomata with a new, completely marginate ascoma (i.e. an exciple is formed all away around the new hymenium: Fig. 6B, 8F, 22C and 2) “parallela-type” ascomata, which advance continuously from the original starting point of the ascoma and do not form a definite margin facing the necrotic shell they grow out of (Figs. 15B, 15D, 15F, 21B). Both of these ascomatal growth patterns are unique, to our knowledge, to Xylographa.

Fig. 6. Xylographa disseminata Willey.

Fig. 6

A, habit and arrangement of ascomata and thallus; B, ascomata and thallus granules in water; C, detail of goniocyst, showing paraplectenchymatous cortex, in water; D, section through ascoma, in water; E, asci and paraphyses in ILugols without pretreatment with KOH; F, asci and ejected ascospores in ILugols after pretreatment with KOH. A, B, D, F from Canada, New Brunswick, Clayden 19609 (NBM, DNA voucher 822); C, E from U.S.A., North Carolina, Tønsberg 37619 (BG, DNA voucher 823). Scale bars: A, 0.5 mm; B, C, 0.1 mm; D, 20 μm; E, F, 10 μm.

Fig. 8. Xylographa hians Tuck.

Fig. 8

A-D. Habit and arrangement of ascomata; E, habit of several individuals showing lineup of conidiomata at border between thalli (arrows); F, ascomata, in water. A, lectotype (FH, photo E. Timdal); B, Canada, British Columbia, Spribille s.n., 11 Oct 2011 (GZU, DNA voucher 818); C, U.S.A., Alaska, Spribille s.n. (GZU, DNA voucher 1052); D, F, Spribille 8887 (GZU); E, Spribille 36071-B (GZU, DNA voucher 1053). Scale bars: A–C, 0.5 mm; D, 1 mm; E, 2 mm; F, 0.1 mm.

Fig. 15. Xylographa parallela (Ach. : Fr.) Fr.

Fig. 15

Habit and arrangement of ascomata. A, B: Austria, Spribille s.n. (GZU, DNA voucher 1061); C, D: U.S.A., Montana, Spribille 21171 (GZU, DNA voucher 2430); E, F: U.S.A. Montana, Spribille 20604 (GZU, DNA voucher 2429). Scale bars: A, B, E, 0.5 mm; C, 1 mm; D, F, 0.2 mm.

Fig. 21. Xylographa stenospora T. Sprib. & Resl.

Fig. 21

Habit and arrangement of ascomata. A, B: holotype [Goward]; C, D: Canada, British Columbia, Björk 13454 (UBC); E, F: U.S.A., Montana, Spribille 20345 (GZU). Scale bars: A, C, E, 1 mm; B, D, F, 0.2 mm.

Taxonomic section

Lambiella Hertel

Beih. Nova Hedwigia 79: 459 (1984). Typus generis: Lambiella psephota (Tuck.) Hertel

Hertel (1984) based the genus Lambiella on the presence of an amyloid medulla (incidentally shared with several Xylographa species), the non-gyrose ascomata, and the less reticulate paraphysal networks compared to Rimularia s.str. He however stopped recognizing the genus only a few years later and recombined the type species into Rimularia without explanation (Hertel 1987). Our molecular results lend support to Hertel’s (1984) hypothesis that Rimularia psephota constitutes a distinct group from the type of Rimularia, R. limborina. Additional morphological support may be lent by detailed study of ascus apical structures, already depicted by Hertel & Rambold (1990). A discussion of this and the necessary re-circumscription of generic characters will be discussed at length elsewhere. In the interim, the following new combination is necessary for one of the common and characteristic elements of this clade:

Lambiella insularis (Nyl.) T. Sprib., comb. nov. Mycobank No. MB 805263

Lecidea insularis Nyl., Bot. Not. 1852: 177 (1852); Rimularia insularis (Nyl.) Hertel & Rambold, Lecideac. Exs. Fasc. 8: 9, no. 159 (1985). Type: [Sweden:] ad Holmiam [=Stockholm], 1852, W. Nylander (H-NYL 14031).

Xylographa (Fr. : Fr.) Fr.

Fl. Scan. 344 (1836). Typus generis: Xylographa parallela (Ach. : Fr.) Fr. (Clements & Shear 1931). = Stictis B. Xylographa Fr. : Fr., Syst. Mycol. 2(1): 197 (1822).

?= Spiloma Ach., Methodus: 9 (1803). Typus generis: apparently never typified.

= Xylographomyces Cif. & Tom., Atti Istit. Bot. Univ. Lab. Crittog. Pavia, ser. 5, 10: 42 (1953), nom. illeg. (Lücking & Hawksworth 2007).

Ascomata hemiangiocarpic, angular to linear, with exposed to nearly concealed disc; exciple of interwoven hyphae, pigmented but non-carbonaceous, not amyloid, folded at termina of ascoma, growth tips nearly always with strongly birefringent (POL+) cell walls, and sometimes also inspersed with POL+ crystals; hypothecium of swollen hyphae, paraplectenchymatous as visible in section, giving way upwards to strongly thickened ascogenous hyphae, hemiamyloid or not amyloid; hymenium usually hemiamyloid, rarely euamyloid, with brown pigmentation, often also with a slate gray, HNO3−, C−, KOH− pigment in the inner walls of paraphyses; asci unitunicate, clavate to almost cylindrical, gelatinous sheaths covering the walls amyloid, tholus lacking internal amyloid structures, similar to that in Trapelia; ascospores 8/ascus, single-celled, thin-walled, colourless, broadly to narrowly ellipsoid.

Conidiomata pycnidia, globose, 2/3 immersed to surficial and ±adnate, with conidiogenous hyphae of Type V (Vobis 1980); conidia filiform, curved.

Sterile hyphae occuring in lignum interstices, non-amyloid, rarely (e.g. in X. vermicularis) euamyloid in dense patches below the ascoma (well below the hypothecium); usually forming an endosubstratal to episubstratal thallus first with small “plugs” of algal cells, occasionally also more extensive surficial crusts, in one species non-lichenized. Trebouxia spp. verified as photobiont in several species by DNA sequencing (K. Schneider & T. Spribille, unpublished data).

Key to the species of Xylographa

  • 1

    . Thallus with a distinct surficial layer or piles of corticate goniocysts or isidia; ascomata present or more often absent. .........................2

  • 1

    . Thallus without or at most with scattered goniocysts; always fertile. .............................8

  • 2

    . Thallus P−, KOH−. ........................................3

  • 2

    . Thallus P+ orange, KOH+ yellow-orange to dingy brown-yellow, containing stictic, norstictic or fumarprotocetraric acids. ................6

  • 3

    . Thallus granular or apparently isidiate, the goniocysts prominent, whitish, to 0.12 mm; ascomata usually present; with fatty acids. ...... ................................................... X. disseminata

  • 3

    . Thallus with small brown goniocysts usually not more than 0.06 mm diam.; with confriesiic acid. ................................................................4

  • 4

    . Goniocysts confined to punctiform soralia, these strongly convex; ascomata not known. .. ......................................................X. schofieldii

  • 4

    . Goniocysts not confined to soralia, forming a thin to thick crust. ..........................................5

  • 5

    . Goniocysts sparse, dispersed over wood or endolignic; ascomata present, dark brown to black, strongly constricted at base, with thick margins. [see lead 12: X. bjoerkii]

  • 5

    . Goniocysts abundant, forming a thick crust; ascomata not known. .......................X. isidiosa

  • 6

    . Soralia strongly convex; thallus with fumarprotocetraric acid. ....................... X. soralifera

  • 6

    . Soralia concave to weakly convex; thallus with stictic and/or norstictic acid. ..................7

  • 7

    . Soralia creamy to salt-and-pepper pigmented or grayish; goniocysts matte, roughened in surface view and indistinctly demarcated in squash preparations; ascomata, when present, short, ±trunciseda-type, budding, forming chains or contorted stars. .................X. vitiligo [rare soraliate forms of X. vermicularis will key here, and can be separated only by TLC: confriesiic acid in addition to stictic acid]

  • 7

    . Soralia dark brown; goniocysts appearing “hard”, easy to see as sharply delimited brown balls in squash preparations; ascomata, when present, parallela-type. ....... X. septentrionalis

  • 8

    . Ascomata short, L/W ratio 1.5–3, usually with a complete exciple, single or regenerating from tips of spent ascomata to form chains or stars. ................................................................9

  • 8

    . Ascomata long, L/W ratio 3–8 or more, often with open exciples towards the spent portions of the ascoma (X. parallela group). .............18

  • 9

    . Thallus P−, KOH−. ......................................10

  • 9

    . Thallus (or ascomatal sections) P+, KOH+ yellow to orange. .........................................14

  • 10

    . Ascomata dark brown or nearly black, nearly as tall as wide in section, strongly constricted at the base; ascomata not obviously regenerating from tips of dead ascomatal shells; tips of paraphyses and excipular hyphae pigment-capped. .........................................................11

  • 10

    . Ascomata pale brown to grayish brown; ascomata regenerating from tips of ascomatal shells; paraphysis tips and excipular hyphae weakly if at all pigment-capped. .................13

  • 11

    . Ascomata produced in rings, these squeezing grains of wood into small mounds when mature. Lacking symbiotic algae. ...............X. constricta

  • 11

    . Ascomata not produced in rings; algae always present (though sometimes hard to see: check transverse sections). .....................................12

  • 12

    . Thallus immersed or barely visible along or above grains of wood, consisting of tiny, brown goniocysts to 0.04 mm diam.; with confriesiic acid. ...............................X. bjoerkii

  • 12

    . Thallus surficial, verrucose-granular, with whitish gray granules to 0.12 mm; with fatty acids.[lead 3: X. disseminata]

  • 13

    . Ascospores averaging 12.2–14.1 × 6.8–8.4 μm; hymenium 80–120 μm tall; ascomata beige to pale brown, not forming regular chains, often not arranged in a linear plane; thallus immersed to surficial, smooth, pale brown to grayish brown; confriesiic acid, with or without accessory stictic acid (the common, KOH+ yellowish form; keyed under lead 17). ..................X. vermicularis

  • 13

    . Ascospores averaging 10.1–11.3 × 5.2–6.1 μm; hymenium 60–85 μm tall; ascomata brown, forming regular chains in a single linear plane from dead excipular shells; thallus immersed, consisting of goniocysts developed in the hollowed remains of lignum cells; confriesiic acid. ................................ X. trunciseda

  • 14

    . Ascomatal disc jet black, the margin white and flexuose; with thamnolic acid. ............X. lagoi

  • 14

    . Ascomatal disc brown to gray; thallus with stictic and/or norstictic acid. ........................15

  • 15

    . Ascospores short and narrow, averaging 9.4–11.3 × 3.4–3.9 μm; ascomata variably with concealed or exposed disc when moist, or hymenium abortive; ascomatal pigments brown, usually with some admixed gray pigment; often with norstictic acid as major constituent in thallus ..............X. opegraphella

  • 15

    . Ascospores generally >11 μm long and >5 μm wide; ascomata usually with exposed disc when moist; ascomatal pigments brown, gray present or absent; major constituent almost always stictic acid. ....................................... 16

  • 16

    . Ascospores 11.0–12.2 × 5.3–6.0 μm (average of 10 spores); hymenium 60-80 μm tall; ascomata usually not aggregated, growing mainly in one direction, not forming spikes or stars; hymenial brown pigments present, gray pigments lacking; moistened (!) thallus with gray or (rarely) reddish prothallus .........X. erratica

  • 16

    . Ascospores averaging >12 μm long and >6.0 μm wide; ascomata single or aggregated; hymenium (50-)80-130 μm tall; hymenial pigments absent or present, brown to gray; moistened thallus usually not with gray prothallus and never with reddish prothallus ... 17

  • 17

    . Thallus always with confriesiic acid (major), usually also with stictic acid (TLC); ascomata pale beige, upper 1/5 of paraphyses unpigmented or pale brown; ascomata simple or proliferating in two directions, not forming stars; ascospores broad, 12.2–14.1 × 6.8–8.4 μm (average of 10 spores). [lead 13: X. vermicularis]

  • 17

    . Thallus with stictic acid, never with confriesiic acid (TLC); ascomata brown to gray, gray pigments often prominent in exciple and upper hymenium; ascomata variable, but usually budding in two to multiple directions, growing out from excipular shell to form spikes or stars; ascospores averaging 12.1–13.5 × 6.2–7.4 μm (average of 10 spores) .....X. hians

  • 18

    . Ascomata growing in one or at most two directions from point of origin, linear and narrowly ellipsoid or with an irregular, flexuose outline. ..........................................................19

  • 18

    . Ascomata growing in two or many directions from point of origin, creating “stars” (examine mature material). ..........................................22

  • 19

    . Ascomata essentially unpigmented: exciples lighter than discs, prominent; upper 1/5 of paraphyses not pigmented. ......X. carneopallida

  • 19

    . Ascomata pigmented: exciples brown, usually not lighter than discs; paraphysis tips conspicuously pigment-capped. ........................20

  • 20

    . Hymenium strongly infused above with gray pigment, discs thus essentially black; ascospores narrow, averaging 10.9–12.7 × 3.3–4.5 μm. ..............................................X. stenospora

  • 20

    . Hymenium pigmented brown or with slight tinge of gray, or unpigmented; ascospores averaging >4.5 μm wide or if narrower then >12.5 μm long. .............................................21

  • 21

    . Ascomata irregular, with flexuose margin prominent in young ascomata, brown to pale creamish, forming loose colonies; ascospore L/W ratio 2.74±0.74, averaging 4.1–6.1 μm wide (measure 10 ascospores); exciple internally full of crystals and POL+; hymenium inspersed with scattered POL+ crystals or guttulae; ascomata and adjacent thallus in section KOH+ yellow-orange, forming red needles (norstictic acid); conidia 14–19 μm long. ........ ........................................................X. difformis

  • 21

    . Ascomata ±straight, margin straight, brown, narrow, margin sometimes only visible at tips, forming dense regularly spaced colonies; ascospore L/W ratio 2.03 ±0.35, averaging 5.9–7.6 μm wide (measure 10 ascospores); exciple internally with faint POL+ birefringent cell walls but no crystals; hymenium without crystals or guttulae; ascomata and adjacent thallus in section KOH+ yellow or KOH− (stictic acid or no substances); conidia 9–14 μm long. ....................................... X. parallela

  • 22

    . Ascomatal margins prominent, flexuose, pale creamish, lighter than disc, persistent; ascomata usually in ±linear groups, discs often characteristically fragmented, often forming chains of broken hymenia; thallus with pale creamish goniocysts; with dominant norstictic acid (KOH+ bleeding orange-red crystals) in thallus or at least in ascomatal margin.............. ...................................................... X. rubescens

  • 22

    . Ascomatal margins inconspicuous, straight, brownish, usually ±concolourous with disc, usually receding and ascomata becoming apparently emarginate; ascomata often forming star-like groups, discs not fragmented, remaining continuous or with few irregular breaks in old ascomata; thallus often with brown goniocysts; with stictic acid and ±accessory norstictic acid (KOH+ oozing yellow in section, occasionally also with some red crystals). ...........................................................X. pallens

Xylographa bjoerkii T. Sprib., sp. nov. (Fig. 2) Mycobank No.: MB 805255

Fig. 2. Xylographa bjoerkii T. Sprib.

Fig. 2

A, arrangement of ascomata and goniocysts on bare wood; B, ascomata, in water; C, section through ascoma, in LCB; D, conidia, in water. A, C, D: Canada, British Columbia, Björk 14570 (UBC, DNA voucher 2422); B, holotype. Scale bars: A, 0.2 mm; B, C, 50 μm; D, 10 μm.

Similar to X. disseminata, but ascospores shorter, thallus reduced and containing confriesiic acid as major secondary metabolite; algae lacking in immediate vicinity of ascomata, but alga-containing goniocysts scattered between ascomata.

Type: Canada: British Columbia, Coast Ranges, Bute Inlet, Homathko Valley, 117 km NNE of Campbell River, Smith Creek waterfall on west side of valley near Brew Creek; 51°01.532’N, 124°58.343’W, lignicolous on Thuja plicata log in waterfall spray zone, 45 m elev., 15 Sept 2009, C.R. Björk 19856 (UBC, holotype; CANL, isotype).

Etymology: Xylographa bjoerkii is named for Curtis Björk, originally of Spokane, Washington, in recognition of his outstanding contributions to botany in western North America, and his collection of original material of this species.

Ascomata with lateral growth of trunciseda-type, with limited “budding” from parent ascomata; form angular, variably broadly or narrowly ellipsoid, strongly constricted basally, (0.18–)0.24–0.45 × 0.09–0.18 mm, L/W ratio 2.66±0.86; disc strongly concave, dark brown to black, matte, with thick, light to dark brown to black, flexuose margin; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface in section, often strongly thickened, 15–75 μm wide; excipular hyphae pigmented brown externally, with expanded, almost bulbous, strongly dark brown-pigmented terminal cells to 4 μm diam., exciple lacking crystals but internally with weakly birefringent cell walls; hypothecium 70–120 μm deep, hyaline; hymenium 50–80 μm deep, pale brownish to hyaline, hemiamyloid (ILugols+ greenish blue → rust red); consisting of asci 45–65 × 11–12 μm embedded in a matrix of thin, branched and anastomosed paraphyses ca. 1.0–1.5 μm at midpoint, distally thickened to 4–5 μm in the apical cell, with brown and sometimes also gray wall pigments; ascospores 8/ascus, hyaline, old spores occasionally olivaceous or brownish, simple, rarely apparently 1-septate, ellipsoid, (10–)11.6–13.2(–15) × (4.5–)5.6–6.8(–8) μm (L/W ratio 2.04±0.23) (n = 32). Conidiomata seen in one specimen, occurring in a separate zone from ascomata, adnate, cupular, with wall of laterally interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal gray or gray-black to brown wall pigments; conidia filiform, curved, 10 × ca. 0.5 μm. Sterile hyphae intercalated among xylem cells, irregularly forming darkly pigmented goniocysts 30–65 μm diam, these surficial or immersed. Associated algae chlorococcoid, 6–8 μm diam.

Chemistry: confriesiic acid only.

Substrate affinity: on wood (almost certainly of conifers), including on maritime driftwood.

Macroecology: maritime coastal rainforests and open salt marshes, 0–600 m.

Xylographa bjoerkii is a rarely collected species from the hypermaritime coast of western North America. Without secondary chemistry results it can be difficult to distinguish from some forms of X. hians. It is the only species of Xylographa with confriesiic acid in which the terminal cells of the paraphyses and excipular hyphae are expanded and the ascomata develop deeply concave discs with thickened excipula (Fig. 2B see also Table 3, p. 43). The thallus in X. bjoerkii is sparse and consists of goniocysts 10–40 μm in diametre, which may be visible only upon wetting or in section. Xylographa bjoerkii may be related to the unlichenized species X. constricta and it is conceivable that X. bjoerkii is only facultatively lichenized.

Table 3.

Diagnostic characters in esorediate lichenized species with short ascomata

X. bjoerkii X. disseminata X. erratica X. hians X. lagoi X. opegraphella X. trunciseda X. vermicularis
Ascomata regeneration two, regenerating from ends two to multiple, regenerating from both ends of dead ascomata mostly regenerating from one end and thus unidirectional two to multiple, regenerating from both ends of dead ascomata regeneration not observed two to multiple, regenerating from both ends of dead ascomata two, regenerating from ends two, regenerating from ends
As coma length/width ratio (mean±SD) 2.66±0.86 2.43±0.72 2.84±1.18 1.84±0.89 - 2.56 ±1.04 2.22±0.48 2.19±0.57
Birefringence in exciple (POL+) inner exciple lacking inner exciple inner exciple to whole exciple - inner exciple inner exciple inner exciple to whole exciple
Hymenial pigments brown and gray ±unpigmented brown brown, usually also gray, abundant in young portions of ascomata brown and gray brown and sometimes gray pale brown ±unpigmented
Hymenial amyloidity hemiamyloid hemiamyloid hemiamyloid hemiamyloid - hemiamyloid or euamyloid hemiamyloid hemiamyloid or euamyloid
paraphysis terminal cells expanded to 5 μm expanded to 3 μm scarcely expanded scarcely expanded expanded to 7 μm expanded to 5 μm expanded to 3.5 μm not expanded, unpigmented
Mean ascospore length (μm) 11.6–13.2 15.9–18.2 11.0–12.2 12.1–13.5 9.5 9.4–11.3 10.1–11.3 12.2–14.1
Mean ascospore width (μm) 5.6–6.8 5.7–6.4 5.3–6.0 6.2–7.4 6 3.4–3.9 5.2–6.1 6.8–8.4
As cospore L/W ratio (mean±SD) 2.04±0.23 2.43±0.72 2.09±0.35 1.84±0.89 1.18–2.03 2.92±1.04 2.22±0.48 1.77±0.2
Thallus sparse, immersed algal plugs immersed algal plugs, breaking out into abundant granules immersed algal plugs, sometimes developing areoles to 0.4 mm and distending wood fibres immersed algal plugs sparse, immersed algal plugs variable, immersed algal plugs to robust surface thallus immersed goniocysts immersed algal plugs, sometimes developing endoxylic areoles and distending wood fibres
Gonio cysts present present (granules) absent absent present absent present, immersed, very rarely surficial occasionally produced in “soralia”
Major substances confriesiic acid fatty acids (major), confriesiic acid stictic (norstictic) stictic (norstictic) thamnolic acid norstictic and/or stictic acids confriesiic acid confriesiic and stictic acids
Distribution Pacific North America Eastern North America Boreal, North America, Europe, Asia Pacific North America Spain Northern maritime coasts Boreal-montane, North America, Europe, Asia Pacific Rim of Asia, North and South America

Additional specimens examined: Canada: British Columbia, Southgate River near Bishop confluence, no date, C.R. Björk 14570 (UBC); U.S.A.: Alaska, Glacier Bay National Park and Preserve, Taylor Bay in Icy Straits, lignicolous on beach log, 9 Aug 2012, T. Spribille 39752 & A. Fryday (GZU); Oregon, Douglas Co., Coast Range 12 km W of Winston, Irwin Rocks, Bushnell-Irwin Rocks Research Natural Area, 43.124°N, 123.561°W, [lignicolous] on gnarly old Pseudotsuga, 600 m, 6 Dec 2006, B. McCune 28535 (herb. McCune).

Xylographa carneopallida (Räsänen) T. Sprib., comb. nov. (Fig. 3) Mycobank No.: MB 805264

Fig. 3. Xylographa carneopallida (Räsänen) T. Sprib.

Fig. 3

A, habit and arrangement of ascomata; B, section through ascoma, in water; C, hymenium showing immature asci and thin, filamentous paraphyses, in water; D, ascospores, in water. All photos from Canada, Yukon, Spribille 28528 (GZU, DNA voucher 1024). Scale bars: A, 0.5 μm; B, 20 μm; C, D, 10 μm.

Xylographa rubescens var. carneopallida Räsänen, Ann. Bot. Soc. Zool.-Bot. Fenn. Vanamo 12(1): 181 (1939). Type: Finland: S[avonia] b[orealis], Kuopio, Tiiholankylä, Vehmasjärvi, 26 Jul 1909, K. Linkola (H, holotype!). The type specimen consists of two pieces of wood with a mixture of Xylographa parallela s .str., X. trunciseda and, on the outside parts of the fragment, two thalli of X. carneopallida. These have lighter ascomata than the rest of the sample and were obviously tested previously with KOH, and are considered the holotype. The smaller piece of wood contains only X. parallela and X. trunciseda.

Ascomata with lateral growth of parallela-type, not proliferating through “budding” ascomata, continuously growing in opposite directions, form linear, 0.66–2.1 × 0.12–0.24 mm, L/W ratio 2.75–17.5 (absolute measurements); disc flat, beige to pale brown, matte, with thin, white, straight, persistent margin; exciple appearing paraplectenchymatous in vertical section, 18–45 μm wide laterally; excipular hyphae unpigmented, filled with POL+ crystals throughout entire exciple; hypothecium 70–80 μm deep, hyaline; hymenium 80–90 μm deep, hyaline, inspersed with scattered POL+ crystals or guttulae, euamyloid (ILugols+ royal blue), consisting of asci 63–75 × 8–10 μm embedded in a matrix of slender paraphyses 1.5–2 μm wide at midpoint, not thickened apically and unpigmented; ascospores 8/ascus, ellipsoid, (9.5–)11.4(–13) × (4.5–)5.3(–6) μm (L/W ratio 1.9–2.4) (n = 10). Conidiomata not seen. Sterile hyphae mostly lichenized, confluent around clumps of algae, rimose, lumpy with convex areoles, to 70 μm thick; lacking goniocysts. Associated chlorococcoid, 8–12 μm diam.

Chemistry: norstictic and stictic acids in apparently ±equal amounts.

Substrate affinity: on wood (logs).

Macroecology: in boreal and upper montane forests, too disjunct to generalize.

Xylographa carneopallida is an enigmatic species, the only member of the genus with parallela-type ascomata lacking ascomatal pigments. Its long ascomata suggest a member of the X. parallela group, but molecular data from a sample collected in the Yukon suggest it occupies a position outside of, and possibly ancestral to, both that group and X. opegraphella. Räsänen (1939) described it as a variety of X. rubescens, but it differs from that species in its long, narrow, firmly attached ascomata that do not detach or fragment, and the complete lack of dark pigments. It appears to be a rare but widespread species; it is known to us only from the type and one collection each from Alaska, New Hampshire, the Yukon and Russia.

Additional specimens examined: Canada: Yukon, banks of LaBiche River north of Kootaneelee natural gas facility, 60°09.081’N, 124°04.906’W, 379 m, 26 Aug 2008, T. Spribille 28528 (GZU); same locality, same date, C. Miller, T. Spribille & C. Printzen 10763 (FR); Russia: Khabarovskiy Kray, Bureinskiy Zapovednik, upper reach of the Pravaya Bureya River, Tsarskaya Doroga, ca. 650 m N of patrol cabin ‘Staraya Medvezhka’, 25 km SE of Sofiysk and 2.6 km N (upstream) of the patrol cabin ‘Novaya Medvezhka’, 52°09.002’N, 134°19.035’E, 872 m, 02 Aug 2009, T. Spribille 31772 (H); U.S.A.: Alaska, Fairbanks-North Star Borough, ca. 49 km ENE of Fairbanks, Chena River State Recreation Area, along main road, near start of Compleau Trail, 64°45.338’N, 148°22.921’W, 278 m, 11 Aug 2008, T. Spribille 27432 & C. Miller (GZU); [New Hampshire,] White Mtns, H. Willey (FH).

Xylographa constricta T. Sprib., sp. nov. (Fig. 4) Mycobank No.: MB 805256

Fig. 4. Xylographa constricta T. Sprib.

Fig. 4

A, arrangement of ascomata forming constricting ring, creating raised areas of wood fibre; B, detail of ascomata; C, hand section through ascoma and wood substrate; D, asci with immature ascospores, in ILugols after preteatment with KOH. All photos from holotype (DNA voucher 1147). Scale bars: A, 1 mm; B, 0.2 mm; C, 50 μm; D, 10 μm.

Ascomata similar to those of X. disseminata, narrow with thinly exposed discs, arising in small groups and growing concentrically outwards, squeezing wood fibres together into a raised “hill”. Sterile hyphae not associated with algae.

Type: Chile: Prov. Antártica Chilena, Comuna Cabo de Hornos, Parque Nacional Alberto de Agostini, N shore of Isla Hoste, SE end of Península Cloué, S end of Estero Fouque, S shore of stream that drains Lago Covadonga, 55°10’59”S, 69°34’50”W; boulder field just ESE of glacier, on lignum, 21 Jan 2012, W.R. Buck 58580 (NY, holotype).

Etymology: named for the ascomata, which form a ring and give the appearance of constricting or squeezing wood fibres together in its centre.

Ascomata appearing as narrow slits, apparently beginning as a single ascoma and then radiating outwards, ultimately forming a ring, in the centre of which wood grains become squeezed together into a shallow “hill”; form of ascomata narrowly angular, tips acuminate, 0.24–0.42 × 0.06–1.2 mm, L/W ratio 2.5–4.7 (absolute measurements); disc concave, dark brown, matte, with thin brown margin; exciple paraplectenchymatous in vertical section, in lower part integral with and incorporating xylem cells (Fig. 4C), 18–22 μm wide laterally; excipular hyphae pigmented brown externally; hypothecium 60–70 μm deep, pale reddish brown; hymenium 60–65 μm deep, pale hazy brown throughout, euamyloid (ILugols+ blue, turning violet when flushed with KOH), consisting of asci 70–97 × 15–18 μm mingled with sparsely branched paraphyses ca. 2.5 μm at midpoint, distally thickened to 3–4 μm in the apical cell, with brown wall pigments; ascospores 8/ascus, ellipsoid, (12–)13.4(–16) × (6–)7.0(–7.5) μm (L/W ratio 1.7–2.3) (n = 12). Conidiomata ca. ¾ immersed, globose, wall hyphae with internal brown and gray pigments; empty in the only specimen seen, conidia not seen. Sterile hyphae not lichenized, intercalating with wood hyphae.

Chemistry: no substances detected.

Substrate affinity: on bleached wood.

Macroecology: from glacial forelands in Cape Horn.

Though known so far only from a single collection, Xylographa constricta is one of the most distinctive members of the genus, its characters and DNA evidence so clear that we feel it warrants description based on even scant material. Its ascomata form concentric “fairy rings” that appear to squeeze the wood fibres and raise them into small heaps (Fig. 4A, B). It is also the only known member of the genus not to be associated with algae, supporting the hypothesis of reversion to saproby in Xylographa.

Xylographa difformis (Vain.) Vain. (Fig. 5)

Fig. 5. Xylographa difformis (Vain.) Vain.

Fig. 5

A, B, C: habit and arrangement of ascomata and thallus; D, section of hymenium showing thickened terminal portions of paraphyses and ascospores; E, habit of the type specimen of Xylographa crassithallia Ryan & Nash (ASU); F, habit of the type specimen of Xylographa pruinodisca Ryan & Nash (ASU). A, D, lectotype of X. difformis (TUR-V 29123); B, Canada, British Columbia, Spribille 20110 (GZU, DNA voucher 2421); C, British Columbia, Spribille 25050 (GZU, DNA voucher 2404). Scale bars: A, E, F, 1 mm; B, C, 0.5 mm; D, 10 μm.

Ann. Acad. Scient. Fennicae, ser. A, 27(6b): 106 (1928). Xylographa parallela var. difformis Vain., Med. Soc. Fauna Flora Fenn. 10: 148 (1883). Type: [Finland: Ostrobottnia kajanensis], Kuhmon kirkko. Varjoisella seinällä [= Kuhmo church, on shaded wall], 1877, E. Vainio (TUR-V 29123, lectotype, second piece from left, designated here!). TLC: norstictic acid only.

= Xylographa pruinodisca B.D. Ryan & T.H. Nash, Lichen Flora of the Greater Sonoran Desert Region 2: 615 (2004). Type: U.S.A.: Arizona, Cochise Co., Chiricahua Mountains, north slope of Monte Vista Peak along Turtle Creek Trail, 31°49’45”N, 109°18’30”W, 2770 m, on wood, 4 Sept 1983, T.H. Nash 21049 (ASU-563143, holotype!). TLC: norstictic acid only.

?=Xylographa crassithallia B.D. Ryan & T.H. Nash, Lichen Flora of the Greater Sonoran Desert Region 2: 613 (2004). Type: U.S.A.: Arizona, Apache Co., Sunrise ski area, Fort Apache Reservation, spruce-fir forest, on rotten wood, elevation 9200’, 29 Aug 1975, T.H. Nash 11694-a (ASU-563144, holotype!). TLC: no substances detected.

Ascomata with lateral growth of parallela-type, not proliferating through “budding” ascomata; form angular, irregular, variably broadly or narrowly ellipsoid, 0.36–1.2 × 0.09–0.3 mm, L/W ratio 4.12±2.09; disc flat to convex, brown, matte, with thin brown to pale cream, flexuose margin, prominent in young ascomata, quickly receding in older ascomata; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface in section, often strongly thickened, 22–80 μm wide; excipular hyphae pigmented brown externally, filled with POL+ crystals; hypothecium 70–150 μm deep, hyaline or pale hazy yellowish; hymenium 50–100 μm deep, pale hazy yellow-brown throughout, interspersed with scattered POL+ crystals or guttulae, euamyloid (ILugols+ royal blue) in all samples studied, consisting of asci 37–70 × 11–20 μm embedded in a matrix of stout, sparsely branched paraphyses 2.5–4 μm at midpoint, distally moniliform and thickened to 4–6(–6.5) μm in the apical cell, with brown and sometimes also gray wall pigments; ascospores 8/ascus, narrowly ellipsoid, (10.0–)12.4–14.5(–20) × (3–)4.1–6.1(–7) μm (L/W ratio 2.74±0.74) (n = 55). Conidiomata seen in three specimens, adjacent to ascomata but tending to occur in ±elongated, segregated zones, adnate, cupular, with wall of laterally interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal gray or gray-black to brown wall pigments; conidia long-filiform, curved, 14–19 × ca. 0.5 μm. Sterile hyphae mostly lichenized, becoming confluent around clumps of algae, lacking goniocysts; sometimes appearing rimose or scurfy. Associated algae trebouxioid, 8–18 μm diam.

Chemistry: norstictic acid only or stictic acid and submajor to trace amounts of norstictic acid.

Substrate affinity: on wood, especially of snags.

Macroecology: in continental boreal and high elevation, montane conifer forests; in Finland in boreal lowlands, in western North America at altitudes of 1000–2200 m.

There are three specimens from Finland in TUR-V under the name X. parallela var. difformis, that correspond to localities in the protologue (Vainio 1883). They all appear to belong to the same species. Of these, the specimen from Kuhmo is the richest and is designated here as the lectotype. The specimens closely correspond to DNA vouchers sampled in western North America for the present study in the non-breaking excipular-hymenial transition (indicating it is not a member of the X. opegraphella group), the strongly thickened and pigment-capped paraphysis tips, and the proportionately long and narrow ascospores. Xylographa difformis is similar to X. rubescens and like that species, it usually contains norstictic acid as its main secondary substance (see Table 4, p. 54 for a comparison of this species with other members of the X. parallela group). It can be distinguished from X. rubescens by its long, narrow ascospores averaging 12.4–14.5 × 4.1–6.1 μm, L/W ratio 2.74±0.74 (10.8–12.5 × 5.5–6.7, L/W ratio 1.98±0.33 in X. rubescens), euamyloid, ILugol’s+ blue hymenium (I+ green turning rust red in X. rubescens), stout paraphyses and pigment-capped paraphysis tips (paraphyses thinner and lacking pigment-capped tips in X. rubescens), and finally its plain brown, receding margins (rarely pale and thick; margins prominent, persistent and paler than disc in X. rubescens). Xylographa difformis appears not to be closely related to X. rubescens and forms a distinct clade together with the goniocyst-bearing species X. septentrionalis. Confusion with X. opegraphella is also conceivable, but that species has shorter and narrower ascospores, 9.4–11.3 × 3.4–3.9 μm. Xylographa difformis is likely to be difficult to detect in the field because most thalli look like a poorly developed or parasitized specimen of a member of the X. parallela group. Xylographa difformis may especially be confused with forms of X. pallens, but has a habit of developing contorted ascomata without a clear direction of growth (Fig. 5B), unlike X. pallens, and they do not lift off the substrate. The ascospore L/W ratio is typically also larger than in most other members of the X. parallela group. Xylographa pruinodisca (Fig. 5F) was described from 2800 m elevation in the mountains of Arizona by Ryan (2004a) based on a single specimen, and is tentatively listed as a synonym here. It shares with X. difformis the short, flexuose ascomatal habit (note the scale bar in Ryan 2004a indicates 2 mm but the ascomata, as clearly indicated in the text, are no longer than 0.5 mm), stout, semimoniliform paraphyses and pigment-capped paraphysis tips, receding, brown margins, the long, narrow ascospores 12–20 × 4–6 μm, and the thick, surficial thallus with norstictic acid. The “pruina” in X. pruinodisca are not in fact pruina but unpigmented surface striations, created by paraphysis tips, that give the impression of pruina. Final confirmation that it is conspecific with X. difformis will likely require sampling of a larger range of material (only a single sample of X. pruinodisca is known) and DNA sampling of fresh material from the type locality, something that was not possible in the current study. Xylographa crassithallia (Fig. 5E) is another species described by Ryan (2004a) from Arizona. We were unable to obtain fresh material of this species for molecular sampling. It is similar to X. difformis and the only clear difference between the two appears to be its lack of secondary metabolites. It may ultimately be found to be a synonym of the latter.

Table 4.

Diagnostic characters in species with long, parallela-like ascomata

X. carneopallida X. difformis X. pallens X. parallela X. rubescens X. septentrionalis X. stenospora
Ascomatal regeneration bidirectional, linear irregular, deformed bidirectional, multiple growth tips, old ascomata forming stars mainly unidirectional, often one apothecium end blunt bidirectional, multiple growth tips, old ascomata forming (irregular) stars bidirectional, multiple growth tips, old ascomata occasionally forming weak stars bidirectional, linear, old ascomata tending to become deformed
Ascoma length/width ratio (mean±SD) 2.75–17.5 4.12±2.09 7.79±4.75 5.69±2.56 8.73±7.45 6.89±3.78 3.71±1.33
Ascomatal margin colour and habit pale, lighter than disc, straight brown to pale cream, thin, flexuose brown to cream, ±straight brown brown to cream, flexuose brown to cream, ±straight brown to black, usually “crimped” or flexuose
Birefringence in exciple (POL+) entire exciple full of true crystals entire exciple full of true crystals inner exciple inner exciple entire exciple full of true crystals entire exciple full of true crystals inner exciple
Ascoma “peeling” no no frequently frequently frequently, also fragmenting no no
Hymenial pigments ±unpigmented brown and sometimes also gray brown brown and gray brown and gray brown and sometimes also gray gray and brown
Hymenial amyloidity euamyloid euamyloid hemiamyloid hemiamyloid hemiamyloid hemiamyloid hemiamyloid
Paraphysis terminal cells not expanded expanded to 6 μm expanded to 6 μm expanded to 6 μm expanded to 5 μm expanded to 6.5 μm expanded to 5 μm
Mean ascospore length (μm) 11.4 12.4–14.5 12.3–16.1 11.3–14.5 10.8–12.5 11.9–16.1 10.9–12.7
Mean ascospore width (μm) 5.3 4.1–6.1 5.8–7.2 5.9–7.6 5.5–6.7 5.9–7.8 3.3–4.5
Ascospore L/W ratio (mean±SD) 1.9–2.4 2.74±0.74 2.1 ±0.4 2.03 ±0.35 1.98 ±0.33 2.05±0.41 3.06±0.33
Thallus well developed, white, lumpy endoxylic to well developed, white, lumpy well developed, white, forming lens-like surficial patches consisting of lichenized algal clumps between wood fibres, seldom surficial granular to rimose and lumpy consisting of lichenized algal plugs between wood fibres, breaking out in goniocysts consisting of sparse lichenized algal plugs between wood fibres
Gonio cysts absent absent often present often present usually present constant, abundant, forming soralia absent
Major substances norstictic and stictic acids in ±equal amounts norstictic only or norstictic and stictic acids in ±equal amounts stictic acid (major), norstictic (trace) stictic acid or substances not detected norstictic only or norstictic and stictic acids in ±equal amounts, norstictic localized norstictic only or norstictic and stictic acids in ±equal amounts stictic acid or substances not detected
Distribution Boreal-montane, North America, Europe, Asia Boreal-montane, western North America, Europe Boreal-montane, North America, Europe, Asia Boreal-montane, North America, Europe, Asia Boreal-montane, western North America, Europe, central Asia Boreal-montane, North America Inland western North America

Our knowledge of the distribution of Xylographa difformis is spotty, with a cluster of records from boreal Finland and European Russia, and several specimens from western North America, from about 31°N in the Chiricahua Mountains of Arizona to almost 60°N in the British Columbia-Yukon border region. Most western North American collections are from snags and not from logs, although the data are too sparse to draw any inferences as to its ecology at this point. A specimen in TUR from western Siberia, deposited under this name by Vainio, has similar ascomata to those of the lectotype but possesses distinct areoles that break open apically into salt-and-pepper-coloured soralia, and may represent another undescribed species. Another enigmatic specimen is Poelt s.n., 12.06.1965 (M), from the Lindbergschachten in the Bavarian Forest in southeastern Germany, with ascomata similar to X. difformis but small, blue-greenish thallus areoles unlike any otherwise seen in Xylographa (stictic acid by TLC). Both of these specimens may constitute rare forms or undescribed species from the vicinity of X. difformis, but fresh material is needed.

Additional specimens examined: Canada: British Columbia, East Kootenays, Kootenay River E of Canal Flats, Dry Creek, 04 Aug 2005, T. Spribille 17238 (GZU); NW of province, S of Carcross, B.C. side, White Pass hwy. at Tutshi River, T. Spribille 25050 (GZU); Selkirk Mtns., Silvercup Ridge, T. Spribille 20110 (GZU); Russia: Karelian Republic, Belomorsk District, Vygostrov, 1996, T. Ahti 54300d (H); U.S.A.: Idaho, Shoshone Co., Bloom Peak, weathered snag, Jul 2006, C. Björk 13073 & R. O’Quinn (GZU, UBC).

Xylographa disseminata Willey (Fig. 6)

in Tuckerman, Synopsis of North American Lichens 2: 112 (1888). Type: [U.S.A.: Massachusetts,] New Bedford, H. Willey (FH-00060438, lectotype, designated here; BM, F, G, H-NYL p.m. 6772!, NY, US, isolecto-types). TLC (FH specimen): unidentified fatty acid (major, RF class A2, B4, C3), confriesiic acid (trace).

Ascomata with lateral growth of trunciseda-type, regenerating in multiple directions off the edges of spent excipular shells, ascomatal complexes sometimes forming rings or stars; form angular, variably broadly or narrowly ellipsoid or irregularly lobed, strongly constricted basally, 0.18–0.54 × 0.09–0.18 mm, L/W ratio 2.43±0.72; disc deeply concave, black, matte, when dry almost completely concealed by margins, these thick, black, flexuose, prominent; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, overtopping hymenium surface in section, often strongly thickened, 15–70(–90) μm wide; excipular hyphae pigmented dark brown externally, lacking birefringence; hypothecium 50–150 μm deep, hyaline; hymenium 50–80 μm deep, hyaline, ±hemiamyloid (ILugols+ blue-green → rust red, with localized persistent blue patches), consisting of clavate asci 56–85 × 12–16 μm embedded in a matrix of slender, branched and anastomosing paraphyses 1–2 μm wide at midpoint, distally scarcely thickened, to 3 μm in the apical cell, not or weakly pigmented; ascospores 8/ascus, long-ellipsoid to almost fusiform, (12–)15.9–18.2(–23) × (4.5–)5.7–6.4(–8.7) μm (L/W ratio 2.43±0.72) (n = 33). Conidiomata seen once, partially immersed, globose, 85–110 μm diam, the studied conidiomata empty; conidia not seen. Sterile hyphae forming an extensive, well developed lichenized thallus, consisting of round, isidioid, white granules 0.05–0.12 mm diam, these contained in paraplectenchymatous fungal sheaths, the cells unpigmented; granules occasionally nearly absent and confined to sheltered cracks in the wood. Associated algae Trebouxia, 6.5–13 μm diam.

Chemistry: 1-3 unidentified fatty acid(s) (major), confriesiic acid (trace).

Substrate affinity: on wood, apparently mainly of Cupressaceae; Willey (in the protologue, Tuckerman 1888) reported it from Cupressus wood and we have seen collections from Thuja wood.

Macroecology: temperate forests and on drift-wood in salt marshes in the Atlantic coastal plain of eastern North America, to montane elevations in the Appalachians.

Xylographa disseminata is unique in the genus for its coarse isidioid thallus (Fig. 6A, B), which is sometimes confined to cracks in the wood, the presence of fatty acids in the thallus, and its long, nearly fusiform ascospores (Fig. 6F). It is one of only a few nemoral Xylographa species, and is known in eastern North America from Nova Scotia to North Carolina.

Additional specimens examined: Canada: New Brunswick, S. Clayden 19609 (NBM); Charlotte Co., St. James Parish, M. Shchepanek s.n. (CANL-109941); Nova Scotia, Yarmouth Co., East Barclay Brook, 1999, T. Ahti 57155a (H); U.S.A.: Maine, Bangor, C. Pringle 502 (FH); North Carolina, Haywood Co., southern Appalachians, Great Smoky Mountains National Park, Purchase, 2006, T. Tønsberg 37619 (BG); Vermont, Charlotte, C. Pringle 395 (FH).

Xylographa erratica T. Sprib., sp. nov. (Fig. 7) Mycobank No.: MB 805257

Fig. 7. Xylographa erratica T. Sprib.

Fig. 7

A-D. Habit and arrangement of ascomata, A and C dry, B and D moistened; E, section through hymenium, in LCB; F, detail of paraphyses, in LCB; G, ascus with immature ascospores, in ILugols without pretreatment with KOH. A-B: holotype (DNA voucher 820); C-F, Canada, British Columbia, Björk 14550 (UBC, DNA voucher 2423). Scale bars: A, B, 0.5 mm; C, D, 1 mm; E, 20 μm; F, G, 10 μm.

Similar to and chemically concordant with X. hians, but ascomata developing one at a time in one direction, never developing hyaline flaps, lacking gray pigments, and ascospores 5.3–6 μm wide.

Type: Russia: Khabarovskiy Krai, Bureinskiy Zapovednik, upper reach of the Pravaya Bureya River, 25 km SE of Sofiysk, Tsarskaya Doroga, patrol cabin ‘Novaya Medvezhka’, 52°07.918’N, 134°17.436’E, in stream below cabin and on the slope opposite, lignicolous on logs in Larix gmelinii forest near stream, 880 m, 08 Aug 2009, T. Spribille 32039 & L. Yakovchenko (H, holotype; CANL, GZU, UBC, isotypes).

Etymology: Named for the ascomata, the tips of which point erratically in different directions, instead of being aligned with the grain of the wood.

Ascomata with lateral growth of trunciseda-type, with ascomata regenerating in a single direction from the ends of spent excipular shells, irregularly narrowly to broadly ellipsoid, eccentric, with tips pointing away from main axis of disc, 0.21–0.69 × 0.075–0.3 mm, L/W ratio 2.84±1.18; disc exposed to hidden or exposed only when moist, flat to concave, brown, matte, with thick to thin, pale to dark brown margin; exciple appearing paraplectenchymatous in vertical section, ±flush with the hymenium surface in section, 11–33 μm wide laterally; excipular hyphae pigmented brown externally, internally hyaline with birefringent cell walls (POL+); hypothecium 70–130 μm deep, hyaline; hymenium 60–80 μm deep, hyaline or pale hazy brown, hemiamyloid (ILugols+ blue-green → rust red), consisting of asci 55–75 × (6–)12–15 μm, embedded in a matrix of slender, sparsely branched paraphyses 1–1.5(–2.0) μm at midpoint, distally scarcely thickened, with brown wall pigments; ascospores 8/ascus, ellipsoid, (9–)11.0–12.2(–15) × (4–)5.3–6.0(–7.5) μm (L/W ratio 2.09±0.35) (n = 31). Conidiomata adjacent to ascomata but segregated, ca. ½ immersed, globose, 55–150 μm diam, wall hyphae with internal brown pigments; conidiophores bearing terminal conidia, ca. 7.5 × 2 μm; conidia long-filiform, curved, 15–20 × ca. 0.5 μm. Sterile hyphae permeating wood, becoming lichenized with endosubstratal plugs of algae to 300–600 × 100 μm, becoming confluent, displacing wood fibres when wet and swelling, and given the thallus an “unkempt” appearance; goniocysts not observed. Associated algae chlorococcoid, 9–20 μm diam.

Chemistry: stictic acid (major), rarely trace, norstictic acid trace or absent.

Substrate affinity: on conifer wood.

Macroecology: in humid boreal conifer forests and along coastal beaches, to 880 m elev., currently known from scattered occurrences in northern Europe, NE Asia and western North America between 51° and 60°N latitude.

Xylographa erratica is similar to X. opegraphella and X. hians and can easily be confused with both. Like X. opegraphella, it can grow on coastal driftwood in the intertidal zone and develop ascomata closely resembling those of X. opegraphella. Unlike that species, however, it also occurs both on coastal driftwood and deep inland in relatively dry forest habitats, especially in the continental boreal forests of the Russian Far East, where it can be abundant. It is characterized by the following combination of characters: small, football-shaped ascomata that tend to occur singly and have a single direction of growth; brown pigmentation without any hint of gray; the ascospores 5–6 μm wide; the presence of stictic acid in the thallus; the habit of the thallus to develop areoles just below the first layer of wood fibre, eventually swelling and distending the fibre, creating a cracked, unkempt appearance; and finally the presence of a visible hypothallus. The habit of developing below and eventually distending the wood fibre is similar to X. vermicularis, but that species can be separated from X. erratica by its larger ascospores, lack of hymenial pigments and the constant presence of confriesiic acid (in addition to stictic acid; see Table 3, p. 43 for a trait-by-trait comparison).

Three specimens of X. erratica from the intertidal zone were found to develop a hypothallus or thalline ring with a KOH+ purplish substance, possibly an anthraquinone, leaving a pink stain on the wood at the edges of the thallus. The identity of at least one of these (isolate P99) as X. erratica has been confirmed through DNA. The ascomatal discs of X. erratica may remain open when dry or collapse, recalling the habit of X. opegraphella, and it may be necessary to moisten specimens to gain a full impression of their habit (Fig. 7B, D).

In Europe, X. erratica has been confused with X. trunciseda; Brodo (1992) cites a specimen from Vězda’s Lichenes Selecti Exsiccati as being “aberrant” X. trunciseda. Xylographa erratica can be separated from X. trunciseda by the presence of stictic acid, ascomatal tips pointing in apparently random directions (as opposed to being aligned with the wood grain as in X. trunciseda), and the thallus, which is strongly scurfy from developing robust areoles below the wood surface and lifting it off (as opposed to the filmy, smooth thallus surface and subsurficial goniocysts in X. trunciseda).

Exsiccate: Sweden: Värmland, Vězda, Lich. Selecti Exs. 2100 (BM!, GZU!, H!, M!, as X. trunciseda).

Additional specimens examined: Canada: British Columbia, Coast Ranges, Homathko Estuary South, 15 Jun 2007, C.R. Björk 14550 (UBC); Finland: Regio aboensis, Lokala[hti], 21 Jul 1882, H. Hollmén & V. Sederholm (H, KW); Rovaniemi, 8 Jun [19]21, V. Räsänen s.n. (H); U.S.A.: Alaska, Kodiak Island, T. Tønsberg 15582 (BG: form with anthraquinones); Glacier Bay National Park, Icy Straits, Fern Harbor, T. Tønsberg 41775, 41775a (BG: form with anthraquinones).

Xylographa hians Tuck. (Fig. 8)

Synopsis of North American Lichens 2: 113 (1888). Type: [U.S.A.:] Washington Terr[itor]y, W. N. Suksdorf (FH-00370115!, lectotype, designated here; FH-00370116, H-NYL p.m. 6771!, UPS, US [image!], isolectotypes). TLC (FH specimens): stictic acid (major), norstictic acid (trace).

= Xylographa micrographa G. Merr., Ottawa Naturalist 27: 121 (1913). Type: [Canada: British Columbia], Surrey, J. Macoun (FH-00370117, holotype!). TLC: stictic acid (major), norstictic acid (trace).

Ascomata with lateral growth of trunciseda-type, regenerating from the edges of spent excipular shells in multiple directions, to form chains or stars, broadly ellipsoid, 0.21–0.45(–0.6) × 0.09–0.27 mm, L/W ratio 1.84±0.89; disc widely exposed, flat to concave, brown to ochre gray, matte, with thin brown to gray or pale cream, flexuose margin, often with overhanging chartaceous “flaps”, occasionally margin inconspicuous; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, overtopping the hymenium surface in section, 15–30(–40) μm wide; excipular hyphae pigmented brown and/or gray externally, internally or wholly with birefringent fungal cell walls (POL+); hypothecium (40–) 60–150 μm deep, hyaline; hymenium easily separating from exciple in gentle water squash, 50–130 μm deep, hyaline, hemiamyloid (ILugols+ blue-green → rust red), consisting of clavate asci 55–110 × 12–15 μm embedded in a matrix of slender, sparsely branched, gangly paraphyses 1.2–2 μm wide at midpoint, not or scarcely distally thickened, with brown and sometimes also gray wall pigments; ascospores 8/ascus, ellipsoid, (10.0–)12.1–13.5(–17) × (5.2–)6.2–7.4(–9) μm (L/W ratio 1.84±0.89) (n = 64). Conidiomata common, dark gray or black, segregated from ascomata and often ringing “thallus” margins, ca. ½ immersed, globose, 60–105 μm diam, with wall of laterally interwoven hyphae ca. 10 μm thick, appearing paraplectenchymatous in section; hyphae with internal gray and some brown wall pigments; conidia long-filiform, falcate, 11–18 × 0.3–0.5 μm. Sterile hyphae at least sometimes amyloid, ILugols+ blue in patches below ascoma, permeating wood, becoming lichenized with endosubstratal plugs of algae up to 0.7 mm below the wood surface, plugs 160–370 × 50–90 μm, goniocysts not observed. Associated algae chlorococcoid, 7–17 μm diam.

Chemistry: stictic acid (major), rarely (Macoun 209, FH) norstictic acid (major) and stictic acid (submajor).

Substrate affinity: on wood of conifers and Quercus garryana.

Macroecology: in temperate to boreal conifer forests of North America, from sea level to over 500 m.

Xylographa hians is a widespread species distributed on wood in the coastal temperate and boreal rainforest of the northwest North American coast. When well developed, X. hians can be distinguished from all other species of Xylographa by the combination of short ascomata, long, wide ascospores and abundant gray pigments, the latter especially in pycnidia and the excipula of new ascomatal initials. However, the species as treated here encompasses some confounding variability (Fig. 8A-D). In northern coastal regions (Haida Gwaii to the Aleutians) as well as at higher elevations farther south, the ascomata are easily recognizable by the gray pigments and the presence of a chartaceous excipular flap over the discs of many ascomata. In the southern part of its range, X. hians occurs on Quercus garryana and Pseudotsuga wood in thermophilous lowland forests; ascomata in these areas may be compound and a few lack gray pigments. These forms include the type of X. micrographa G. Merr. from lower mainland British Columbia (Merrill 1913). These southern forms can be difficult to separate from X. erratica, but they nearly always proliferate in two to more directions from the margins of a dead, central ascoma (as opposed to X. erratica, in which they are single and grow in one direction), and in nearly all specimens some gray pigment can be found (never present in X. erratica). Diagnostic characters of these species and X. opegraphella are compared in Table 3. Xylographa hians is one of the few species to regularly produce abundant conidiomata on the same thallus as the teleomorph, albeit segregated. In X. hians they are produced at the outer edge of the thallus and are rich in gray pigment, forming concentric rings of black dots at some distance from the centre of the thallus (Fig. 8E).

We have seen two specimens that closely resemble Xylographa hians from southern Chile which possess grayish ascomatal pigments and stictic acid. However we have not been able to verify beyond doubt that they can be assigned here barring DNA analysis. Further collecting in the Nothofagus forests of extreme southern Chile may prove this to be another bipolar species.

Exsiccates: Canada: British Columbia, Brodo, Lich. Can. Exs. 149 (BG!, BM!, as X. parallela); U.S.A.: California, California Fungi 850 (F!, H!, as X. parallela).

Additional specimens examined (X. hians): Canada: British Columbia, Vancouver Island, Sidney, 1913, J. Macoun 209 (FH); Queen Charlotte Islands, Moresby Island, Tasu, 1980, T. Ahti 38956 (CANL); Prince Rupert area, N shore of Skeena River, 02 Sept 1991, T. Goward 91-1583 & H. Knight (UBC); U.S.A.: Alaska, Mitkof Island, 2011, T. Tønsberg 41139 (BG); Aleutian Islands, Unimak Island, 27 Aug 2011, T. Ahti & S.S. Talbot 70438 (H); Oregon, Polk Co., Rickreall Ridge, 11 Mar 1992, B. McCune 19503 (UBC); Washington, Klickitat Co., near Husum, 21 Jun 1894, W.N. Suksdorf 403 (WSU); Whatcom Co., Mt. Baker[-Snoqualmie] National Forest, Sulfur Creek Lava Flow, 460–550 m, 29 Mar 1992, T. Ahti 51006 & F. Rhoades (H).

Additional specimens examined (X. aff. hians): Chile: Region X, Parque Nacional Puyehue, Antillanca, 40°46’S, 72°12”W, 1100-1500 m, 2 Dec 1986, B.J. Coppins, D.J. Galloway, G. Guzmán & P.W. James 4573 (BM); Prov. Antártica Chilena, Comuna Cabo de Hornos, Parque Nacional Alberto de Agostini, N shore of Isla Gordon, extreme SW end of Bahía Romanche, 54°58’07”S, 69°32’13”W, coastal Nothofagus betuloides forest with small waterfalls and landslide, 31 Jan 2012, W.R. Buck 59086 (NY).

Xylographa isidiosa (Elix) Bendiksby & Timdal (Fig. 9)

Taxon 62:952 (2013). Hypocenomyce isidiosa Elix, Mycotaxon 94: 219 (2005). – Type: Australia: Western Australia, Avon district, Charles Gardner Flora Reserve, central track, 20 km SW of Tammin along old York Road, 31°47’24”S, 117°28’07”E, alt. 305 m, on dead, charred wood in Eucalyptus woodland with Casuarina and Acacia in shallow gully, 22 April 2004, Elix 31849 (PERTH, holotype, not seen; CANB, isotype, seen by Bendiksby & Timdal 2013).

Ascomata and Conidiomata not seen. Sterile hyphae lichenized, associated with algal plugs developing endosubstratally in the wood fibre, internally prosoplectenchymatous and mixed with algae, externally all areas of thallus covered in a thin to thick layer of goniocysts, these grouping into plates or areoles 450–650 μm; goniocysts consisting of tightly packed algae surrounded by brown, angular, paraplectenchymatous fungal hyphae, in total 25–50 μm diam, easily dislodged and free in water squash preparations, macroscopically pigmented dark brown. Associated algae chlorococcoid, 7–11 μm diam.

Chemistry: confriesiic and friesiic acid (Elix 2005).

Substrate affinity: on charred wood.

Macroecology: known only from Western Australia.

This species, described by Elix (2005), is only known without ascomata, and was recently transferred to Xylographa based on molecular data by Bendiksby & Timdal (2013). Its thallus form and goniocysts (Fig. 9) are similar to those of the Northern Hemisphere species X. septentrionalis but are more continuous and thicker. It strongly resembles a Placynthiella (e.g., P. icmalea) in habit and could easily be overlooked as such.

Specimen examined: Australia: Western Australia, Caernarvon Hills, Dryandra Woodland, 17 km NW of Narrogin, 32°48’21”S, 117°03’21”E, 325 m, 6 Apr 2006, J.A. Elix 39837 (O).

Xylographa lagoi T. Sprib. & Pérez-Ortega, sp. nov. (Fig. 10) Mycobank No.: MB 805258

Fig. 10. Xylographa lagoi T. Sprib. & Pérez-Ortega.

Fig. 10

A, B, habit; C, section through ascoma (in LCB); D, exciple, in LCB; E, F, paraphyses; G, H, asci with immature ascospores, in ILugols without preteatment with KOH; I, J, K, ascospores. All photos from holotype (DNA voucher 162). Scale bars: A, 2mm; B, 0.5 mm; C, 50 μm; D, 10 μm; E–H, 5 μm; D, 10 μm; I–K, 2.5 μm.

Species with black ascomatal disc and white, internally unpigmented excipulum and thick thallus, with thamnolic acid as the main secondary metabolite.

Type: Spain: Asturias, Cangas del Narcea, Reserva de la Biosfera de Muniellos, Muniellos Mount, Quercus petraea forest along Fuenculebrera trail, 43°02’02”N, 06°41’59”W, on fallen, decorticated branches of Quercus petraea, 1156 m, 04 May 2009, S. Pérez-Ortega 1975, T. Spribille & V. Wagner (MAF, holotype; GZU, isotype); same locality, same day, T. Spribille 30267 (H, UPS, topotypes).

Etymology: The new taxon is named in memory of Manuel Lago ‘Chiquito’, a ranger for the forest service in the Muniellos Nature Reserve, who was murdered by poachers in 1980 while working in the Reserve.

Ascomata frequent, elongated, up to 0.3 mm wide, forming star-like clusters up to 1.2 mm in diam; disc flat to slightly concave, dark brown; exciple white, thin, up to 50 μm wide, inner exciple more or less thick, up to 90 μm, outer part tinged by brownish pigment, inner part paraplectenchym-atous and composed of thin-walled hyphae; hypothecium hyaline; hymenium hyaline, up to 100 μm high, with brown and gray pigments above, becoming dark brown in KOH asci subcylindrical to clavate, 55–80 × 12–16 μm (n = 10), 8-spored, tholus distinct, pale blue in ILugols, paraphyses septate, more or less straight, simple or sparely branched, often anastomosed, 2–3 μm thick, upper cells elongated and in some paraphyses usually much wider, up to 7 μm, with a greenish brown pigment becoming dark brown in KOH; ascospores simple, hyaline, ellipsoid to ovoid, irregularly biseriate, thick-walled (up to 1.5 μm thick), (7.5–) 9.5±0.9 (–11.5) × (5.5–) 6±0.8 (–7.5) μm (ratio 1.18–2.03) (n = 35). Conidiomata not observed. Sterile hyphae forming a crustose, lichenized thallus, mostly episubstratal but endosubstratal in areolate areas or areas lacking goniocysts; areoles convex, usually developing convex soralia; soralia white, rounded and convex, confluent, usually covering several mm2 of the thallus; goniocysts (soredia) rounded, rather coarse, more or less corticate, up to 90 μm in diam, consoredia not observed. Algal cells chlorococcoid, 10–14 μm in diam, forming plugs within the fungal thallus.

Chemistry: thamnolic acid.

Xylographa lagoi was collected on ca. 30 cm diam. fallen, decorticated branches of Quercus petraea. It is only known from the type locality. The Muniellos Preserve is one of the best studied regions of northern Spain for its lichen flora (Barreno & Pérez-Ortega 2003), and despite this the species was not detected prior to 2009. Xylographa lagoi is a striking and instantly recognizable crustose lichen (Fig. 10A, B) and we consider it likely that it would have been reported before if it had been collected, and thus that our single collection represents bona fide rarity. The species is recommended for tracking by the IUCN on account of extreme rarity and paucity of dead wood in managed forests on the Iberian Peninsula. Further surveys are needed.

Xylographa opegraphella Nyl. (Fig. 11–12)

Fig. 11. Xylographa opegraphella Nyl.

Fig. 11

Habit and arrangement of ascomata. All specimens except A (the type) verified to be conspecific based on ITS. A, isolectotype (H); B, Tønsberg 39916 (BG); C, Norway, Timdal 12068 (O); D, Canada, Québec, Spribille s.n. (GZU, DNA voucher 1069); E, U.S.A., Alaska, Spribille 24979 (KLGO); F, Canada, New Brunswick, Spribille s.n. (GZU, DNA voucher 1068). Scale bars: A–F, 0.5 mm.

Fig. 12. Xylographa opegraphella Nyl.

Fig. 12

Anatomy of fertile and sterile forms. A, longitudinal section through sterile ascoma (in water with polarizing filter); B, latitudinal vertical section through ascoma, showing abortive asci and free paraphyses (in LCB); C, section through fertile ascoma with “normal” hymenium, in water; D, sterile hyphae between xylem cell walls showing lichenized and non-lichenized hyphae, in LCB; E, section through fertile ascoma, showing paraphyses and immature asci, in ILugols after pretreatment with KOH; F, conidioma vertical view showing patch of gray pigment around ostiole, in water. A, B, D: Canada, Québec, Spribille s.n. (GZU, DNA voucher 1069); C, Canada, New Brunswick, Lendemer 27781 (M); E, Norway, Timdal 12068 (O); F, Iceland, Orange 17027 (M). Scale bars: A, C, F, 20 μm; B, D, E, 10 μm.

in Rothrock, Proc. U.S. National Museum 7(1): 8 (1884). Type: [U.S.A.:] Alaska, at Cooks Inlet, 1880, Dr. T.H. Bean (F-119631, lectotype, designated here; H-NYL 4721, isolectotype!). TLC (specimen from F): norstictic acid (major), stictic acid (submajor). An additional note on the type specimen in F in an unknown handwriting says ‘From the “spit”, Coal Point, Chugachik Bay, Cook’s Inlet. July 1, 1880. Bean.’ The H-NYL specimen says “Fret. Behring, Alaska at Cooks Inlet, Dr. Bean, 1/vii/1880”, Nylander having erroneously believed Cook Inlet to be in the Bering Straits.

= Opegrapha stictica Tuck. & Fr. in Tuck., Lich. Amer. Sept. Exs. no. 97 (1854) (nom. nud. Art. 38); non Opegrapha stictica (Durieu & Mont.) Nyl., Mém. Soc. Sci. Nat. Cherbourg 2: 335 (1854).

= Xylographa arctica Vain., Ark. Bot. 8(4):154 (1909), nomen illeg., non Xylographa arctica Fuckel (see “excluded taxa”). = Xylographa sibirica Zahlbr., Cat. Lich. Univ. 2: 155 (1922) as nom. nov. Type: [Russia: Magadanskaya Oblast’,] Sibiria sept., Pagum Pitlekai, ad lignum, E. Almquist (TUR-V 29512, lectotype, designated here). TLC (performed by I. Brodo, 3/1993): stictic acid, trace of norstictic, fatty acid A7, B6, C7. This typification establishes the var. arctica and by extension the var. sibirica of Zahlbruckner’s nomen novum. When Vainio (1909) described Xylographa arctica, he distinguished only two varieties, var. incrustans and var. subhians, encompassing the entire variation in the species. Original material labeled var. incrustans (and already annotated in herb. by I.M. Brodo as “var. arctica”, 1993, referring to the Herb. Vainio no. 29095 = TUR-V 29512!) is here designated as the lectotype of var. arctica, and by extension also X. sibirica var. sibirica.

= Xylographa arctica var. incrustans Vain., Ark. Bot. 8(4): 154 (1909), nomen illeg. Xylographa sibirica var. incrustans (Vain.) Zahlbr., Cat. Lich. Univ. 2: 155 (1922 [1924]), nom. illeg. See comment under X. arctica.

= Xylographa arctica var. subhians Vain., Ark. Bot. 8(4): 154 (1909). Xylographa sibirica Zahlbr. var. subhians (Vain.) Zahlbr., Cat. Lich. Univ. 2: 155 (1922 [1924]). Type: [Russia: Magadanskaya Oblast’,] Sibiria sept., Peninsula Jinretlen, ad lignum [E. Almquist] (TUR-V 29511, lectotype, designated here; material is also present in S but was not studied). TLC: (performed by I. Brodo, 3/1993): trace of stictic acid, fatty acid A7, B6, C7. = Xylographa borealis Rehm, Hedwigia 39: 321 (1900). Type: Canada, Newfoundland, Shoal Point, 1896, A. C. Waghorne 205 (S-F5584, holotype, image!)

Ascomata with lateral growth of trunciseda type; first generation ascomata broadly to narrowly ellipsoid or linear, 0.21–0.48 ×0.06–0.21 mm, L/W ratio 2.56 ±1.04, dark brown to castaneous brown, sometimes pale translucent, later generation ascomata regenerating at both ends of necrotic margin and resembling those of the first generation, growing linearly in two directions from mother ascoma or in multiple directions, necrotic shells in old individuals sometimes building up to form encrusted waxy cushions over 200 μm or more thick; exciple of laterally interwoven hyphae, apparently paraplectenchymatous in vertical section, usually overtopping the hymenium surface (forming “flaps”), 14–32 μm wide at widest point, excipular hyphae pigmented brown externally, internally with a distinct layer of unpigmented, birefringent (POL+) but non-crystalliferous hyphae between outer exciple and hymenium; hypothecium hyaline to hazy reddish brown, 30–110(–150) μm deep in section; ascomata with two paths of development: 1) fertile, with exposed dark-brown disc; hymenium 40–70(–90) μm deep, consisting of a matrix of asci 45–72 × 8–11 μm, rooted deep in a tangle of ascogenous hyphae, and simple or sparing branches paraphyses 1.5–2.5 μm at midpoint, thickened to 4–5 μm apically, thin to rather stout, straight to distinctly moniliform, curving at their tips and sprawling over surface of ascoma; hymenium hemiamyloid or euamyloid, ILugols+ blue-green turning rust red or ILugols+ royal blue; hymenium unpigmented or hazy yellowish brown, darkening to dark brown, the paraphysis walls in upper 1/5 infused with brown pigment, usually with additional gray pigment; ascospores present, hyaline, 8/ascus, appearing healthy with intact walls and internal features, narrowly ellipsoid, (9.0–)9.4–11.3(–13.5) × (2.8–)3.4–3.9(–5.0) μm (L/W ratio 2.92±1.04) (n = 70), rarely with distinct plasma bridges resembling septa; 2) sterile, hemiangiocarpic ascomata prematurely shedding the excipular covering along suture lines (easly separating in section in water), resultant ascomata appearing “hollowed out”, in section with scattered longer paraphyses and abundant, abortive asci to ca. 30 μm long; ascospores rarely developed. Conidiomata rare, adjacent to ascomata but segregated, ca. 2/3 immersed, globular, with wall of interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal brown wall pigments, additional gray pigment formed around ostiole; conidia filiform, curved, 9–12 × ca. 0.7–1.0 μm. Sterile hyphae running through interior of necrotic wood grains, contacting concentrated endoxylic plugs of algae (Trebouxia sp.), 100–200 × 60–100 μm; surficial thallus occasionally well developed (as in type), forming convex, cream-coloured areolae 0.12–0.48 × 0.09–0.21 mm; goniocysts not observed.

Chemistry: norstictic and stictic acids, alternating as major and submajor substances, rarely norstictic or stictic acid alone; confriesiic acid rarely present (e.g. Gowan 2062, CANL; Kershaw s.n., CANL).

Substrate affinity: on driftwood affected by ocean saltspray, at least during periodic storms, rare in freshwater habitats.

Macroecology: in the upper intertidal zones of coastlines at latitudes from about 35°N to 70°N, in the Atlantic, Pacific and Arctic Oceans.

Xylographa opegraphella is the most pronouncedly maritime species of the genus, with DNA-verified occurrences on Pacific and Atlantic coasts as well as the Arctic Ocean. It has been considered a fairly straightforward species but its identification may be complicated by the presence of X. erratica, which can occur in the same habitats and is essentially a cryptic species within the X. opegraphella complex (see below). Inland records of X. opegraphella are rare, and usually associated with shorelines or flowing water (e.g. Pringle 364, FH). Not all major shoreline sites are associated with saltwater: locations are also known from Lake Superior, e.g. in the Apostle Islands (Wetmore 60928, CANL). Xylographa opegraphella is a variable species. The ascomata range from closed to open and short to elongate, and ITS sequence data have confirmed they are conspecific. The typical form (Fig. 11A, the type specimen, also Fig. 11B) is easy to identify, but forms exist with straight ascomata that resemble short forms of X. parallela (e.g. Brodo 29630, F, also in part Fig. 11D). It is difficult to distinguish from X. erratica, which also occurs on maritime driftwood, even side-by-side with X. opegraphella. The two are most easily separated by the prominent brown margins in X. opegraphella (often translucent in sterile specimens), its habit of forming multidirectional ascomatal growth, and its short, narrow ascospores rarely >5 μm wide (see Table 3, p. 43). Xylographa erratica by contrast has a scarcely differentiated exciple that does not form conspicuous margins, its ascomata are almost always simple and grow in a single direction, and its ascospores are longer and wider (Table 3). While X. opegraphella is known mostly from maritime driftwood, X. erratica also occurs far inland in upland forests. The thallus of X. opegraphella can also be extremely polymorphic, ranging from surficial and areolate (Fig. 11A, B) to completely immersed (Fig. 11D). Vainio (1909), in describing Xylographa arctica Vain. from the extreme eastern tip of Russia, accorded these status as var. incrustans (with a thick thallus; = var. arctica) and var. subhians (with immersed thallus), noting the similarity of the latter to Willey’s Xylographa hians (Tuckerman 1888). To add to the morphological complexity of this species, Xylographa opegraphella has a propensity to produce sterile, abortive ascomata (Fig. 12A, B). Sterile forms are superficially similar to typical X. opegraphella but instead of developing a gelatinized hymenium they develop a free matrix of simple paraphyses and aborted asci. The paraphysis-ascus matrix is covered by an extended excipular cap that easily erodes and/or separates from the matrix under light pressure in H2O (Fig. 12A). Ascoma genesis happens in that a single ascoma is formed initially, with a paraphysis-ascus matrix developing under an excipular mantle as in immature hemiangiocarpic ascomata. In contrast to the normal development of such ascomata, however, the excipular mantle is fragile and can easily be detached with light pressure under a cover slip, exposing the free paraphyses and abortive asci. These in turn can detach and may serve as dispersal propagules. The resultant, empty ascoma regenerates from the most recent growth tips, developing a new ascoma at each end, in which this process is repeated.

Exsiccates: Canada: New Brunswick, Lendemer, Lich. Eastern North America Exs. 437 (M!); Québec, Macoun, Can. Lich. 72 (BM!, mixed with X. parallela); ibid., Brodo, Lich. Can. Exs. 225 (ALA!, GZU!); Sweden: Västerbotten, Santesson, Lich. Selecti Exs. Upsal. 250 (GZU!, M!); Öland, Vězda, Lich. Selecti Exs. 180 (G!, M!, as X. trunciseda).

Additional specimens examined: Canada: British Columbia, Port Edwards, 2006, T. Spribille 22693 (GZU); New Brunswick, Fundy National Park, S. Gowan 2062 (CANL); Nunavut, East Pen Island area, K.A. Kershaw s.n. (CANL-98552); Finland: Alandia, Eckerö, Storby, vanha tukki rannalla [=old log on shore], 12 Jul 1935, L.E. Kari 12765 (F); Iceland: Norður-Þingeyjarssla, near Þórshöfn, Lambanes, 16 June 2007, A. Orange 17027 (M); Norway: Finnmark, Båtsfjord, W of Hamningberg, S of Skjåvika, 25 Jun 2010, T. Tønsberg 39916 (BG); Vadsø, Krampenes, alt. 5 m, 25 Jun 2011, E. Timdal 12068 (O); Russia: Sakhalinskaya Oblast’, Kuril’skie O[stro]va, Ostrov Shikotan [= Kurile Islands, Shikotan Island], 11 Jul 1965, O. B. Blum s.n. (KW); Ostrov Kunashir [= Kunashir Island], 15 Aug 1965, O. B. Blum s.n. (KW); U.S.A.: Alaska, [Chukchi Sea,] Ogotoruk Creek area, A.W. Johnson et al. 329 (ALA); Amchitka Island, L.W. Sowl s.n. (CANL); Glacier Bay National Park, Muir Point, A. Fryday 10251 (MSC); Massachusetts, New Bedford, 1876, H. Willey (G); Vermont, no locality, C. Pringle 364 (FH); Wisconsin, Ashland Co., Apostle Islands National Lakeshore, Outer Island at southern tip on sand spit, C. Wetmore 60928 (CANL).

Xylographa pallens (Nyl.) Harm. (Fig. 13–14)

Fig. 13. Xylographa pallens (Nyl.) Harm.

Fig. 13

Habit and arrangement of ascomata. A, holotype (H-NYL); B, U.S.A., Montana, Spribille s.n. (GZU; DNA voucher 1060); C-D, Canada, British Columbia, Spribille 17029 (GZU); E-F, Austria, Resl 1143 (GZU, DNA voucher 1150). A, ca. 1 mm; B, D, F, 0.5 mm; C, 1 mm; E, 2 mm.

Fig. 14. Xylographa pallens (Nyl.) Harm.

Fig. 14

A, colony in axenic culture (in vitro in GZU); B, exciple section; C, asci with ascospores; D, conidia and conidiogenous hyphae. B, D: U.S.A., Montana, Spribille s.n. (GZU, DNA voucher 1060); C: Canada, British Columbia, Björk 13789 (UBC). Scale bars: A, 1 mm; B–D, 10 μm.

Bull. Soc. Sci. Nancy, Ser. II 16(34): 47 (1900). Xylographa parallela var. pallens Nyl., Actes Soc. linn. Bordeaux 21: 393 (1857 [“1856”]). Type: [France:] In Vogesis, Dr. Mougeot (H-NYL 4684, lectotype, designated here). TLC: stictic acid.

= Xylographa rubescens var. degelii Räsänen in Ann. Bot. Soc. Zool.-Bot. Fenn. Vanamo 12(1): 182 (1939); Xylographa abietina var. degelii (Räsänen) Makar, Handb. Lich. U.S.S.R. 4: 222 (1977), nom. inval. – Type: [Russia: Murmanskaya Oblast’, Pechenga:] Lt [Lapponia tulomensis,] Petsamo, Mattert–Ala-Köngäs, ad lignum vetust[um], 20 Jun 1931, V. Räsänen (F, neotype, designated here).

Ascomata occurring clustered, with patches of ascomata amid sterile interspaces; lateral growth of parallela type, first generation ascomata linear, 0.5–2.8 × 0.09–0.33 mm, L/W ratio 7.79±4.75, later generation ascomata regenerating at both ends of necrotic margin and resembling those of the first generation, growing linearly in two to many directions from mother ascoma, forming “stars” (Fig. 13); ascomata sometimes “peeling off” when old; disc flat to concave, pale to dark brown, matte, with thin brown to pale margin (rarely completely “bleached” as in X. rubescens), the margin receding in older ascomata; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, usually flush with the hymenium surface in section, 15–35(–50) μm wide at widest point; excipular hyphae pigmented brown externally, internally hyaline with a distinct layer of unpigmented, birefringent (POL+) but non-crystalliferous hyphae between outer exciple and hymenium; hypothecium 80–140(–200) μm deep, hyaline; hymenium (40–)60–110(–120) μm deep, unpigmented or hazy yellowish brown, darkening to dark brown, hemiamyloid, ILugols+ blue-green turning rust red, consisting of a matrix of asci 52–85 × 9–20 μm, admixed with slender, branched and anastomosing paraphyses 1.5–2.0 μm at midpoint, thickened to 4–6 μm apically, arising ±straight through the ascus matrix until reaching the surface, then continuing laterally in knot-like tangles over surface of disc, with brown wall pigments; ascospores 8/ascus, ellipsoid, (10.0–)12.3–16.1(–18.5) × (5–)5.8–7.2(–10) μm (L/W ratio 2.1±0.4)(n = 73). Conidiomata infrequent, formed in lines that appear to demarcate individuals, adnate, globular to cupular, with wall of interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal brown wall pigments; conidia fili-form, curved, 12–13 × ca. 0.5 μm. Sterile hyphae mostly lichenized, forming a thallus, with lens-like patches/areoles 100–150 × 40–60 μm, sometimes appearing rimose or scurfy, sometimes forming secondary corticate goniocysts 35–90 μm diam. Associated algae chlorococcoid, 7–21 μm diam.

Chemistry: stictic acid (major), norstictic acid (usually trace, rarely major), often with an unidentified fatty acid (trace).

Substrate affinity: on wood, especially in exposed habitats that become xeric in summer.

Macroecology: mainly montane to subalpine conifer forests, a high elevation species in the Alps, up to 4300 m in Tibet, lowland records occasional at high latitudes (e.g. Finland).

Xylographa pallens is a widespread species in the northern hemisphere. It is more common in mountain regions and areas with a seasonally dry climate than is X. parallela, which is more strictly borealmontane. It appears to be be abundant in western North America, northern, central and southeastern Europe and the Altai, but we have not yet seen any specimens from northeastern Asia or eastern North America. It is characterized by aggregated ascomata that grow outwards in two or more directions, often creating a star-like pattern. Microscopically it is virtually identical to X. parallela and young material is nearly impossible to distinguish without DNA sequencing. Mature thalli of the two species are quite distinct and can be easily identified with a hand lens. In X. pallens, the ascomata are aggregated into groups with ascomatal tips growing outwards in two or more directions (Fig. 13A, D-F); old ascomata will often contain a pallid “dead zone” in the middle where only remnants of previous ascomatal shells remain (Fig. 13A). The ascomata are thus non-evenly distributed, leaving significant ascoma-free portions of open wood or thallus (Fig. 13A, B, E). In X. parallela, by contrast, ascomata are more or less evenly distributed, and the vast majority of ascomata grow unidirectionally, i.e. after emergence they develop a rounded end and pry open the wood in a single direction (Fig. 15A, C, E).

Notwithstanding its microscopic similarity to X. parallela, our sequence data suggest the nearest relative to X. pallens to be X. rubescens. This relationship can be seen in the occasional persistence of the excipular margins in X. pallens and the presence in some X. pallens specimens of an excipular cuticle, causing the margins to appear whitish. Xylographa pallens further differs from X. rubescens in the absence or only trace occurrence of norstictic acid (abundant in X. rubescens), the star-forming habit of ascomatal aggregates (not known from X. rubescens) and the comparatively better developed thallus in X. rubescens (Table 4).

Xylographa pallens was described by Nylander (1857) in a description of the occurrence of X. parallela in France. The rank at which Nylander wanted to describe pallens would seem to be ambiguous; he does not list it at equal rank with X. parallela and X. flexella (= Elixia flexella), other species recognized in his catalogue, instead calling it a variety but using the species combination (“ejus verisimiliter modo est varietas X. pallens Nyl., ibidem occurrens, apotheciis pallide testaceis vel rufescentibus”, p. 393). Other indications that Nylander did not intend to recognize it as a species come from a reference to it in a catalog a year later at varietal rank (Nylander 1858), and from the Mougeot specimen itself in H-NYL, on which is clearly written Xylographa parallela var. pallens. Some authors regularly used binary names for varieties in the 19th century (A. Sennikov, pers. comm., 2013) and thus there is little doubt that Nylander intended to describe this as a variety. It was validly and unambiguously combined as a species by Harmand (1900).

The only Vosges specimen in H-NYL collected by Mougeot has aggregated ascomata and corresponds to the concept of X. pallens used here; the name derives from the beige, empty excipular “shells” left behind by advancing ascomata (Fig. 13A). There is however no indication that Nylander actually subsequently interpreted the taxon as it is used here. Most specimens annotated with this name during the 19th century belong to X. trunciseda or X. soralifera. The misconception of X. pallens was propagated by the distribution of an exsiccate under the name X. parallela f. pallens that is in fact X. trunciseda (see that species). In fact, the species represented by the type specimen – a member of the X. parallela group with aggregated ascomata – was never recognized as a distinct taxonomic unit by European taxonomists. The earliest indication that it was recognized as a distinct species is notes on herbarium material in ASU by Bruce Ryan, who penciled in the unpublished epithet “aggregata”.

Xylographa pallens as circumscribed here includes, in addition to the common stictic acid-containing form, a norstictic acid-dominant forms with linear ascomata. These forms correspond to the entity that Räsänen (1939) called Xylographa rubescens var. degelii (also X. parallela var. nilssonii in herb.). Räsänen (1939: footnote, pp. 181–182) originally described this as a hypothetical variety after sending Gunnar Degelius a mixed specimen of X. rubescens and X. parallela s.lat., which Degelius subsequently concluded could not be distinguished. Räsänen rather acridly described the KOH+ red form with long ascospores, if it should really exist, as X. rubescens var. degelii Räsänen, clearly without seeing any specimen that matched these characters (“hat Nilsson-Degelius in Schweden wirklich mit KOH rotfärbende Xylographa-Individuen mit grösseren Sporen … gefunden, so gehören diese dann zu einer neuen Varietät, die folgenderweise beschrieben werden mag”). Räsänen must have however come to believe in the variety as he annotated one of his own specimens (not cited in the protologue), collected in Petsamo in 1931, variously as var. degelii (specimen in H) or var. nilssonii (duplicate of the same collection in F, here designated as a neotype). This specimen closely matches material we have sequenced corresponding to X. pallens (e.g. isolate 2385). It differs from X. rubescens in its linear ascomata, narrow discs, dark exciples and immersed thallus, but possesses dominant norstictic acid. Single-locus DNA sequencing results of further individuals (not shown) suggest these forms are separated from X. pallens by several substitutions in the ITS region but still cluster with X. pallens rather than X. rubescens. Morphologically the forms are difficult to separate from specimens of X. pallens with submajor amounts of norstictic acid, and they may constitute an incipient species.

Exsiccates: France: Pyrénées-orientales, Santesson, Lich. Selecti Exs. Upsal. 200 (BM!, H!, as X. parallela); Greece: Thessalia, Gyelnik, Lichenotheca 105, BM!, H! p.p., mixed with X. parallela); Norway: [Hordaland], J.J. Havaas, Lich. Exs. Norv. 117 (H!, as X. parallela).

Additional specimens examined: Austria: Styria, Hörsterkogel, 2009, T. Spribille 32101 (GZU); Canada: British Columbia, East Kootenays, km 12 on Skookumchuck Road, 49°57.806’N, 115°49.244’W, 1271 m, 2 Aug 2005, T. Spribille 17029 & I. Houde (CANL, GZU, NY); [central interior,] Opax/Mud Lake, C. Björk 15105 (UBC); ibid., Opax Mtn., C. Björk 13789 (UBC); China: Tibet, prov. Sichuan, Tibetan fringe mountains (Hengduan Shan), Shaluli Shan, 4300 m, 5 Aug 2000, W. Obermayer 9470 (GZU); Finland: Nyl[andia], Helsingfors, Degerö, 1938, E. Häyrén (H); U. Artjärvi: Villikkala, Palomäki, 2009, V. Haikonen 27247 (H); [Regio aboensis,] Lohja, Skraatila, 2003, J. Pykälä 23847 (H); [Lapponia sompiensis,] Sodankylä: 6 km W of Korvanen, on log by river Kopsusjoki, 1959, T. Ahti 11956 (H); Germany: Bayern [=Bavaria], Nationalpark Berchtesgaden, Steinernes Meer, Feldkogel, 18 Sept 1985, R. Türk & H. Wunder 5341 (M); südliches Lattengebirge, Almwiesen oberhalb der Lattenbergalmen, 6 Oct 1987, H. Wunder 4870a (M); Italy: Südtirol [=Trentino-Alto Adige], Schlern Klamm, 18 Jul [18]67, F. Arnold (H); Norway: Dovre, Jan 1864, Th.M. Fries (BM); Slovakia: Nízke Tatry, path between Čertovica and Ďumbier, on sitting bench, 28 Aug 2009, T. Spribille 32149 & V. Wagner (GZU); Sweden: Härjedalen, Storsjö par., c. 5 km WNW of village of Messlingen, 720 m, 3 Aug 1976, R. Santesson 27097 (BM); Switzerland: Canton Valais, Zermatt, Börter, 2220 m, A. M. Burnet 114 (BM); near Tüfteren, 2215 m, A. M. Burnet 161 (BM); Turkey: Bolu Prov., Yedigöller National Park, 5 Jun 2007, T. Spribille s.n. (GZU); U.S.A: Arizona, Coconino Co., along trail to Mt. Humphreys timberline, 07 Jul 1994, T.H. Nash 35206 (ASU); California, Madera Co., Shinn Grove, 29 Jun 1994, B.D. Ryan 32027d (ASU, p.p.); Colorado, Boulder Co., Ward Science Lodge, 21 Jul 1961, A. Henssen 13039c (H); Montana, Flathead Co., Whitefish Range, Kimmerly Creek, T. Spribille 4059 (COLO); Wyoming, Johnson Co., Bighorn National Forest, USFS 31 at West Fork of Crazy Woman Creek, 29 Jul 2007, C. M. Wetmore 96729 (GZU).

Xylographa parallela (Ach. : Fr.) Fr. (Fig. 15–16)

Fig. 16. Type specimen of Xylographa parallela at BM.

Fig. 16

The specimen top centre is designated as the lectotype.

Summa Veg. Scand.: 372 (1849). Stictis (Xylographa) parallela (Ach.) Fr. : Fr. Syst. Mycol. 2(1): 197 (1822); sanctioned name according to Art. 15.1; Lichen parallelus Ach., Lichenogr. Suec. Prodr.: 23 (1799 [“1798”]); Opegrapha parallela (Ach.) Ach., Method. Lich.: 20 (1803); Hysterium parallelum (Ach.) Wahlenb., Fl. lapp.: 523 (1812); Xylogramma parallelum [as “parallela”] (Ach.) Wallr., Fl. crypt. Germ. (Norimbergae) 2: 509 (1833). Type: [Sweden: “habitat ad ligna denudata emortua truncorum Betulae”]; locality not specified on packet, [E. Acharius] 253 (BM-ACH 000500495, lectotype, designated here). Note: The type material at BM consists of four pieces glued to a single sheet (Fig. 16), labeled A, B, C and D. Of these, A, B and C represent typical material of X. parallela (TLC: stictic acid in each) and D appears to represent immature material of X. pallens (Nyl.) Harm. We have chosen the fragment labeled A (top centre on the sheet) to be the lectotype.

= Hysterium abietinum Pers., Ann. Bot. (Usteri) 15: 31 (1795). Xylographa abietina (Pers.) Zahlbr., Cat. Lich. Univers. 2: 151 (1922); name not available for use under Art. 15.1. Type: not found.

= Xylographa incerta A. Massal., Miscell. Lich. 1856: 17 (1856). Type: [Germany:] Ad ligna Herciniae superioris, Hampe (VER, holotype!). TLC: stictic acid.

= Xylographa parallela var. sessitana Bagl. in Arnold, Flora 67: 663 (1874). Type: [Italy: Piemonte, Prov. Vercelli] sui tronchi scortecciati delle conifere esposti alle intemperie, presso Riva in Valsesia [= Riva Valdobbia], 1861, Carestia, Erbar. Crittogam. Ital. 843 (WU!, lectotype, designated here; BM!, G!, H, S [image]!, TO!, isolectotypes).

= Xylographa minutula Körb., Parerga Lichenologica: 276 (1861). Type: [Poland: Silesia] R Sfl. [= Riesengebirge, Seifenlehne, currently Złotowka, (valley of the brook Złoty Potok near lake Mały Staw), Poland; see Liška 2013] 1/8 46 [= 1 Aug 1846, G.W. Körber]. (L-0788902, holotype!)

= Xylographa laricicola Nyl., Flora 68: 13 (1875). Type: [United Kingdom: Scotland,] supra corticem Laricis (prope basio truncorum) in Scotia prope Ben Lawers, J. C. Crombie (H!, lectotype, designated here; BM!, E, G!, isolectotypes).

= Stictis linearis Cooke & Ellis, Grevillea 7: 7 (1878); Xylographa linearis (Cooke & Ellis) Sacc. in Michelia 2: 141 (1880); Xylogramma lineare (Cooke & Ellis) Sacc., Syll. Fung. 8: 678 (1889). Type: [U.S.A.: New Jersey,] Newfield, J.B. Ellis (FH-00370118!, lectotype, designated here; G!, isolectotype). TLC: no substances.

Ascomata narrowly ellipsoid, elongate, with lateral growth, densely and evenly distributed in colonies of up to 188/cm2, linear, 0.45–1.14× 0.09–0.23 mm, L/W ratio 5.69±2.56; ascomata growing by extending one end of the ascoma laterally, leaving behind a blunt end or - in older ascomata - a translucent excipular shell, occasionally also growing linearly in two directions; ascomata sometimes “peeling off” when old; disc flat to slightly convex, locally concave near tips, dark brown to black, matte, with thin brown to black margin (never pale), the margin receding in older ascomata and often visible only at the tips; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, usually flush with the hymenium surface in section, 15–37 μm wide; excipular hyphae pigmented brown externally, internally hyaline with a distinct layer of unpigmented, birefringent (POL+) but non-crystalliferous hyphae between outer exciple and hymenium; hypothecium 40–150 μm deep, hyaline or a haze of pale brown, of densely packed hyphae; hymenium 55–110(–150) μm deep, hyaline or hazy, very pale yellow-brown throughout, hemiamyloid (ILugols+ blue-green turning rust red) or euamyloid (ILugols+ royal blue), consisting of asci (30–)52–95 × 8–21(–29) μm embedded in a matrix of strongly contorted, branched and anastomosing paraphyses 1.7–2.5 μm at midpoint, often distally moniliform and thickened to (2.5–)4–6(–8) μm in the apical cells, the last 4-5 cells continuing lying horizontal in knot-like tangles over surface of disc and with brown and sometimes also gray wall pigments; ascospores 8/ascus, ellipsoid, (10.0–)11.3–14.5(–16.5) × (3.5–)5.9–7.6(–8.5) μm (L/W ratio 2.03±0.35) (n = 82). Conidiomata infrequent, adjacent to ascomata but segregated, partially immersed, globose, with wall of laterally interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal brown wall pigments; conidia filiform, curved, 9–14 × ca. 0.5–0.7 μm. Sterile hyphae mostly lichenized, with corticate goniocysts 35–100(–200) μm diam, becoming confluent into lichenized algal plugs or a ±continuous but largely immersed thallus, sometimes appearing rimose or scurfy. Associated algae chlorococcoid, 7–16(–20) μm diam.

Chemistry: stictic acid or secondary substances not detected.

Substrate affinity: on conifer wood, including logs, snags and fenceposts and rails, rarely on conifer (Larix or Pinus) bark..

Macroecology: montane and boreal forests between about 35°N to 65°N, mostly in the conifer forest zone but also south to the New Jersey Pine Barrens in eastern North America.

Xylographa parallela is a widespread species in the northern hemisphere and the only one we have unambiguously confirmed based on DNA sequence data to occur also in the Southern Hemisphere. Along with X. pallens it is one of the most common species of the genus. It is easily recognized by its simple, evenly distributed ascomata that tend to exhibit growth in only one direction, meaning most ascomata typically have a pointed “leading” and blunt “trailing” end. The name X. parallela has long been the only name in widespread use for Xylographa species with linear ascomata considerably longer than wide, and thus has been applied to a large range of material, which we now recognize as belonging to other species, especially X. pallens. The two species are microscopically almost identical, but can easily be separated by their growth habit, with X. parallela forming regular, evenly spaced colonies of single ascomata strictly aligned with the grain of the wood, and X. pallens developing ascomata in clusters with multiple leading tips growing outward from a central point, and considerable ascoma-free space between each ascomatal cluster (Table 4). The genetic distinction of these two species is likewise unambiguous.

Bark-dwelling forms of X. parallela have long been recognized as a distinct species, X. minutula, as recently as Wirth et al. (2013). However, DNA sequence data from a recent specimen from the Russian Far East, agreeing morphologically with the type of X. minutula and on Larix bark, does not differ from that in X. parallela. Xylographa minutula was long thought to be a sorediate species, beginning with the protologue and continuing into the 20th century (Lettau 1911; Zahlbruckner 1922). The type specimen of X. minutula at L is extremely small but exhibits the short, irregular ascomata and stain-like thallus seen in other specimens. In his protologue, Körber (1861: 276) described the species as “tenuissime leprosus albido-cinerascens”, but he was seeing the accompanying species Lecidea pullata on the type. It is not known what controls the ability of X. parallela to colonize bark, but it may constitute a secondary relaxation of whatever mechanism otherwise enforces the high affinity to wood in Xylographa. Remarkably, while lignicolous X. parallela is still common and widespread, the “X. minutula ecotype” appears to have all but disappeared from Europe. The species was collected in the 19th century in Tyrol (Austria), Germany, the present-day Czech Republic and Scotland (where it was described as X. laricicola), but we have seen only one collection from Europe from after 1950, from Switzerland (1998, M. Dietrich 11633, G).

The authorship for the combination of parallela in Xylographa is often attributed to Behlen and Desberger (Zahlbruckner 1922, 1932; Santesson 1993; Giavarini & Orange 2009) based on the appearance of the species in an early book on German forest cryptogams (Behlen & Desberger 1835). However, the latter authors clearly recognized Xylographa as a kind of unranked section of Stictis, and parallela was listed within that genus as “St. parallela”. Thus neither was the genus validated here, nor the species combination in Xylographa. The earliest valid combination is that of Fries (1849). Because of the sanctioning of the Acharius epithet through Fries (1822), the full proper author citation has to be (Ach. : Fr.) Fr. Santesson et al. (2004) recognized this error and provided a corrected species authorship.

Selected exsiccates: Czech Republic: Moravia, Kovář, Cryptog. Exs. Vindob. 1025 (BM!, FH!, H!, M!; corresponds to the X. “minutula” ecotype, distributed under X. parallela f. elliptica); France: Plantae Graecenses 56 (BM!); Italy: Erbar. Crittogam. Ital. 843 (as X. parallela var. sessitana, see synonym list for herbaria); Norway: Vězda, Lich. Selecti Exs. 2315 (BM!); Poland: Tobolewski, Lichenoth. Polon. 334 (BM!); Romania: Cretzoiu, Lich. Rom. Exs. 84 (BM!); Slovakia: Timkó, Fl. Hung. Exs. 512 (F!); Switzerland: Luzern, Kunze, Fungi Sel. Exs. 368 (H!, mixed with Agyrium rufum).

Selected additional specimens examined: Argentina: Tierra del Fuego, S side of Paso Garibaldi, 54°41’S, 67°50’W, 6 Nov 1997, R. Guderley, H.T. Lumbsch & G. Vobis 12031a (F); Chile: Prov. Antártica Chilena, Comuna de Hornos, N shore of Isla Navarino, N slopes of Pico de la Bandera from Río Róbalo dam to 400 m marker, 22 Jan 2013, W.R. Buck 60821 (NY); Germany: [Niedersachsen,] Harz, Braunlage, 10 Jul 1906, H. Zschacke (H); Japan: Hokkaido, Ishikari Prov., Kamikawa gun, Kamikawa cho, E of Obako Gorge Tourist Centre, 10 Jun 1995, T. Tønsberg 23129 (BG); Turkey: Prov. Gümüsane, Kalkani Mts., Zigana Pass, 40°38’25”N, 39°23’59”E, on bark of Pinus, 2000 m, 12 Jul 2001, A. Guttová, J. Halda & Z. Palice 11830 (herb. Palice; = X. “minutula” ecotype); U.S.A.: Alaska, Denali Borough, Summit Lake, Parks Highway, 63°07.411‘N, 149°27.447‘W, lignicolous, 587 m, 17 Aug 2008, T. Spribille 27762 (GZU); Montana, Lake Co., St. Mary’s Lake, T. Spribille 20604 (GZU).

Xylographa rubescens Räsänen (Fig. 17)

Fig. 17. Xylographa rubescens Räsänen.

Fig. 17

A, B, habit of type material; C, habit showing fragmenting ascomata; D, detail showing “peeling” ascomata (arrows); E, habit, showing adjacent parts of thallus with (KOH+ red) and without (K−) norstictic acid; F, detail, showing pseudopruinose ascomatal discs. A, B: holotype (H); C, Finland, Norrlin s.n. (H); D, U.S.A., Montana, Spribille s.n., 15 Oct 2007 (GZU); E, Sweden, Vänskä 7534 (H), F, U.S.A., Washington, Spribille 17491 (GZU). Scale bars: A, C, ca. 1 mm; B, E, ca. 0.5 mm; D, F, 0.5 mm.

in Vainio, Medd. Soc. Fauna Flora Fenn. 47: 51 (1921). Type: [Finland: Ostrobottnia ultima,] O[strobot-tnia] b[orealis]. Simo, Tiurasenkrunni, lautakatolla [on board roof]. 14/6 [19]20, V. Räsänen (H!, lectotype, designated here; the thallus labeled “1.”). Two specimens collected a year later may be considered topotypes: O[strobottnia] b[orealis]. Simo, Tiurasenkrunni, laholla lautakatolla [on rotten board roof]. 10/VII.21, V. Räsänen (H!); O[strobottnia] b[orealis]. Simo Tiurasenkrunni, laholla lautakatolla, 20/VI.21, V. Räsänen (H!).

Ascomata occurring clustered, with patches of ascomata amid sterile interspaces; lateral growth of parallela type; first generation ascomata linear, very variable in length, 0.4–4.4 × 0.11–0.45 mm, L/W ratio 8.73±7.45; later generation ascomata regenerating at both ends of necrotic margin and resembling those of the first generation, growing linearly in two to many directions from mother ascoma, forming contorted, flexuose aggregates, rarely recognizable “stars” (Fig. 17D, E); ascomata often fragmenting into multiple sectors (Fig. 17C), “peeling off” when old (Fig. 17D); disc flat to strongly convex, pale to red brown or dark brown, matte, often apparently pruinose, with thick, pale, “bleached” margin, the margin persistent; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface in section or overtopping it, 18–60(–90) μm wide at widest point; excipular hyphae pigmented brown externally, internally hyaline and filled throughout with birefringent (POL+) crystals; hypothecium 80–170 μm deep, hyaline; hymenium 60–120 μm deep, un-pigmented or hazy yellowish brown, darkening to dark brown above, lacking crystals or with obscure POL+ guttulae, hemiamyloid, ILugols+ blue-green turning rust red, rarely euamyloid, consisting of a matrix of asci 43–93 × 13–20 μm, admixed with slender, branched and anastomosing paraphyses 1.5–2.5 μm at midpoint, thickened to 3–5 μm apically, arising ±straight through the ascus matrix until reaching the surface, then continuing laterally in knot-like tangles over surface of disc, with brown and gray wall pigments, rarely unpigmented; ascospores 8/ascus, ellipsoid, (9.0–)10.8–12.5(–14.0) × (4.5–)5.5–6.7(–8.5) μm (L/W ratio 1.98±0.33) (n = 61). Conidiomata infrequent, adjacent to ascomata but segregated, adnate, globular to cupular, 60–170 μm diam, with wall of interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal brown wall pigments; conidia filiform, curved, 12–14 × ca. 0.5 μm. Sterile hyphae mostly lichenized, forming a thallus, verruculose-areolate to rimose, forming distinct granular patches of unpigmented or brown goniocysts, these 50–70 μm diam, corticate and strongly infused with POL+ crystals, KOH+ bleeding red norstictic acid crystals out of the fungal cells. Associated algae chlorococcoid, 8–16 μm diam.

Chemistry: norstictic acid (major), alone or occasionally with stictic acid (submajor to trace). North American specimens agreeing in ITS sequence can have stictic and norstictic acids estimated to be in near equal amounts on TLC plates, or even no detectable norstictic acid, as the latter appears sometimes to be localized in certain thallus parts or in the exciple (Fig. 17E).

Substrate affinity: on conifer wood, especially in exposed habitats that become xeric in summer.

Macroecology: lowland boreal conifer forests (in Canada and Finland), also in montane conifer forests at elevations up to 1700 m (in the Altai, Pyrenees and Sierra Nevada of California) and to 3000 m in the Rocky Mountains of Colorado.

The name Xylographa rubescens has been in circulation for nearly a century in Finland following its description by Veli Räsänen in Vainio (1921), but there has never been consensus on whether it is a distinct species. Nilsson (1930; the earlier name of Gunnar Degelius) argued that the ascospore size of a piece provided to him by Räsänen was the same as for X. abietina (= X. parallela) and that X. rubescens was no more than a ‘chemical species’; he reduced it to a variety of the former (we found ascospore size is not a good distinguishing character). The topic of the merit of X. rubescens as a species was again taken up by Brodo (1992), apparently independent of the discussion by Degelius and Räsänen. Brodo likewise concluded that X. rubescens was no more than a chemical form of X. parallela.

In fact, molecular data support the recognition of X. rubescens and suggest that it is more closely related to X. pallens than X. parallela; the sister group relationship is nearly supported in both the Bayesian MCMC and ML analyses, and is fully supported in analysis of unpruned DNA data (not shown). The close relationship is reflected in the morphology, especially the tendency of X. rubescens to develop aggregate ascomata and “stars”, and the shared habit of both species to have pale, thickened margins (though much more strongly the case in X. rubescens).

When well developed, X. rubescens is distinctive and cannot be confused with any other species: in particular, its combination of pale margins in young ascomata, ascomata regularly fragmenting when old, and norstictic acid in the thallus (KOH+ orange-red even in macroscopic spot tests) is not found in any other species. Several members of the X. parallela group (notably X. parallela s.str. and X. pallens) can develop “deciduous” ascomata that peel off and fragment, but no species develops such an extreme case of this as X. rubescens (exemplified for instance in Haikonen 20951, H). In dry weather, these “peeling ascomata” point perpendicularly off from the wood surface and are brittle and clingy, making it likely that fragments become lodged in the fur or feathers of passing squirrels and birds.

Distinguishing young X. rubescens from X. pallens in areas where they co-occur can be difficult, even with mature material. In some cases, X. pallens can also develop pale margins, non-negligible amounts of norstictic acid and fragmenting ascomata. However, even in mixed collections (e.g. Haikonen 22289, H), the two species maintain distinguishing features (Table 4). In X. rubescens, (1) the ascomata are coarser and shorter (long and thin in X. pallens), with broader discs, larger, dark brown to pale margins, hymenia which fragment in older ascomata, shedding chunks of hymenia and leaving behind pale excipular shells (seldom the case in X. pallens); (2) thallus granules are pale creamish, seldom darkly pigmented as in X. pallens; and (3) norstictic acid predominates giving a strong KOH+ orange-red reaction (most X. pallens have predominantly stictic acid, KOH+ pale to strong yellow, not turning red). Xylographa rubescens is by far the rarer of the two species at middle latitudes, becoming more common at high latitudes (such as central Finland) and higher altitudes (Altai, Pyrenees, Rocky Mountains) and in general in more continental climates. In critical cases it may be necessary to sequence barcode loci such as ITS to verify the identity of the material.

Exsiccates: Finland: Räsänen, Lich. Fenn. Exs. 842 (M); U.S.A.: Colorado, Weber, Lich. Exs. COLO 163 (ALA!, FH!, as X. spilomatica; for other replicates see X. septentrionalis, X. vitiligo).

Additional specimens examined: Canada: British Columbia, East Kootenays, Rocky Mountains, White River region E of Canal Flats, Moscow Road, 50°20.490’N, 115°35.255’W, 1053 m, 01 Aug 2005, T. Spribille 16974-B (UBC); Manitoba, W shore of Blueberry Lake, 15 Jun 2003, I.M. Brodo 31221A (CANL); Yukon, Wernecke Mtns., Carpenter Lake, 64°30’N, 135°06’W, 25 Jul 1972, G.W. Scotter 19376 (CANL); Finland: Regio aboensis, Lohja, Nummenkylä, J. Pykälä 22782 (H); Tavastia australis, Tavastia, J. P. Norrlin (H), Sysmä, Liikola, Viljamenvuori, 16 Sept 2001, V. Haikonen 20737 (H); Heinola, Lusi, Näätävuori, 28 Oct 2001, V. Haikonen 20951 (H); Russia: [Komi Republic,] Rossia bor., ad flum[en] Petschora, Varjanga, 15 Jun 1891, A.O. Kihlman (H); Altai Republic, Altai Mts., distr. Shebalino, Cherga: right side of the Sema river approx. 4.6 km N-NNE of the village, 51° 36.823’N, 85° 35.140’E, 495 m, P. Resl 1142 (GZU); Spain: Navarra, Roncal Valley above Isaba, 2 May 2009, T. Spribille 30255 & S. Pérez-Ortega (GZU); Sweden: Uppland, Vänge, Fiby urskog, 27 Sept 1959, A. Henssen 4849 (H); Jämtland, Åre parish, Mt. Snasahögarna, Snasahögsvallen, 14 Aug 1974, H. Vänskä 7534 (H); U.S.A.: California, Madera Co., Shinn Grove, 37°14’45”N, 119°25’30”W, 29 Jun 1994, B.D. Ryan 32027d (ASU); Montana, Glacier Co., Upper Two Medicine Lake, 15 Oct 2007, T. Spribille s.n. & V. Wagner (GNP); Washington, Pend Oreille Co., Frater Lake, 19 Aug 2005, T. Spribille 17491 (GZU, NY, UBC).

Xylographa schofieldii T. Sprib., sp. nov. (Fig. 18). Mycobank No.: MB 805259

Fig. 18. Xylographa schofieldii T. Sprib.

Fig. 18

A, B, habit of type material; C, D, goniocysts, in water. All photos from holotype (DNA voucher 1103). Scale bars: A, 2 mm; B, 0.2 mm; C, F, 50 μm; D, 10 μm; E, 500 μm.

Similar to Xylographa vitiligo (Ach.) J.R. Laundon, but with goniocysts with a smooth, compact surface and chemically with confriesiic acid instead of stictic acid as main substance; on wood in hypermaritime regions.

Type: U.S.A.: Alaska, E of Gustavus, just outside boundary of Glacier Bay National Park and Preserve, Falls Creek, 58.43788°N, 135.63509°W, 21m elev., on suspended, exposed conifer log in boggy Tsuga heterophylla-Malus fusca thicket, 28 Jul 2012, A. Fryday, M. Svensson & T. Spribille 39088 (NY, holotype; CANL, GZU, H, UBC, isotypes)

Etymology: Named for Wilfred B. “Wilf” Schofield (1927–2008), professor of botany at University of British Columbia, an inspiration to many and collector of the first specimen of this species.

Ascomata and Conidiomata not seen. Sterile hyphae lichenized, bound to algal plugs developing endosubstratally in the wood fibre, white, regularly breaking out on the surface as round, strongly convex soralia 0.21–0.9 mm diam, gray-green externally, internally pinkish when damaged or exposed, becoming confluent; goniocysts 27–50(–87) μm diam, forming “consoredia” held together by a paraplectenchymatous hyphal matrix, pigmented brown when exposed. Associated algae chlorococcoid, 8–10 μm diam.

Chemistry: confriesiic acid (major).

Substrate affinity: on conifer wood.

Macroecology: known only from hypermaritime coastal rainforests on the outer west coast of NW North America in the Gulf of Alaska.

Xylographa schofieldii is similar to X. vitiligo in habit but differs in chemistry, containing confriesiic acid. It is not included in our phylogenetic tree because we were able to obtain only a single locus (mtSSU) despite multiple re-sampling of the Alaskan material. The sequence confirms its placement in Xylographa but due to the low level of variability in mtSSU and absence of other loci, the inclusion of this species in the tree would only serve to weaken the support for other relationships. The species is known from only three collections but can be expected to be more widespread in hypermaritime coastal rainforests of southeastern Alaska and British Columbia.

Additional specimen examined: Canada: British Columbia, Queen Charlotte Islands, Graham Island, McClinton Bay, SW Masset Inlet, on log of upper salt marsh, 30 Jul 1967, W.B. Schofield 35238a (CANL); U.S.A.: Alaska, same locality as type, 28 July 2012, A. Fryday 10275 (MSC).

Xylographa septentrionalis T. Sprib., sp. nov. (Fig. 19). Mycobank No.: MB 805260

Fig. 19. Xylographa septentrionalis T. Sprib.

Fig. 19

A-D, habit and arrangement of ascomata. D, goniocysts, in water; E, soralia and F, goniocysts in SEM. A, B, D, E, F: holotype (DNA voucher 2402); C: U.S.A., Arizona, Nash 39348 (M). Scale bars: A, 0.5 mm; B, C, 0.2 mm; D, 10 μm; E, 200 μm; F, 50 μm.

Similar to Xylographa parallela (Ach. : Fr.) Fr. with linear ascomata but thallus producing compact goniocysts in soralia and thallus with stictic and norstictic or only norstictic acid.

Type: Canada: British Columbia, Cassiar Highway, Dease River area, 5 mi N of Baking Powder Creek, 14 mi N of Boya Lake, 59°32.780’N, 129°14.067’W, open Pinus woodland, on logs, 708 m, 9 Oct 2007, T. Spribille 25133 (CANL, holotype; GZU, H, isotypes).

Etymology: septentrionalis (Latin), northern, in reference to the provenance of the type material.

Ascomata when present with lateral growth of parallela type, not proliferating through “budding”, ascomata linear or narrowly long-ellipsoid, 0.33–1.9 × 0.06–0.3 mm, L/W ratio 6.89±3.78; disc flat to convex, brown, matte, with thin brown to pale cream, straight margin, lighter than disc; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, 18–50 μm wide laterally; excipular hyphae pigmented brown externally, wholly filled with POL+ crystals; hypothecium 70–140 μm deep, hyaline or pale hazy yellowish; hymenium 60–80 μm deep, hyaline to pale hazy yellow-brown throughout, sparingly inspersed with POL+ hymenial crystals, hemiamyloid (ILugols+ blue-green→ rust red), consisting of clavate asci 58–75 × 15–19 μm, embedded in a matrix of straight, stout, sparsely branched paraphyses 2–2.5 μm wide at midpoint, distally ±moniliform and thickened to 4–6.5 μm in the apical cell, with brown and sometimes also gray wall pigments; ascospores 8/ascus, ellipsoid, (11–)11.9–16.1(–22) × (5–)5.9–7.8(–9.5) μm (L/W ratio 2.05±0.41) (n = 43). Conidiomata inconspicuous, intermingled among ascomata, immersed, globose, ca. 80 μm diam, with light brown pigmented wall; conidia long-filiform, curved, 20–22 × ca. 0.5 μm. Sterile hyphae lichenized, connecting to algal plugs to 100 μm long developing in the wood fibre, white, regularly breaking out on the surface with convex mounds of dark brown pigmented goniocysts (= soralia), these roundish, indeterminate, 0.12–0.27 mm diam; goniocysts 18-34 μm diam, forming “consoredia” held together by a paraplectenchymatous hyphal matrix, puzzle-pieced in surface view, pigmented dark brown when exposed. Associated algae chlorococcoid, 6–11 μm diam.

Chemistry: stictic/norstictic acid or only norstictic acid.

Substrate affinity: on conifer wood, especially logs.

Macroecology: in boreal and montane forests, a rather continental species. Records from the western Cordillera of North America may belong in part to another, undescribed species (see below).

This species has been widely confused with Xylographa vitiligo, from which it differs even in sterile material in its much smaller soralia with darker, sparser and more compact goniocysts (compare the “hard” goniocysts of Figs. 19E, F with the roughened goniocysts of Figs. 24C, D). Fertile material can be instantly distinguished from both X. soralifera and X. vitiligo on account of its “parallela-type”, linear ascomata as opposed to the short, “trunciseda-type” ascomata of those two species. X. septentrionalis and X. vitiligo are not closely related; X. septentrionalis is a close relative of X. difformis. X. septentrionalis is widespread, especially in western North America, and represented by several rich collections in the herbaria studied. It can be expected to be found in boreal Asia and Europe as well.

Xylographa septentrionalis appears to consist of at least two genetically distinct entities. The first, described here as the type, was sampled in both the Yukon (three locus sample) and southeastern British Columbia (only ITS obtained: Spribille 16905). A second form was sampled from Montana (Fig. 1: accession 1056) and appears to be closely related to Xylographa carneopallida, outside the core X. parallela group; it is not included in the diagnosis and measurements for X. septentrionalis here. Furthermore, we have observed some specimens to contain only norstictic acid and others to include both stictic and norstictic acid. It is not clear if more than two entities are involved and how they can be distinguished, if at all. Xylographa septentrionalis is a highly variable species (note range of ascospore sizes, even in sequenced material) and we do not fully understand this variation. In addition, while numerous specimens exist in herbaria that formally fit to the description of the species, there is little fresh material. We refrain from describing a second species until we have more material for DNA sampling and understand the limits of morphological, chemical and genetic variation in X. septentrionalis.

Exsiccate: Canada: British Columbia, Brodo, Lich. Can. Exs. 150 (M!, as X. vitiligo); U.S.A.: Arizona, Nash, Lich. Exs. Arizona State Univ. 200 (G!, M!,, issued as X. vitiligo); ibid., Nash, Lich. Exs. Arizona State Univ. 300 (BM!, G!, issued as X. hians); Colorado, Weber, Lich. Exs. COLO 163 (M!, mixed with X. pallens; for other replicates see X. rubescens and X. vitiligo).

Additional specimens examined (norstictic acid only): Canada: British Columbia, Rocky Mountains, bench on west bank of the White River, ca. 13 km north of Whiteswan Lake, 50°16.060’N, 115°30.719’W, 1183 m, 31 Jul 2005, T. Spribille 16905 (UBC); U.S.A.: Arizona, Apache Co., W side of Escudilla Mtn., 21 May 1975, T. H. Nash 10679 p.p. (ASU); Minnesota, St. Louis Co., Voyageurs National Park, 3.5 mi W of Kettle Falls, 12 Jun 1978, C.M. Wetmore 32943 (CANL).

Additional specimens examined (stictic/norstictic chemistry): Canada: British Columbia, Brackendale, 10 Jun 1916, J. Macoun s.n. (F, FH); Moresby Island, Alliford Bay, 18 Jul 1967, I.M. Brodo 11757 (CANL); Northwest Territories, Reindeer Station, J.W. Thomson & J. A. Larsen 15607 p.p. (CANL); Glacier (Brintnell) Lake, 1939, H.M. Raup 3557 p.p. (CANL, FH); Mexico: Chihuahua, Sierra Madre Occidental, 20 km SE of Cusárare, 27°32’N, 107°23’50”W, 22 Jul 1994, J. Hafellner 37802 (GZU); U.S.A.: Arizona, Apache Co., Mt. Baldy Wilderness, 30 Sept 1997, T.H. Nash 39348 (ASU); Sunrise Ski Area, Fort Apache Reservation, 29 Aug 1975, T.H. Nash 11694b (ASU); Colorado, Garfield Co., NW of Meadow Lake Campgound, 24 Jun 1992, T.H. Nash 31936a (ASU); Michigan, Isle Royale National Park, Wallace Lake, 10 Jul 1983, C.M. Wetmore 47633 (CANL); Montana, Lincoln Co., Grave Creek at Cat Creek, 2011, T. Spribille s.n. (GZU); Oregon, Lincoln Co., public fishing pier below Yaquina Bay bridge, B. McCune 27218 (F); South Dakota, Pennington Co., Medicine Mt. Rd., 19 Jul 1960, C.M. Wetmore 7757 (CANL); on west side of south arm of Deerfield Reservoir, 19 Jul 1960, C.M. Wetmore 7811 (CANL).

Xylographa soralifera Holien & Tønsberg (Fig. 20)

Graphis Scripta 20: 58 (2008). Type: U.S.A.: Washington, Kittitas Co., 25 km NE of Cle Elum, off Hwy 97, 0.95 miles along Old Blewett Road towards Old Blewett Pass, 47°20’N, 120°41’W, alt. 1000 m, on wood of conifer log, on W-facing, dry slope with Pinus ponderosa and Pseudotsuga menziesii, 24 Sept 1999, T. Tønsberg 28049 (BG, holotype; isotypes to be distributed in Tønsberg, Lich. Isid. Sor. Crust. Exs.).

Ascomata solitary or adjacent in groups to 3 mm in diameter, with lateral growth of trunciseda type, straight to slightly curved, mostly ± ellipsoid or rounded, sometimes linear, rarely stellate, 0.20–0.36 × 0.10–0.32 mm; margin to 0.08 mm wide, dark brown to medium brown, becoming light brown with age, in uppermost part often becoming thin, whitish and ± lacerate; disc concave to flat, rarely convex, grayish white to brown, becoming pale brownish to rose in widely exposed discs; exciple 35–80 μm wide in uppermost part, brown in outer part, colourless to faintly yellowish towards the hymenium, with POL+ birefringence present in inner part of exciple; hymenium pale yellowish in top 10 μm with some POL+ crystals present, colourless below, 70 to 140 μm deep; hypothecium not well separated from excipulum in lower part, colourless, 50–70 μm deep; asci clavate, 52–70(–130) × 12–17 μm; ascospores 8/ascus, sometimes sticking together when out of ascus in squash preparations, simple, mostly straight, sometimes slightly curved, elongate with rounded ends to ellipsoid, sometimes, especially in upper part of ascus, obovoid, rarely globose, (7–)9.5–13.3(–17) × (3–)5.3–6.3(–8) μm (L/W ratio 2.19±0.57) (n = 74). Conidiomata not observed. Sterile hyphae lichenized, developing in the wood, colourless, forming convex endosubstratal areoles (tuberculae) which at first are covered by the uppermost layer of the wood, some bursting open to form convex soralia producing conglutinated goniocysts (= soredia); soralia at first often brown due to pigmentation of the external soredia, later when external, pigmented soredia are shed becoming pale greenish to dirty white, rounded, 0.3–0.6 mm wide; soredia colourless or, especially in the outwardly facing part of external soredia, brown, globose with a more or less distinct paraplectenchymatous wall but with a rough surface (Fig. 20F), 15–36 μm diam, becoming conglutinated (Fig. 20C, F). Photobiont (endosubstratal and in the soredia/consoredia) chlorococcoid, 6–13 μm.

Chemistry: fumarprotocetraric acid ± traces of satellites. Brown pigment in excipulum and wall of soredia/consoredia: K−, N− or + brown with a reddish tinge.

Substrate affinity: on conifer wood, especially logs, at least two records from conifer bark.

Macroecology: in montane conifer forests, especially in suboceanic regions (e.g., the Alps, the Scandes, the interior wet belt of NW North America).

Xylographa soralifera was long overlooked within the variability of the X. vitiligo complex until it was recognized and described in detail by Holien & Tønsberg (2008). It is most easily distinguished from X. vitiligo by its strongly convex, greenish soralia and its distinctive chemistry (see Heininger & Spribille 2009 and Fig. 20). Our molecular results provide strong support for all specimens with fumarprotocetraric acid forming a monophyletic clade. The only NCBI voucher of Xylographa previous to this study, originally accessioned as X. vitiligo, was recovered by our analyses in this clade and subsequently revised to X. soralifera, an observation backed up by TLC analysis (Z. Palice, pers. comm.). The voucher for that specimen represents the first for Turkey and Asia for this species.

Xylographa soralifera is one of the only species of Xylographa with a described lichenicolous fungus, Bellemerella ritae (Pérez-Ortega & Spribille 2007). Other lichenicolous fungi are however known from X. trunciseda and X. vitiligo (unpublished) as well as undescribed coelomycetous fungi from the X. parallela group.

Some specimens from the southern edge of the species’ range in North America (Arizona, Colorado) have strongly salt-and-pepper-pigmented external soredia and smaller soralia (e.g., Nash 7874, ALA; Anderson s.n., 29 Sept 1962, FH). Interestingly, this form has also been seen at low latitudes in Europe (Austria: Brodo 19900, CANL). They appear otherwise typical. Specimens cited here and in Table 1 considerably extend the range of this species.

Exsiccate: France: Roumeguère, Lich. Gallici exs. 89 (M!); U.S.A.: Montana, Weber, Lich. Exs. COLO 526 (ALA!, BG!, GZU!, FH!, G!, H!, M!, for the most part; mixed with X. vitiligo (in FH) and X. rubescens in some replicates).

Representative specimens examined (only specimens not cited in previous papers): Canada: British Columbia, Shuswap Highland, Trophy Mountain Recreation area, 24 Aug 1994, T. Ahti 52094 (H); Glacier National Park, on bark[!], T. Goward 05-223 (UBC; verified by mtSSU rDNA); Okanagan Lake area, ca. 25 km NNW of Kelowna, Wrinkley Face Mt., 27 Sept 2008, I.M. Brodo 32377 (CANL); Norway: [Møre og Romsdal,] Skiri i Romsdalen, Aug. 1904, J.J. Havaas (BG-L-56149, BG-L-56150); Nordland, Grane, the S slope of Lillefjellet, 65°07’N 13°22’E, alt. 530 m, 22 Aug 1981, T. Tønsberg 6085 (BG-L-36778); Grane, Majavatn, the W-facing foothills of Litlfjellet, 65°09.86’N 13°22.58’E, 350–400 m, 13 June 2011, T. Tønsberg 41033 (BG); Troms, Bardu, N of Setermoen, E of Sponga, 68°52.47’N 18°22.65’E, alt. 60–80 m, 13 July 2010, T. Tønsberg 40236 (BG-L-89242); Finnmark, Nalganas i Alten, J.M. Norman (BG-L-56170); Russia: [Krasnoyarsk Krai,] Guv. Jenisejsk, Polovinka, 68°15’ n. Br., 16 Sep 1876, M. Brenner 411k (H); Sweden: Åsele Lappmark, Vilhelmina, 18 km N of Stalon, Mt. Mörrösjöliden, 9 Aug 1991, T. Ahti 50331 (H); Switzerland: Canton de Vaud, commune et réserve forestière de Montricher, 29 Sept 2004, M. Mola s.n. (G); U.S.A.: Arizona, Apache Co., trail to Mt. Baldy, 25 May 1973, T.H. Nash 7874 (ALA); Mt. Baldy Wilderness, 02 Jul 1994, T.H. Nash 34760 (ASU); Colorado, Boulder Co., Rocky Mtn. National Park, Wild Basin, 29 Sept 1962, R.A. Anderson s.n. (FH); Montana, Gallatin Co., Yellowstone National Park, 16 Jul 1998, C.M. Wetmore 80593 (ASU); Washington, Skagit Co., 27 Sept 1993, B. D. Ryan 30478-A (ASU).

Xylographa stenospora T. Sprib. & Resl, sp. nov. (Fig. 21). Mycobank No.: MB 805261

Similar to Xylographa parallela (Ach. : Fr.) Fr., but with consistently narrow ascospores and strong gray pigments in the ascomata, causing them to be black.

Type: Canada: British Columbia, Mt. Revelstoke National Park, summit trail on Mt. Revelstoke, 51°02’N, 118°00’W, lignicolous on Abies [lasiocarpa] snag, old-growth ESSF [Engelmann spruce-subalpine fir forest] with Tsuga mertensiana, ca. 1800 m, 01 Aug 2005, T. Goward 05-83 (UBC, holotype; GZU, isotype).

Etymology: From Greek στενóς, narrow + spore, a reference to the characteristic narrow ascospores.

Ascomata with lateral growth of parallela-type; form linear to narrowly ellipsoid, 0.55–1.6 × 0.2–0.8 mm, L/W ratio 3.71±1.33; disc flat to slightly concave, dark brown to black, matte with a roughened surface, margin straight or occasionally “crimped”, black in young ascomata, persistent in older ascomata; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface in section, 22–55 μm wide laterally; excipular hyphae pigmented brown and gray externally, internally with birefringent hyphal cell walls (POL+); hypothecium ca. 70 μm deep, hyaline; hymenium 70–100 μm deep, hyaline; hemiamyloid (ILugols+ greenish → rust red), consisting of asci 50–70 × 14–20 μm, embedded in a matrix of slender, simple or sparsely branched paraphyses 1.5–3 μm wide at midpoint, distally moniliform and abruptly thickened to 5 μm in the apical cell, with both brown and gray wall pigments, together appearing at times greenish; ascospores 8/ascus, narrowly ellipsoid, (10.0–)10.9–12.7(–14) × (3–)3.3–4.5(–5) μm (L/W ratio 3.06±0.33) (n = 80). Conidiomata black, globose, adjacent to and apparently freely mixed with ascomata, not segregated, ca ¾ immersed, ca. 100–120 μm diam, with wall of laterally interwoven hyphae appearing paraplectenchymatous in section, hyphae with internal brown wall and gray pigments; conidia filiform, curved, 14–18 × ca. 0.5 μm. Sterile hyphae contacting immersed algal plugs 90–250 × 40–90 μm situated between wood fibres, these occasionally forming shallow surficial areoles; goniocysts not seen. Associated algae Trebouxia sp., 10–15 μm diam.

Chemistry: stictic acid, or no substances detected in about half the specimens.

Substrate affinity: apparently early successional on recently decorticated wood: six of the eleven recent collections seen are from hard snags, one from hard wood of a bridge deck, and four from hard logs.

Macroecology: mainly in mid-elevation, montane conifer forests.

This is one of the most geographically restricted of the new species described here, according to present knowledge. It is known only from subcontinental regions in the Rocky Mountains and nearby mountain ranges in a line running from the northern British Columbia to western Montana, with two occurrences in central Canada.

Xylographa stenospora possesses the same gray pigment known from other members of the X. parallela group but in no other species is it as dominant. As a result, the ascomata are typically jet black, a good field character for recognition. In addition, the ascomata of X. stenospora have not been seen to break or peel off the substrate as is common in X. pallens, X. rubescens and sometimes X. parallela. X. stenospora is similar to X. difformis but the latter species always has a well developed surficial thallus and contains norstictic acid, in addition to possessing longer ascospores (Table 4).

Additional specimens examined: Canada: British Columbia, Mile 81 Alaska Highway, 10 Jul 1967, J.W. Thomson 23452 & T. Ahti (CANL); Wells Gray Prov. Park: Philip Lake Meadows, 14 Jun 1978, T. Goward 78-383 (UBC); East Kootenays, White River area, 28 Jul 2005, T. Spribille 16628 (UBC); ibid., 31 Jul 2005, T. Spribille 16884 (UBC); East Kootenays, Rocky Mountains, White River region E of Canal Flats, Moscow Road, 50°20.559‘N, 115°35.277‘N, 1062 m, 01 Aug 2005, T. Spribille 16952 (UBC); Kootenay River E of Canal Flats, Dry Creek, 04 Aug 2005, T. Spribille 17204 (UBC); Selkirk Mountains, Incomappleux River drainage, Boyd Creek, on worked wood of bridge deck, 23 Aug 2005, T. Spribille 18256 (GZU); Selkirk Mountains, Goat Range, Dennis Creek, 18 Jul 2006, T. Spribille 20224 (GZU); Mud Lake, C. R. Björk 13454 (UBC); Manitoba, W shore of Blueberry Lake, S of Lake Kisseynew, ca. 35 km NE of Flin Flon, 54°54’27”N, 101°26’33”W, 15 Jun 2003, I.M. Brodo 31221B (CANL); Northwest Territories, Keewatin, N end of Lake Ennadai, 19 Jul 1960, J. W. Thomson 20773 (CANL); U.S.A.: Montana, Glacier Co., Glacier National Park, Lower Two Medicine Lake, Scenic Point Trail just above trailhead, 15 Oct 2007, T. Spribille s.n. (GZU); Lincoln Co., Ten Lakes Scenic Area, Wolverine Basin, 21 Jul 2006, T. Spribille 20345 (GZU); Washington, Spokane Co., Riverside State Park, C.R. Björk 14172 (UBC).

Xylographa trunciseda (Th. Fr.) Minks ex Redinger (Fig. 22)

Rabenhorsts Kryptogamenflora 9, Abt. 2/1: 216 (1938); Lecidea trunciseda Th. Fr., Lichenographia Scandinavica, pars secunda: 467 (1874). Type: [Sweden:] Dalsland, Heden i Laxarby, 1870, J. Hulting s.n. (LD-1163605, lectotype, designated here; H, isolectotype). TLC: confriesiic acid.

= Xylographa parallela f. elliptica Nyl. apud Leight., Lich. Fl. Great Britain: 391 (1879). Type: [United Kingdom: Scotland,] ad ligna vetusta putrefacta apud Blaire Athole, JMC [= J.M. Crombie] (H-NYL 4665, holotype!). TLC: confriesiic acid. According to Leighton (1879), the specimen was collected in 1872.

Ascomata with lateral growth of trunciseda type, forming chains with next generation ascomata regenerating from the outer tips of empty excipular shells; form broadly ellipsoid, 0.2–3.9 × 0.09–0.24 mm, L/W ratio 2.22±0.48; disc concave to flat, light to dark brown, matte, with inconspicuous, thin, brown margin, concolourous with the disc, not flexuose; rarely prominent; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface in section or occasionally with “flaps”, 20–45(–67) μm wide; excipular hyphae pigmented light brown externally, inner excipular hyphae faintly birefringent and POL+; hypothecium 30–50(–70) μm tall, hyaline; hymenium easily separating from exciple in gentle water squash, 60–85 μm tall, hyaline or hazy yellow-brown, hemiamyloid (ILugols+ blue-green → rust red) in all samples studied, consisting of asci 57–75(–90) × 12–15(–19) μm embedded in a matrix of slender, sparsely branched paraphyses 1.2–2.0 μm at midpoint, distally thickened to 3.5 μm in the apical cells, these sprawling over the surface of the hymenium, with pale brown wall pigments; ascospores 8/ascus, ellipsoid, (8.5–)10.1–11.3(–13) × (4.5–)5.2–6.1(–7) μm (L/W ratio 2.22±0.48) (n = 41). Conidiomata not seen. Sterile hyphae sprawling in surrounding xylem cells, forming lichenized goniocysts around single to multiple algal cells, the goniocysts with paraplectenchymatous “cortex”, 10–40 μm diam, mostly endosubstratal, the “thallus” thus appearing similar to a biofilm. Associated algae chlorococcoid, 8–15 μm diam.

Chemistry: confriesiic acid constant and major in all samples.

Substrate affinity: on conifer logs, also infrequently on lignum of Betula, rare on snags.

Macroecology: in old forests in the boreal and oroboreal zones, circumboreal.

Xylographa trunciseda is a widespread, though much misunderstood species that has been inadequately explained in the literature; nearly ¾ of the material seen from northern Europe was filed under another name. It is in fact easy to recognize once the habit of the short, “American football”-shaped ascomata (Fig. 22B, C) is understood, and it possesses a characteristic chemistry, as explained by Brodo (1992). In a few specimens (e.g. Brodo 18257, CANL, F) the exciple is strongly swollen and nearly eclipses the disc when dry, however these specimens are anatomically and chemically concordant with X. trunciseda. We further obtained DNA sequences for at least one such specimen (Björk 12399, UBC) and verified that they not differ from those of typical X. trunciseda.

Xylographa trunciseda was one of the few lichen species in a recent study to be statistically significantly associated with older forests (Bunnell et al. 2008), and its ecology as an oldgrowth forest species has been borne out by years of field observation. The overwhelming majority of material of X. trunciseda seen from both northern and central Europe was collected before 1950, and the species should be considered highly threatened here due to loss of substrate and habitat. The species is known from Europe, Atlantic Maritime Canada, and western North America from Alaska to Colorado (Spribille & Björk 2008) and is reported here as new to Asia, the Czech Republic, Germany and Greece.

Exsiccate: Finland: Norrlin & Nylander, Herb. Lich. Fenn. 789 (BM!, G!, H!, as X. parallela f. pallens).

Additional specimens examined (only previously un published specimens, see also Spribille & Björk 2008): Austria: Salzburg, Pongau, Gasteiner-Tal, SE von Böckstein, Anlauftal, zwischen der Ortschaft Anlauftal und dem Gasthof Marienbad, 1190 m, 28 Feb 1994, H. Wittmann s.n. (LI); Styria, Sölktal, slope above Breitlahnhütte, 26 Sept 2011, T. Spribille & H. Mayrhofer s.n. (GZU); Canada: Alberta, Jasper National Park, Miette Hot Springs, N slope at the campground mountain, 4 Aug 1962, A. Henssen 14403i & R.F. Cain (H, sub Ptychographa xylographoides); British Columbia, Zopkios Ridge, Coquihalla Highway, 22 May 1993, I.M. Brodo 28489 (CANL); Graham Island, ca. 4 miles W of Tow Hill, 13 Jul 1971, I.M. Brodo 18257 (CANL, F); Moresby Island, Sandspit, 19 Jun 1967, I. M. Brodo 10069 (F); Newfoundland, Grand Falls Distr., Sandy Lake Dam, 17 Jul 1956, T. Ahti 7948 (H); Québec, Pontiac County, Parc de la Vérendrye, 47°14’N, 76°47’W, 5 Jul 1970, I.M. Brodo 16756 (CANL); China: Yunnan, Jian Chuan Co., San Jiang Bin Liu area, trailhead to mt. Lao Juen Shan, 3800 m, 26°37’56.2”N, 99°43’30.8”E, 18 Oct 2002, C. Printzen 7275 p.p. (FR); Czech Republic: [province not indicated,] Lichenes Bohemiae, na starém dříví v Krkonoších, 1931, V. Kut’ak s.n. (GZU); Finland: Satakunta, Kankaanpää, 1937, M. Laurila (H); Tavastia australis, Tammela, Kuusto, 1869, A. Kullhem (H), Ylöjärvi, Pengonpohja, 5 Jun 1921, A. A. Sola (H); Germany: [Bavaria,] Nationalpark Bayerischer Wald, Bayerisch-Böhmischer Wald, am Weg von der Schwarzbachklause zum Kirchlinger Stand, 19 Aug 1984, J. Poelt s.n. (GZU); Greece: Epirus, along Aoos River, 39°57’08”N, 21°03’10”E, on Pinus nigra wood, 965 m, 06 Jul 2005, T. Spribille 16060 (GZU); Russia: Khabarovskiy Krai De Kastri-Komsomolsk route, 30 km (air line) WSW of De Kastri, near watershed divide between Chistiy and Khanda River watersheds, 51°23.260’N, 140°21.758’E, 135 m, 20 Jul 2009, T. Spribille 31080 & L. Yakovchenko (GZU); foothills of the Etkil’-Yankanskiy Mountains, Amgun’ River region, 9.7 km (air line) due N of Berozovyy, accessed via garbage landfill road, 51°46.193’N, 135°41.045’E, elev. 550 m, 24 Jul 2009, T. Spribille 31282 & L. Yakovchenko (GZU, LE); Sweden: Södermanland, Västermo, Malmberga, 1881, O.G. Blomberg p.p. (BM, F, G); ibid., 1882, O.G. Blomberg s.n. (M); U.S.A.: California, Del Norte Co., Siskiyou National Forest, Sanger Lake, 1760-1830 m, 11 June 1984, T. Ahti 42608 & D. Norris (H); Oregon, Hood River Co., along Hwy. 38, 8 km SE of Mt. Hood, along highway, at snowmobile parking area (Teacup Snopark Parking), 1307 m, 20 Sep 2008, T. Spribille 29876 (GZU); Vermont, Underkill, 18 May 1880, C. Pringle 519 (FH).

Xylographa vermicularis T. Sprib., sp. nov. (Fig. 23). Mycobank No.: MB 805262

Fig. 23. Xylographa vermicularis T. Sprib.

Fig. 23

A, B, habit of type material, A dry, B moistened; C, D, habit of Alaskan material, C dry, D moistened; E, ascomatal section, in water; F, asci, ascospores and paraphyses, in ILugols after pretreatment with KOH. A, B, F: holotype; C, D, E: U.S.A., Alaska, Spribille 27762 (GZU, DNA voucher 821). Scale bars: A, B, 0.2 mm; C, D, 0.5 mm; E, 20 μm; F, 10 μm.

Similar to X. trunciseda (Th. Fr.) Minks ex Redinger, but differing in the longer and broader ascospores 12.2–14.1 × 6.8–8.4 μm, and the chemistry (confriesiic and stictic acids); also similar to X. vitiligo (Ach.) J.R. Laundon, but differing in the high density of ascomata, the larger ascospores and the presence of confriesiic acid.

Type: Russia: Khabarovskiy Krai, Khomi Mountains, De Kastri-Komsomolsk route, between Tsimmermannovka and Chernyy Mys; Gorelaya Mountain, logging road S into mountains, Khivanda Creek drainage, 51°08.565’N, 139°09.775’E, Abies nephrolepis-Picea jezoensis forest, logged areas, lignicolous on logs, 460 m, 21 Jul 2009, T. Spribille 31246, C. Printzen & L. Yakovchenko (H, holotype; F, FR, GZU, LE, M, NY, TNS, UBC, isotypes) Etymology: from Latin vermiculus, little worm, referring to the habit of the ascomata when dry.

Ascomata with growth of trunciseda-type, proliferating laterally; form ellipsoid to long-ellipsoid, flexuose-vermiform, acute at the tips, 0.18–0.48 × 0.09–0.21 mm, L/W ratio 2.19±0.57; disc concave, swelling to flat when wet, beige to pale brown, matte, with thin, pale margin, inconspicuous to prominent, sometimes forming “flaps”; exciple of laterally interwoven hyphae, appearing paraplectenchymatous in vertical section, flush with the hymenium surface or overtopping it in section, 17–50 μm wide; excipular hyphae pigmented brown externally, partially or wholly birefringent in cell walls (POL+); hypothecium 40–90 μm deep, hyaline; hymenium (40–)80–120 μm deep, hyaline, hemiamyloid (ILugols+ blue-green → rust red) or euamyloid (ILugols+ blue), with a striking salmon hue when ILugols is cleared with KOH, consisting of asci 72–100 × 15–19 μm embedded in a matrix of long, slender, sparsely branched, gangly paraphyses 1–1.5 μm at midpoint, distally moniliform and thickened to 2.5–3 μm in the apical cells, looping onto top of hymenium, unpigmented or with pale brown wall pigments; ascospores 8/ascus, broadly ellipsoid, (11–)12.2–14.1(–17.5) × (5.5–)6.8–8.4(–11) μm (L/W ratio 1.77±0.2) (n = 59). Conidiomata adjacent to ascomata but segregated, mostly immersed, globose, to 90 μm diam, with light brown paraplectenchymatous wall; conidia short-filiform or long-bacilliform, straight, 10–12 × ca. 0.7 μm. Sterile hyphae at least sometimes amyloid, ILugols+ blue in patches below ascoma; contacting endosubstratal algal plugs to 250 × 100 μm, becoming confluent, displacing wood fibres when wet and swelling, and given the thallus an “unkempt” appearance; thallus (in combination with surface wood grain) acquiring a whitish gray to metallic gray hue when dry; goniocysts rare, present in delimited soralia in few specimens, unpigmented. Associated algae chlorococcoid, 8–15 μm diam.

Chemistry: confriesiic acid (major), stictic acid (submajor to trace), rarely confriesiic acid alone.

Substrate affinity: on wood of logs and decorticated branches of conifers, once on Betula, in the type specimen spreading secondarily as small thalli onto Cladonia squamules; also once on Abies nephrolepis bark.

Macroecology: in high latitude conifer forests in the summer-wet, winter-dry (‘monsoonal’) climates of the Russian Far East, Japan and central Alaska; at altitudes of sea level to 1200 m.

Xylographa vermicularis was first seen by us in a collection from the island of Sakhalin and has subsequently been discovered at several near-coastal sites on the mainland of the Russian Far East, as well as Japan and Alaska. Especially characteristic for X. vermicularis is a metallic gray thallus that develops below a thin layer of wood fibres and distends it when wet. The combination of confriesiic and stictic acids is diagnostic. Xylographa vermicularis strongly resembles X. erratica and can be macroscopically impossible to distinguish from it, especially when dry. However, in section it is easily separated by its much deeper hymenium and the size of its ascospores, which are among the largest in the genus, and the two are easily separated by TLC (see Table 3, p. 43 for further comparisons).

Xylographa vermicularis is closely related to X. vitiligo and this relationship is strongly supported in both the Bayesian and maximum likelihood analyses. More work is needed in this group. The species pair X. vermicularis-X. vitiligo is the only one in which the respective species are not reciprocally monophyletic, which may be caused by the inclusion of a Chilean sample of X. aff. vermicularis in the tree. This specimen is morphologically close to X. vitiligo but possesses the chemistry of X. vermicularis, and is genetically divergent enough from both to be unresolved in our current topology. A similar sorediate specimen with stictic and confriesiic acids has also been seen in historical material from southern Siberia (Brenner 483d, H).

Additional specimens examined: Japan: Hokkaido, Ishikari Prov., Kamikawagun, Kamikawacho, just S Daisetsukogen hot spring hotel (Onsen), alt. 1200 m, 43°37.30’N, 142°56’E, humid, oldgrowth coniferous forest with Abies sachalinensis, Picea glehnii and P. jezoensis, 1995, T. Tønsberg 23210-11 (BG); Russia: Sakhalinskaya Oblast’, [Sakhalin Island], Noglikskiy Rayon, 2 km S of Nogliki, 51°45’30.1”N, 143°05’48.5”E, 26 Jul 2004, C. Printzen 9388 (FR); Primorskiy Krai, Oblachnaya Mountain, 20 km (air line) E of Yasnoye, 43°40.617’N, 134°12.761’E , 21 Aug 2007, T. Spribille 23687 & P. Krestov (GZU); Kamchatka, southern slope of Tolbachik Volcano, 55°37’45.5”N, 160°12’40”E, 560 m, D.E. Himelbrant & I.S. Stepanchikova s.n. (H); eastern Kamchatka, Elizovsky District, Kronotsky Nature Reserve, 55°08’10”N, 159°58’55”E, 330-340 m, 03 Aug 2009, D.E. Himelbrant & I.S. Stepanchikova s.n. (H); Khabarovskiy Krai, De Kastri-Lazarev route, Vidanovo wetland complex, swampy valley of the River Psyu, ca. 1.7 km E of Vidanovo, 6.5 km W of seashore, 51°59.759’N, 141°15.000’E, 3 m elev, 16 Jul 2009, T. Spribille 30863 (H); 33.7 km (air line) due W of Lazarev, up small side road in Sredniy Khrebet Mountains, between Studeniy and Zvuchnaya streams, 52°13.451‘N, 141°00.428‘E, corticolous on bark patches of log, probably of Abies nephrolepis, 56 m elev., 16 Jul 2009, C. Printzen, L. Yakovchenko & T. Spribille 30992 (GZU, H); Bogorodskoe-De Kastri route, 30.5 km (air line) N of De Kastri, along main road, 51°44.699’N, 140°49.350’E, 69 m elev, 19 Jul 2009, T. Spribille 31075 (LE); Bureinskiy Zapovednik, upper reach of the Pravaya Bureya River, Tsarskaya Doroga, small unnamed stream ca. 1200 m N of patrol cabin ‘Staraya Medvezhka’, 52°09.318’N, 134°19.035’E, 882 m, 4 Aug 2009, T. Spribille 31902 & L. Yakovchenko (GZU); U.S.A.: Alaska, Kenai Peninsula, Russian River, 9 Aug 2008, T. Spribille 27320 (GZU); Denali Borough, Summit Lake, Parks Highway, 63°07.411‘N, 149°27.447‘W, lignicolous, 587 m, 17 Aug 2008, T. Spribille 27762 (GZU); Denali Borough, wetlands along Chulitna River below Buckskin Glacier, 62°49.220’N, 150°07.173’W, 312 m, 20 Aug 2008, T. Spribille 28105 (NY); ibid., T. Spribille 28121 (ALA).

Additional specimens examined (X. aff. vermicularis): Chile: Prov. Antártica Chilena, Comuna Cabo de Hornos, N shore of Isla Navarino, N slopes of Pico de la Bandera from Río Robalo dam to 400 m marker, on Nothofagus log, 22 Jan 2013, W.R. Buck 60823 (NY); Russia: [Krasnoyarsk Krai,] Guv. Jenisejsk, Ust-Kureika, 66°20’n. Br., auf Holz, 18.9.1876, M. Brenner 483d (H).

Xylographa vitiligo (Ach.) J.R. Laundon (Fig. 24)

Lichenologist 2: 147 (1963). Spiloma vitiligo Ach., Methodus: 10, tab. 1, fig. 4 (1803). Type: [probably Sweden:] E. Acharius s.n. (BM-ACH, lectotype!). For lectotypification see Holien &Tønsberg (2008).

= Agyrium spilomaticum Anzi, Comment. Soc. Crittog. Ital. 2: 20 (1864); Xylographa spilomatica (Anzi) Th. Fr., Lichenogr. Scand.: 639 (1874). Type: [Italy: Lombardy, Prov. Sondrio] Bormio, Anzi, Lich. Rar. Langob. Exs. 385 (UPS!, lectotype designated by Holien & Tønsberg 2008; also present in H-NYL p.m. 6769, but not studied by TLC).

= Xylographa corrugans Norman, Bot. Not. 1872(2): 34 (1872). Type: Norway: Finnmark, in Alten ad Skaidi, sinus Rafsbotten, Norman (UPS, lectotype!). See Holien & Tønsberg (2008) for lectotypification.

Ascomata solitary or adjacent in groups to 3 mm in diameter, rarely proliferating outwards at multiple points and forming “rings” (e.g. in P.A. Karsten s.n., 1860, H), with lateral growth of trunciseda-type, usually straight, occasionally slightly curved, mostly ± rounded, ellipsoid or fusiform, rarely substellate, 0.3–0.6 × 0.1–0.3 mm; margin often reflexed, dark brown to medium brown, becoming light brown by age, often glossy, unpigmented towards the hymenium, to 0.06 mm wide; disc concave to flat, rarely convex, grayish white to brown, becoming pale brownish to rose in widely exposed discs; exciple brown in outer part, the brown pigment K−, colourless towards the hymenium, 24–72 μm wide in uppermost part; hypothecium colourless, of thick-walled cells with narrow lumina, 48–72 μm deep, in lower part not well separated from excipulum; POL+ birefringence present in excipulum rim, at least in the inner, colourless part, in epihymenium and sometimes also in upper part of hymenium; hymenium brown above, otherwise colourless, 72–108 μm deep, consisting of para-physes 1–1.5 μm thick, widening to 2.5(–3.5) μm in upper part, uppermost paraphysis cells brown; asci narrowly clavate, 65–95 × 10–17 μm; ascospores 8/ascus, simple, mostly straight, sometimes slightly curved, elongate with rounded ends to ellipsoid, rarely obovoid or dacryoid, (8–)10.9–11.5(–15.5) × (4–)4.9–5.5(–7)(L/W ratio 2.27±0.48) (n = 78). Conidioma observed once (Tønsberg 23551) as a rounded mass of conidia in ± squashed section of an apothecium, conidia filiform, ± curved, (12–) 15–20 μm. Sterile hyphae lichenized, developing in the wood, colourless, forming endosubstratal areoles (tuberculae) which at first are covered by the uppermost layer of the wood, later bursting open to form convex soralia producing goniocysts (= soredia); soralia concave to slightly convex, sometimes distinctly convex, at first often brown due to pigmentation of the external soredia, later, when the external soredia have been shed, ±dirty white, rounded, ellipsoid or fusiform, 0.2–0.6(–1.0) × 0.2–0.3(–0.8) mm in diam, confluent soralia forming elongate patches to several mm long; soredia colourless or, especially in the outwardly facing part of external soredia, brown, globose with a more or less distinct paraplectenchymatous wall, 19–45 μm diam, becoming conglutinated; into colourless or brown, rounded to irregularly rounded “consoredia”, these 22–50(–70) μm diam. Photobiont (endosubstratal and in episubstratal soredia/consoredia) chlorococcoid, (6–)8–12(–15) μm.

Chemistry: stictic acid with satellites. Brown pigment in excipulum, epithecium and wall of sore-dia/consoredia: K−.

Substrate affinity: on wood of logs, snags and decorticated twigs, also on worked wood and maritime driftwood; usually on conifers but also recorded on Betula.

Macroecology: in boreal and montane forests from ca. 35°N in Arizona to the Arctic, from sea level to treeline.

Xylographa vitiligo is a widespread species of logs and snags in boreal and montane forests. It has been widely reported in the past, though in some regions old records may refer to X. septentrionalis, X. soralifera, or, in rare cases, X. schofieldii. X. vitiligo is most easily distinguished from X. septentrionalis by its often cavate soralia with apparently “soft” goniocysts. The goniocysts acquire the “soft” or matte habit from the roughened surface as seen in SEM (Fig. 24D). In X. septentrionalis, by contrast, the goniocysts are smaller, brown, and not roughened (Fig. 19F), and are not borne in cavate soralia. X. vitiligo can be easily separated from X. soralifera by chemistry (stictic as opposed to fumarprotocetraric acid) and the greenish, convex soralia of X. soralifera. Both X. vitiligo and X. soralifera commonly possess conglutinated and confluent goniocysts (“consoredia”: Fig 24A-D and Fig. 24C-D); the goniocysts of X. septentrionalis and X. schofieldii, by contrast, remain largely discrete (Figs. 18E-F, 19E-F).

We report Xylographa vitiligo here as new to China. Numerous specimens from the eastern Alps were mapped by Heininger & Spribille (2009) and are not repeated here.

Exsiccates: Austria: Arnold, Lich. Exs. 563 (H!, M!, as X. minutula); Styria, Obermayer, Dupla Graec. Lich. 200 (M!); Styria, Obermayer, Dupla Graec. Lich. 680 (M!); Styria, Obermayer, Lichenoth. Graec. 12–13: 260 (G!, M!); Norway: Krypt. Exs. 2554 (BG!, F!, M!); Sweden: Södermanland, Malme, Lich. Suecici Exs. 196 (M!); Switzerland: Graubünden, Plantae Graecenses Lich. 347 (G!, M!); United Kingdom: [Scotland,] Vězda, Lich. Sel. Exs. 1478 (M!); U.S.A.: Colorado, Weber, Lich. Exs. 163 (BG!, for other replicates see X. rubescens and X. septentrionalis).

Selected specimens studied: Austria: [border area of Tyrol and Salzburg,] Gerlosplatte, 3 km W of Krimml, 10 Sep 1973, I.M. Brodo 19978 (CANL); Canada: Alberta, Bow River Forest Reserve, 10 Jun 1966, S.D. MacDonald s.n. (CANL); British Columbia, Queen Charlotte Islands, Huxley Island, 52°28’N, 131°21’W, 01 Jul 1971, I.M. Brodo 17517 (CANL, F); Wells Gray Prov. Park, Phillip Lake Meadows, 52°20’N, 120°00’W, 14 Jun 1978, T. Goward 78-375 (UBC); Zopkios Ridge, Coquihalla Highway, 49°36’N, 121°04’W, 22 May 1993, I.M. Brodo 28489 (CANL); Manitoba, Lac Brochet area, 59°00’N, 101°28’W, Apr 1977, P.Y. Wong 975 (CANL); Newfoundland, Gros Morne National Park, 3.2 km SW of St. Paul’s, 24 Jun 1981, C.M. Wetmore 42781 (CANL, mixed with X. trunciseda, see Spribille & Björk 2008); Nunavut, East Pen Island area, 56°45’N, 88°45’W, Aug 1973, K.A. Kershaw s.n. (CANL-98581); Yukon, Wernecke Mtns., Carpenter Lake, 64°30’N, 135°06’W, 25 Jul 1972, G.W. Scotter 19361 (CANL, filed under Xylographa parallela); China: Yunnan, Jian Chuan Co., San Jiang Bin Liu area, trailhead to mt. Lao Juen Shan, 3800 m, 26°37’56.2”N, 99°43’30.8”E, 18 Oct 2002, C. Printzen 7275 p.p. (FR); Norway: Sogn og Fjordane, Gloppen, S of fjord Nordfjord, N of Mt Haugsvarden, Grønlia, 61°50’N, 6°15’E, alt. 340 m, lignicolous on Juniperus communis, 12 May 1998, T. Tønsberg 26070 (BG-L-66291); Nord-Trøndelag, Namsskogan, E of Smalvatn, 65°04’N, 13°22’E, alt. 350–360 m, on Picea abies, stump, 27 Sept 1981, T. Tønsberg 6279 (BG-L-25425); Namsskogan, Børgefjell National Park, Namskroken, 65°05’N, 13°27’E, alt.: 400 m, on Picea abies, wood of stump, 23 Aug 1995, T. Tønsberg 23549 (BG-L-31466), 23550 (BG-L-1467), 23551 (BG-L-96392); Nordland, Grane, Børgefjell National Park, Simskaret, N of Simskarelva, 65°17.31’N, 13°38.02’E, alt. 420–440 m, lignicolous on hard wood of trunk of downed Pinus sylvestris, 11 June 2011, T. Tønsberg 40977a (BG-L-94187); Troms, Bardu, near Lappskardelva, 68°47.72’N, 18°34.34’E, alt. 220–240 m, lignicolous on wood of ?Betula, 15 July 2006, T. Tønsberg 36829 (BG-L-83842); Bardu, SW of Innset, E side of river Dittielva, near the rim of the canyon, 68°39.35’N, 18°47.11’E, alt. 340–360 m, lignicolous on trunk of Betula pubescens, 12 July 2010, T. Tønsberg 40181 (BG-L-89199); Finnmark, Lebesby, Hopseidet, at the Gamvik/Lebesby municipality border, 70°48.04’N, 27°43.80’E, alt. 1–20 m, lignicolous on decayed wood on horizontal ground above the beach, 27 June 2010, T. Tønsberg 39978 (BG-L-94170); Sør-Varanger, Fredheim i Sydvaranger, [69°41’N, 30°8’E, alt.: 15–70 m,] 3.VIII.1906, J.J. Havaas (BG-L-56163); U.S.A.: Arizona, Greenlee County, Bear Wallow Wilderness, 33°36’00”N, 109°25’00”W, 07 Jun 1998, T.H. Nash 41891a (ASU); Oregon, Lane Co., near mouth of Gwynn Creek on Pacific Ocean, 44°17’N, 124°06’W, 23 Feb 1996, B. McCune 23438 (ASU); Washington, San Juan Co., San Juan Island SE, American Camp, South Beach, 48°27.4’N, 123°00.3’W, alt. 0–5 m, on wooden fence at inner part of beach, 02 Oct 1998, T. Tønsberg 26778 (BG; duplicates will be distributed in Tønsberg, Lich. Isid. Sor. Crust. Exs.).

Excluded taxa

Xylographa arctica Fuckel in Lindeman & Finsch, Die zweite deutsche Nordpolarfahrt 2: 95 (1874). Type: Greenland: Kaiser-Franz-Josefs-Fjord (G, holotype!). The specimen at G bears the inscription “Xylographa arctica n. sp. Salix? (arctica; Kaiser Franz Joseph Fiord Nova Zemblia) Herbier Fuckel 1894”. The attribution of the specimen to Novaya Zemlya must be taken as an error. Fuckel (1874) indicated “ascos nondum inveni” (= asci not yet found) and what he thought were coloured ascospores are large brown conidia similar to those in Phaeoblastophora resinae (Fr. : Fr.) Partr. & Morgan-Jones; the specimen represents an unidentified hyphomycetous black fungus and does not belong to Lecanoromycetes.

Xylographa orientalis Navrotska, Ukr. Bot. Zhurn. 33: 277 (1976). This species was described by Navrotskaya (1976) from Tilia amurensis bark in the Russian Far East, but original material could not be found during a 2008 visit to KW nor in a recent search of TU (A. Suija, pers. comm.).

Xylographa perangusta (Stirt.) Müll. Arg., Bull. Herb. Boissier 2 (App. 1): 76 (1894); Arthonia perangusta Stirt., J. Linnean Soc. Bot. 14: 470 (1875). Type: New Zealand: near Wellington, J. Buchanan (BM-001084674, isotype!; the holotype, in GLAM, was seen by Galloway 2007). The “apothecia” are sporodochia, possibly aff. Tylophoron (Arthoniomycetes).

Xylographa perminuta (Juss. ex Müll. Arg.) R.W. Rogers, Muelleria 5: 33 (1982); Lecanora perminuta Juss. ex Müll. Arg., Bull. Herb. Boissier 1: 39 (1893, ‘1892’). Type: [Australia:] Victoria, Mt. Macedon, F.R.M. Wilson (G, holotype!). May be a species of Lecanora, as described.

Xylographa perparvula (Stirt.) Müll. Arg., Bull. Herb. Boissier 2 (App. 1): 76 (1894); Arthonia perparvula Stirt., Proc. Phil. Soc. Glasgow 10: 301 (1877). Type: New Zealand: not found, also not found by Galloway (2007).

Xylographa scaphoidea Stirt., Grevillea 3: 35 (1874). Type: not found. Described by Stirton (1874) from “ad alnum decorticatum prope Dalwhinnie et Grantown”, Scotland. The type could not be found at GLAM or BM but may be in unsorted specimen backlogs at BM (H. Thüs, pers. comm.).

Acknowledgements

We would like to thank the curators of the herbaria ALA, BG, CANL, F, FH, FR, G, GZU, H, L, LD, LI, M, MSC, NBM, NY, O, TO, TUR, UBC, UPS, W and WU as well as Curtis Björk, Trevor Goward and Bruce McCune for loans of specimens and the kind people of BM, H, KW and VER, especially Holger Thüs, Sergei Kondratyuk and Francesco di Carlo, for their hospitality on visits to their herbaria. Andy Acton, Curtis Björk, Stephen Clayden, Brian Coppins, Alan Fryday, Lucia Muggia, Göran Thor and Tim Wheeler are thanked for kindly providing fresh material for molecular studies. Einar Timdal provided us yet-unpublished sequences of X. isidiosa, as well as a photo of the type of X. hians, for which we are grateful. Robert Lücking kindly took photographs of several specimens on loan to F, Florian Ernemann assisted in the Pritzker Lab and Edith Stabentheiner assisted us with scanning electron microscopy in Graz. Teresa Craighero assisted with thin layer chromatography at an early stage of this project. Irwin Brodo and Einar Timdal are thanked for their detailed reviews of an earlier version of this manuscript and Inga Hedberg and Leif Tibell for copy-editing. This project was made possible by a visiting scholar grant to TS from the Field Museum (2008) and by a grant from the Austrian Science Fund (FWF P25237).

Literature

  1. Baloch E, Lücking R, Lumbsch HT, Wedin M. Major clades and phylogenetic relationships between lichenized and non-lichenized lineages in Ostropales (Ascomycota: Lecanoromycetes) Taxon. 2010;59:1483–1494. [Google Scholar]
  2. Bao J, Xia H, Zhou J, Liu X, Wang G. Efficient implementation of Mr Bayes on multi-GPU. Mol. Biol. Evol. 2013;30:1471–1479. doi: 10.1093/molbev/mst043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baral HO. Lugols solution / IKI versus Melzers reagent: hemiamyloidity, a universal feature of the ascus wall. Mycotaxon. 1987;29:399–450. [Google Scholar]
  4. Barreno E, Pérez-Ortega S. Liquenes de la Reserva Natural Integral de Muniellos, Asturias. Consejeria de Medio Abiente, Ordenacion del Territorio e Infraestructuras del Principado de Asturias; KRK Ediciones; Oviedo: 2003. [Google Scholar]
  5. Behlen S, Desberger FA. Naturgeschichte und Beschreibung der Deutschen Forstcryptogamen. Erfurt and Gotha: 1835. [Google Scholar]
  6. Bendiksby M, Timdal E. Molecular phylogenetics and taxonomy of Hypocenomyce sensu lato (Ascomycota, Lecanoromycetes) — extreme polyphyly and morphological convergence. Taxon. 2013;62:940–956. [Google Scholar]
  7. Brodo IM. Bryoria trichodes, Ochrolechia oregonensis and Xylographa opegraphella new to Europe. Graphis Scripta. 1992;4:61–65. [Google Scholar]
  8. Bunnell FL, Spribille T, Houde I, Goward T, Björk C. Lichens on down wood in logged and unlogged forest stands. Can. J. For. Res. 2008;38:1033–1041. [Google Scholar]
  9. Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 2000;17:540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [DOI] [PubMed] [Google Scholar]
  10. Clements FE, Shear CL. The genera of Fungi. H.W. Wilson Company; New York: 1931. [Google Scholar]
  11. Coppins BJ. A taxonomic study of the lichen genus Micarea in Europe. Bull. Brit. Mus. (Nat. Hist.), Bot. Ser. 1983;11(2):1–214. [Google Scholar]
  12. Cubeta MA, Echandi E, Abernethy T, Vilgalys R. Characterization of anastomosis groups of binucleate Rhizoctonia species using restriction analysis of an amplified ribosomal RNA gene. Phytopathology. 1991;81:1395–1400. [Google Scholar]
  13. Culberson CF. Improved conditions and new data for the identification of lichen products by a standardized thin-layer chromatographic method. J. Chromatography. 1972;72:113–125. doi: 10.1016/0021-9673(72)80013-x. [DOI] [PubMed] [Google Scholar]
  14. Culberson CF, Johnson A. Substitution of methyl tert.-butyl ether for diethyl ether in standardizded thin-layer chromatographic method for lichen products. J. Chromatography. 1982;238:483–487. [Google Scholar]
  15. Elix JA. New species of sterile crustose lichens from Australasia. Mycotaxon. 2005;94:219–224. [Google Scholar]
  16. — Lichen phytochemistry III: further additions and amendments. Australasian Lichenology. 2011;68:22–26. [Google Scholar]
  17. Elix JA, Tønsberg T, Wardlaw JH. The structure of friesiic acid, a novel lichen substance from Hypocenomyce friesii. Bibliotheca Lichenologica. 2004;88:103–109. [Google Scholar]
  18. Ertz D, Miadlikowska J, Lutzoni F, Dessein S, Raspe O, Vigneron N, Hofstetter V, Diederich P. Towards a new classification of the Arthoniales (Ascomycota) based on a three-gene phylogeny focussing on the genus Opegrapha. Mycol. Res. 2009;113:141–152. doi: 10.1016/j.mycres.2008.09.002. [DOI] [PubMed] [Google Scholar]
  19. Ertz D, Tehler A. The phylogeny of Arthoniales (Pezizomycotina) inferred from nucLSU and RPB2 sequences. Fungal Divers. 2011;49:47–71. doi: 10.1007/s13225-010-0080-y. [DOI] [Google Scholar]
  20. Fries EM. Systema Mycologicum, sistens fungorum ordines, genera et species, huc usque cognitas, quas ad normam methodi naturalis determinavit, disposuit atque descripsit. Volumen II. Lundae: 1822. [“1823”] [Google Scholar]
  21. Fries E. Summa Vegetabilium Scandinaviae. Sectio posterior. A. Bonnier, Holmiae et Lipsiae; 1849. pp. 259–572. [Google Scholar]
  22. Fuckel L. Endophytische Pilze. In: Verein für die deutsche Nordpolarfahrt in Bremen, editor. Die Zweite Deutsche Nordpolarfahrt in den Jahren 1869 und 1870 unter Führung des Kapitän Karl Koldewey. Zweiter Band. Wissenschaftliche Ergebnisse. Brockhaus, Leipzig: 1874. pp. 90–96. [Google Scholar]
  23. Galloway D. Flora of New Zealand Lichens. Revised Second Edition including Lichen-Forming and Lichenicolous Fungi. Manaaki Whenua Press; Lincoln, New Zealand: 2007. [Google Scholar]
  24. Gardes M, Bruns TD. ITS primers with enhanced specifity for Basidiomycetes: application to identification of mycorrhizae and rusts. Mol. Ecol. 1993;2:113–118. doi: 10.1111/j.1365-294x.1993.tb00005.x. [DOI] [PubMed] [Google Scholar]
  25. Gargas A, DePriest PT, Grube M, Tehler A. Multiple origins of lichen symbioses in fungi suggested by SSU rDNA phylogeny. Science. 1995;268:1492–1495. doi: 10.1126/science.7770775. [DOI] [PubMed] [Google Scholar]
  26. Giavarini V, Orange A. Xylographa (Fr.) Fr. (1836) In: Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA, editors. The lichens of Great Britain and Ireland. British Lichen Society; London: 2009. pp. 973–974. [Google Scholar]
  27. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Ser. 1999;41:95–98. [Google Scholar]
  28. Harmand J. Catalogue descriptif des lichens observés dans la Lorraine. Bull. Soc. Sci. Nancy Sér. 2. 1900;16:46–124. [Google Scholar]
  29. Hedlund T. Kritische Bemerkungen über einige Arten der Flechtengattungen Lecanora, Lecidea und Micarea. Bih. K. Svenska Vet.-Akad. Handl. 1892;18(3):1–104. [Google Scholar]
  30. Heininger C, Spribille T. The sorediate species of Xylographa in Austria (Baeomycetales, lichenized Ascomycetes) Herzogia. 2009;22:129–134. [Google Scholar]
  31. Hertel H. Über saxicole, lecideoide Flechten der Subantarktis. Nova Hedwigia Beih. 1984;79:399–499. [Google Scholar]
  32. Hertel H. Bemerkenswerte Funde südhemisphärischer, saxicoler Arten der Sammelgattung Lecidea. Mitt. Bot. Staatssammlung München. 1987;23:321–340. [Google Scholar]
  33. Hertel H, Rambold G. Zur Kenntnis der Familie Rimulariaceae (Lecanorales) Bibliotheca Lichenologica. 1990;38:145–189. [Google Scholar]
  34. Hodkinson BP, Lendemer JC. The orders of Ostropomycetidae (Lecanoromycetes, Ascomycota): recognition of Sarrameanales and Trapeliales with a request to retain Pertusariales over Agyriales. Phytologia. 2011;93:407–412. [Google Scholar]
  35. Holien H, Tønsberg T. Xylographa soralifera, a new species in the X. vitiligo complex. Graphis Scripta. 2008;20:58–63. [Google Scholar]
  36. Huneck S, Yoshimura I. Identification of Lichen Substances. Springer-Verlag; Berlin, Heidelberg: 1996. [Google Scholar]
  37. Körber GW. Parerga lichenologica. Breslau: 1861. pp. 193–288. [Google Scholar]
  38. Leighton WA. The lichen-flora of Great Britain, Ireland and the Channel Islands. Shrewsbury: 1879. Third Edition. [Google Scholar]
  39. Lettau G. Beiträge zur Lichenographie von Thüringen. Hedwigia. 1911;51:176–220. [Google Scholar]
  40. Liška J. The significance of Körber’s “Typenherbar”, with an explanation of the locality abbreviations on his labels. Lichenologist. 2013;45:25–33. [Google Scholar]
  41. Lücking R, Hawksworth DL. Names for lichen-forming fungi introduced by Ciferri and Tomaselli are illegitimate and not available for use, except for three cases. Taxon. 2007;56:1274–1284. [Google Scholar]
  42. Lumbsch HT. Systematic studies in the suborder Agyriineae (Lecanorales) J. Hattori Bot. Lab. 1997;83:1–73. [Google Scholar]
  43. Lumbsch HT, Huhndorf SM. Myconet Volume 14. Part One. Outline of Ascomycota –2009. Part Two. Notes on Ascomycete Systematics. Nos. 4751-5113. Fieldiana Life and Earth Sciences. 2010;1:1–64. [Google Scholar]
  44. Lumbsch HT, Schmitt I, Döring H, Wedin M. ITS sequence data suggest variability of ascus types and support ontogenetic characters as phylogenetic discriminators in the Agyriales (Ascomycota) Mycol. Res. 2001;105:265–274. [Google Scholar]
  45. Lumbsch HT, Schmitt I, Barker D, Pagel M. Evolution of micromorphological and chemical characters in the lichen-forming fungal family Pertusariaceae. Biol. J. Linnean Soc. 2006;89:615–626. [Google Scholar]
  46. Lumbsch HT, Schmitt I, Lücking R, Wiklund E. The phylogenetic placement of Ostropales within Lecanoromycetes (Ascomycota) revisited. Mycol. Res. 2007a;111:257–267. doi: 10.1016/j.mycres.2007.01.006. [DOI] [PubMed] [Google Scholar]
  47. Lumbsch HT, Schmitt I, Mangold A, Wedin M. Ascus types are phylogenetically misleading in Trapeliaceae and Agyriaceae (Ostropomycetidae, Ascomycota) Mycol. Res. 2007b;111:1133–1141. doi: 10.1016/j.mycres.2007.06.016. [DOI] [PubMed] [Google Scholar]
  48. Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B, Padamsee M, Hibbett D, James TY, Baloch E, Grube M, Reeb V, Hofstetter V, Schoch C, Arnold AE, Miadłikowska J, Spatafora J, Johnson D, Hambleton S, Crockett M, Shoemaker R, Sung GH, Lücking R, Lumbsch HT, O‘Donnell K, Binder M, Diederich P, Ertz D, Gueidan C, Hansen K, Harris RC, Hosaka K, Lim YW, Matheny B, Nishida H, Pfister D, Rogers J, Rossman A, Schmitt I, Sipman H, Stone J, Sugiyama J, Yahr R, Vilgalys R. Assembling the fungal tree of life: progress, classification, and evolution of subcellular traits. Am. J. Bot. 2004;91:1446–1480. doi: 10.3732/ajb.91.10.1446. [DOI] [PubMed] [Google Scholar]
  49. Lutzoni F, Pagel M, Reeb V. Major fungal lineages are derived from lichen symbiotic ancestors. Nature. 2001;411:937–940. doi: 10.1038/35082053. [DOI] [PubMed] [Google Scholar]
  50. Mangold A, Martin MP, Lücking R, Lumbsch HT. Molecular phylogeny suggests synonymy of Thelotremataceae within Graphidaceae (Ascomycota: Ostropales) Taxon. 2008;57:476–486. [Google Scholar]
  51. Merrill GK. New or otherwise interesting lichens from Vancouver Island and the Rocky Mountains. The Ottawa Naturalist. 1913;27:117–121. [Google Scholar]
  52. Miadłikowska J, Kauff F, Hofstetter V, Fraker E, Grube M, Hafellner J, Reeb V, Hodkinson BP, Kukwa M, Lücking R, Hestmark G, Otálora MG, Rauhut A, Büdel B, Scheidegger C, Timdal E, Stenroos S, Brodo IM, Perlmutter GB, Ertz D, Diederich P, Lendemer JC, May PF, Schoch C, Arnold AE, Gueidan C, Tripp E, Yahr R, Robertson C, Lutzoni F. New insights into classification and evolution of the Lecanoromycetes (Pezizomycotina, Ascomycota) from phylogenetic analyses of three ribosomal RNA- and two protein-coding genes. Mycologia. 2006;98:1088–1103. [PubMed] [Google Scholar]
  53. Mugambi GK, Huhndorf SM. Parallel evolution of hysterothecial ascomata in ascolocularous fungi (Ascomycota, Fungi) Syst. Biodivers. 2009;7:453–464. [Google Scholar]
  54. Navrotska IL. On new species of the Xylographa genus. Ukr. J. Bot. 1976;33:276–278. [In Ukrainian] [Google Scholar]
  55. Nilsson G. Lichenologiska bidrag. III. Botaniska Notiser. 1930;1930:344–359. [Google Scholar]
  56. Nylander W. Prodromus Lichenographiae Galliae et Algeriae. Actes Soc. Linn. Bordeaux. 1857;21(1):249–468. [Google Scholar]
  57. Nylander W. Énumération générale des lichens avec l’indication sommaire de leur distribution géographique. Mém. Soc. Sci. Nat. Cherbourg. 1858;5:85–146. [‘1857’] [Google Scholar]
  58. Pérez-Ortega S, Spribille T. Bellemerella ritae sp. nov. (Verrucariaceae), a new lichenicolous ascomycete from northwest North America. Nova Hedwigia. 2007;85:512–520. [Google Scholar]
  59. Persoon CH. Observationes mycologicae, s. descriptiones tam novorum tam notabiliorum fungorum. Lipsiae: 1796. [Google Scholar]
  60. Posada D. jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 2008;25:1253–1256. doi: 10.1093/molbev/msn083. [DOI] [PubMed] [Google Scholar]
  61. Poulsen RS, Schmitt I, Søchting U, Lumbsch HT. Molecular and morphological studies on the subantarctic genus Orceolina (Agyriaceae) Lichenologist. 2001;33:323–329. [Google Scholar]
  62. Prieto M, Wedin M. Dating the diversification of the major lineages of Ascomycota. PLoS ONE. 2013;8(6):e65576. doi: 10.1371/journal.pone.0065576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Räsänen V. Die Flechtenflora der nördlichen Küstengegend am Laatokka-See. Ann. Bot. Soc. Zool.-Bot. Fenn. Vanamo. 1939;12(1):1–240. [Google Scholar]
  64. Redinger K. Familie Graphidaceae. Rabenhorsts Kryptogamenflora. 1938;9(2/1):181–404. [Google Scholar]
  65. Rivas Plata E, Lumbsch HT. Parallel evolution and phenotypic disparity in lichenized fungi: a case study in the lichen-forming fungal family Graphidaceae (Ascomycota: Lecanoromycetes: Ostropales) Mol. Phyl. Evol. 2011;61:45–63. doi: 10.1016/j.ympev.2011.04.025. [DOI] [PubMed] [Google Scholar]
  66. Rivas Plata E, Parnmen S, Staiger B, Mangold A, Frisch A, Weerakoon G, Hernández M,JE, Cáceres MES, Kalb K, Sipman HJM, Common RS, Nelsen MP, Lücking R, Lumbsch HT. A molecular phylogeny of Graphidaceae (Ascomycota, Lecanoromycetes, Ostropales) including 428 species. MycoKeys. 2013;6:55–94. [Google Scholar]
  67. Ryan BD. Xylographa. In: Nash TH III, Ryan BD, Diederich P, Gries C, Bungartz F, editors. Lichen flora of the Greater Sonoran Desert Region. Volume 2. Lichens Unlimited; Tempe, AZ. USA: 2004a. pp. 612–616. [Google Scholar]
  68. Ryan BD. Lignoscripta. In: Nash TH III, Ryan BD, Diederich P, Gries C, Bungartz F, editors. Lichen flora of the Greater Sonoran Desert Region. Volume 2. Lichens Unlimited; Tempe, AZ. USA: 2004b. pp. 350–351. [Google Scholar]
  69. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  70. Santesson R. The lichens and lichenicolous fungi of Sweden and Norway. SBT-förlaget; Lund: 1993. [Google Scholar]
  71. Santesson R, Moberg R, Nordin A, Tønsberg T, Vitikainen O. Lichen-forming and lichenicolous fungi of Fennoscandia. Museum of Evolution; Uppsala: 2004. [Google Scholar]
  72. Schmitt I, Lumbsch HT. Molecular phylogeny of the Pertusariaceae supports secondary chemistry as an important systematic character set in lichen-forming ascomycetes. Mol. Phyl. Evol. 2004;33:43–55. doi: 10.1016/j.ympev.2004.04.014. [DOI] [PubMed] [Google Scholar]
  73. Schmitt I, Lumbsch HT, Søchting U. Phylogeny of the lichen genus Placopsis and its allies based on Bayesian analyses of nuclear and mitochondrial sequences. Mycologia. 2003a;95:827–835. [PubMed] [Google Scholar]
  74. Schmitt I, Martin MP, Türk R, Lumbsch HT. Phylogenetic position of the genera Melanaria, Varicellaria and Thamnochrolechia (Pertusariales) Bibliotheca Lichenologica. 2003b;86:147–154. [Google Scholar]
  75. Schmitt I, Yamamoto Y, Lumbsch HT. Phylogeny of Pertusariales (Ascomycotina): resurrection of Ochrolechiaceae and new circumscription of Megasporaceae. J. Hattori Bot. Lab. 2006;100:753–764. [Google Scholar]
  76. Schoch CL, Kohlmeyer J, Volkmann-Kohlmeyer B, Tsui CK, Spatafora JW. The halotolerant fungus Glomerobolus gelineus is a member of Ostropales. Mycol. Res. 2006;110:257–263. doi: 10.1016/j.mycres.2005.10.001. [DOI] [PubMed] [Google Scholar]
  77. Schoch CL, Sung GH, Lopez-Giraldez F, Townsend JP, Miadlikowska J, Hofstetter V, Robbertse B, Matheny PB, Kauff F, Wang Z, Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker E, Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, de Hoog GS, Crous PW, Hewitt D, Pfister DH, Peterson K, Gryzenhout M, Wingfield MJ, Aptroot A, Suh SO, Blackwell M, Hillis DM, Griffith GW, Castlebury LA, Rossman AY, Lumbsch HT, Lücking R, Büdel B, Rauhut A, Diederich P, Ertz D, Geiser DM, Hosaka K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer B, Mostert L, ODonnell K, Sipman H, Rogers JD, Shoemaker RA, Sugiyama J, Summerbell RC, Untereiner W, Johnston PR, Stenroos S, Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen K, Trappe JM, Yahr R, Lutzoni F, Spatafora JW. The Ascomycota Tree of Life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst. Biol. 2009;58:224–239. doi: 10.1093/sysbio/syp020. [DOI] [PubMed] [Google Scholar]
  78. Sherwood MA. The Ostropalean fungi. Mycotaxon. 1977;5:1–277. [Google Scholar]
  79. Silvestro D, Michalak I. raxmlGUI: a graphical front-end for RAxML. Org. Divers. Evol. 2011;12:335–337. [Google Scholar]
  80. Spribille T, Björk CR. New records and range extensions in the North American lignicolous lichen flora. Mycotaxon. 2008;105:455–468. [Google Scholar]
  81. Spribille T, Thor G, Bunnell FL, Goward T, Björk CR. Lichens on dead wood: species-substrate relationships in the epiphytic lichen floras of the Pacific Northwest and Fennoscandia. Ecography. 2008;31:741–750. [Google Scholar]
  82. Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22:2688–2690. doi: 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
  83. Stenroos S, Laukka T, Huhtinen S, Döbbeler P, Myllys L, Syrjanen K, Hyvönen J. Multiple origins of symbioses between ascomycetes and bryophytes suggested by a five-gene phylogeny. Cladistics. 2010;26:281–300. doi: 10.1111/j.1096-0031.2009.00284.x. [DOI] [PubMed] [Google Scholar]
  84. Stirton J. New British lichens. Grevillea. 1874;3:33–37. [Google Scholar]
  85. Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Tønsberg T. The sorediate and isidiate, corticolous, crustose lichens in Norway. Sommerfeltia. 1992;14:1–331. [Google Scholar]
  87. Tuckerman E. A synopsis of North American lichens. Part II., comprising the Lecideacei, and (in part) the Graphidaceae. E. Anthony and Sons; New Bedford: 1888. [Google Scholar]
  88. Vainio EA. Adjumenta ad lichenographiam Lapponiae fennicae atque Fenniae borealis. Medde-land. Soc. Fauna Fl. Fenn. 1883;10:1–230. [Google Scholar]
  89. Vainio EA. Lichenes in viciniis stationis hibernae expeditionis Vegae prope pagum Pitlekai in Sibiria septentrionali a Dre. E. Almquist collecti. Praefationem scripsit F. Almquist. Ark. Bot. 1909;8(4):11–175. [Google Scholar]
  90. Vainio EA. Lichenes novi in Fennia a V. Räsänen collecti. Meddeland. Soc. Fauna Fl. Fenn. 1921;47:50–51. [Google Scholar]
  91. Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990;172:4238–4246. doi: 10.1128/jb.172.8.4238-4246.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Vobis G. Bau und Entwicklung der Flechten-Pycnidien und ihrer Conidien. Bibliotheca Lichenologica. 1980;14:1–141. [Google Scholar]
  93. Wedin M, Döring H, Gilenstam G. Saprotrophy and lichenization as options for the same fungal species on different substrata: environmental plasticity and fungal lifestyles in the Stictis-Conotrema complex. New Phytol. 2004;164:459–465. [Google Scholar]
  94. Wedin M, Wiklund E, Crewe A, Döring H, Ekman S, Nyberg A, Schmitt I, Lumbsch HT. Phylogenetic relationships of Lecanoromycetes (Ascomycota) as revealed by analyses of mtSSU and nLSU rDNA sequence data. Mycol. Res. 2005;109:159–172. doi: 10.1017/s0953756204002102. [DOI] [PubMed] [Google Scholar]
  95. White TJ, Bruns TD, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols, a guide to methods and applications. Academic Press; San Diego, CA, USA: 1990. pp. 315–322. [Google Scholar]
  96. Wirth V, Hauck M, Schultz M. Die Flechten Deutschlands. Band 2. Ulmer; Stuttgart: 2013. [Google Scholar]
  97. Zahlbruckner A. Catalogus Lichenum Universalis. Band II. Gebrüder Borntraeger; Leipzig: 1922–1924. [Google Scholar]
  98. Zahlbruckner A. Catalogus Lichenum Universalis. Band VIII. Gebrüder Borntraeger; Leipzig: 1931-1932. [Google Scholar]
  99. Zhou S, Stanosz GR. Primers for amplification of mt SSU rDNA, and a phylogenetic study of Botryosphaeria and associated anamorphic fungi. Mycol. Res. 2001;105:1033–1044. [Google Scholar]
  100. Zoller S, Scheidegger C, Sperisen C. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist. 1999;31:511–516. [Google Scholar]

RESOURCES