Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jan 1.
Published in final edited form as: Genesis. 2015 Dec 18;54(1):29–37. doi: 10.1002/dvg.22910

Generation of a KOR-Cre Knockin Mouse Strain to Study Cells Involved in Kappa Opioid Signaling

Xiaoyun Cai 1,#, Huizhen Huang 1,2,#, Marissa S Kuzirian 1, Lindsey M Snyder 1, Megumi Matsushita 3, Michael C Lee 1, Carolyn Ferguson 4, Gregg E Homanics 4, Alison L Barth 3, Sarah E Ross 1,**
PMCID: PMC4747253  NIHMSID: NIHMS739262  PMID: 26575788

Abstract

The kappa opioid receptor (KOR) has numerous important roles in the nervous system including the modulation of mood, reward, pain, and itch. In addition, KOR is expressed in many non-neuronal tissues. However, the specific cell types that express KOR are poorly characterized. Here, we report the development of a KOR-Cre knockin allele, which provides genetic access to cells that express KOR. In this mouse, Cre recombinase (Cre) replaces the initial coding sequence of the Opkr1 gene (encoding the kappa opioid receptor). We demonstrate that the KOR-Cre allele mediates recombination by embryonic day 14.5 (E14.5). Within the brain, KOR-Cre shows expression in numerous areas including the cerebral cortex, nucleus accumbens and striatum. In addition, this allele is expressed in epithelium and throughout many regions of the body including the heart, lung, and liver. Finally, we reveal that KOR-Cre mediates recombination of a subset of bipolar and amacrine cells in the retina. Thus, the KOR-Cre mouse line is a valuable new tool for conditional gene manipulation to enable the study of KOR.

Keywords: genetics, opioid, OPRK1, KOPr, Cre-loxP system

INTRODUCTION

The kappa opioid receptor (KOR; also known as KOPr, Oprk1) and its endogenous ligand dynorphin are a modulatory system with numerous roles in the nervous system, including the regulation of mood, reward, aversive somatosensation, and cognitive function (Butelman et al., 2012; Cahill et al., 2014; Lalanne et al., 2014; Crowley and Kash, 2015). Like other members of the opioid subfamily, KOR is a seven transmembrane receptor that couples to the inhibitory G-protein, Gαi/o. As a result, KOR signaling generally inhibits cell activity by decreasing cyclic AMP, reducing calcium currents, modulating kinase pathways, and/or increasing potassium conductance (Piros et al., 1996; Bruchas and Chavkin, 2010). In neurons, this signaling results in decreased cell firing and reduced neurotransmitter release. There is now good evidence that modulating the dynorphin/KOR system has clear therapeutic potential. In particular, kappa agonists have therapeutic efficacy for the treatment of itch and pain (Inui, 2015), whereas kappa antagonists are currently being investigated for their role in the treatment of addiction and relapse (Carroll and Carlezon, 2013). In addition, the plant derivative Salvinorin A, a recreational drug that causes spatiotemporal dislocation, mediates its effects via activation of KOR (Roth et al., 2002; Chavkin et al., 2004). Thus, KOR signaling is pertinent to many aspects of human health. However, the cellular targets and circuit-based mechanisms underlying the effects of kappa opioids are poorly understood. This gap in our understanding highlights the need for the development of new tools to visualize and manipulate KOR-expressing cells.

Previous work from our lab and others’ has shown that one of the key roles of kappa agonists is the inhibition of itch (Togashi et al., 2002; Inan et al., 2009; Kardon et al., 2014). In particular, we characterized a population of dynorphin-expressing inhibitory interneurons in the dorsal horn of the spinal cord, and provided evidence that these cells function to inhibit itch in part through the release of dynorphin (Ross et al., 2010; Kardon et al., 2014). Moreover, we found that modulation of KOR signaling in the spinal cord bidirectionally alters itch tone—kappa agonists reduce itch, whereas antagonists exacerbate itch. Finally, we provided evidence that kappa agonists can selectively reduce itch and not pain (Kardon et al., 2014). Both spinal interneurons and primary afferents (which innervate the spinal cord) are known to express KOR (Arvidsson et al., 1995). However, the specific interneurons and afferent subtypes that express this receptor are unknown. As a result, the cellular target through which dynorphin inhibits itch remained unclear. To begin addressing this question, we pursued a genetic approach — the generation of a KOR-Cre allele — with the hope of labeling KOR-expressing cells in mice.

In addition to the inhibition of itch, KOR signaling has numerous other roles that have been studied in detail. For instance, dynorphin promotes stress-induced anxiety and dysphoria, and blocking KORs with antagonists can reduce these stress-induced emotional responses (Land et al., 2008; Chavkin, 2011). Also, KORs in the ventral tegmental area (VTA) regulate locomotion, as inhibition of KORs in the VTA decreases locomotion (Vardy et al., 2015). Kappa agonists act on the pituitary to trigger the release of prolactin. KOR signaling is also important in the periphery, and KOR is expressed in the heart, vasculature, and gut (Zhu et al., 1998; Pugsley, 2002; Yamamizu et al., 2015). KOR and dynorphin null mice have an increase in vascular formation during embryogenesis (Yamamizu et al., 2015).

Given the diverse nature of KOR functions, we thought that tools to study KOR function would be of broad interest. Thus, we developed a KOR-Cre knockin mouse with the goal of visualizing and manipulating cells that express KOR. Here, we describe the generation of this mouse line and we characterize the Cre-mediated recombination that is observed when this mouse is crossed with a Cre-responsive reporter, which is predicted to mark all of the cells with current or a history of KOR expression.

RESULTS AND DISCUSSION

To gain genetic access to cells that express (or have expressed) KOR, we targeted Cre recombinase into the endogenous KOR locus (Oprk1). Cre is a recombinase that enables conditional expression of reporter or effector alleles using the Cre/loxP system. To target the KOR locus, fusion PCR was used to replace the coding region of the OPRK1 gene in exon 2 with that of Cre Recombinase followed by a strong polyadenylation sequence. The targeting vector PL450-nCrepA (Taniguchi et al., 2011), featured a FRT-flanked PGK-neomycin positive selection cassette (Neo) downstream to the 3’UTR (Figure 1A). Linearized targeting vectors were electroporated into Sv129 mouse ES cells and G418-resistant clones were screened for homologous recombination at the KOR locus by PCR (Figure 1B). The neomycin cassette was removed in vivo via Flp recombinase. Finally, Southern blotting was performed to confirm correct targeting into the genome (Figure 1C). KOR-Cre heterozygous mice gave rise to offspring of the expected ratio, as confirmed by genotyping PCR (Figure 1D).

Figure 1. Generation of a KOR-Cre knockin mouse.

Figure 1

Open in a new tab

A. Targeting of Oprk1. The KOR-Cre KI targeting vector was constructed by subcloning ~1.6 kb 5’ of exon 2 translation initiation ATG and ~5.2 kb 3’ of exon 2 into the PL450-nCrepA vector (Taniguchi et al., 2011), containing the Cre recombinase gene and a FRT-flanked neomycin (neo) cassette. Open reading frames are indicated with arrows and dark shaded regions within rectangles for Oprk1 (blue) and Cre (green). FRT sites are indicated with black triangles. PCR products are marked with black bars. Forward (For) and Reverse (Rev) primers used for genotyping are marked by red boxes, as indicated, either side of the PCR product. S: SpeI restriction site; X: XcmI restriction site; Neo: neomycin positive selection cassette. B-C. PCR-based screening for homologous recombination at the 5’ (B) and 3’ arms (C). PCR products or appropriate size are observed upon screening clone 25. D-E. Southern blot analysis of XcmI-digested (D) or SpeI-digested (E) genomic DNA from mice that are wild type (+/+), heterozygous (KOR-Cre/+) or KOR-Cre mutant (KOR-Cre/KOR-Cre) using the 5’ or 3’ probes, respectively, results in fragments of the predicted sizes, indicating correct targeting. F. PCR to amplify the junction between the 5’ or 3’ UTR and the coding region of either the Oprk1 gene or the KOR-Cre KI gene. Genotyping PCR products of genomic DNA isolated from tails of mice that are wild type (+/+), heterozygous (KOR-Cre/+), or mutants (KOR-Cre/KOR-Cre).

To analyze the pattern of recombination in KOR-Cre mice, we used the Cre-dependent allele Rosalsl tdTomato (also known as Ai14; Jax Labs). Since KOR mRNA is known to be expressed in the brain at embryonic day 14 (E14) (Zhu et al., 1998), we began our analysis at of Cre-mediated recombination at E14.5. At this time there is recombination in many regions of the embryo (Figure 2A). We also analyzed several regions at higher magnification, where we observed recombination in subsets of cells including the liver (Figure 2B, 2C), dorsal root ganglia (DRG; Figure 2D), heart (Figure 2E), lung (Figure 2F), epithelium of the branchial arches (Figure 2G), and eye (Figure 2H). We find that the tdTomato signal is specific since it is not observed in a control littermate that lacks the KOR-Cre allele (liver; Figure 2C). Previously, we reported that kappa opioid signaling in the spinal cord inhibits itch. We find that KOR-cre causes recombination in ~30% of spinal neurons in the dorsal horn (data not shown) as well as ~25-30% of primary somatosensory neurons in developing (Figure 2D) and adult (data not shown) mice. Which, if any, of these cells is responsible for the inhibition of itch by kappa agonists is unknown.

Figure 2. KOR-Cre mediated recombination in the mouse embryo at E14.5.

Figure 2

Open in a new tab

A. Sagittal section of a KOR-Cre; Rosalsl tdTomato mouse at E14.5 (tiled 20× images; scale bar = 1 mm). Regions in boxes are shown at higher magnification in B-H. B-C.

Magnification of tdTomato expression in liver of KOR-Cre; Rosalsl tdTomato (B) compared to the same region in a control littermate lacking KOR-cre (C). D-H. TdTomato expression in dorsal root ganglia (D), heart (E), lung (F), epithelium of the branchial arches (G), and eye (H). All images were acquired with a 20× objective with a confocal microscope. For B-H, scale bar = 100 μm.

To better visualize KOR-Cre mediated recombination in the nervous system, we took serial sections of the brain of a KOR-Cre; Rosalsl tdTomato mouse in the coronal plane. Some representative sections are shown (Figure 3) and the entire set is available in the supplementary data. We observe very robust recombination in both the caudate putamen and the nucleus accumbens (Figure 3A). Higher magnification of the caudate putamen suggests that KOR is expressed in many, but not all cells in this region. KOR-Cre causes recombination in a layer and region specific manner in neocortex (Figure 3). For instance, in the somatosensory cortex, tdTomato is observed in layers 4 and 6 (Figure 3B, Bi (somatosensory cortex 20×)) in neurons that have apical dendrites characteristic of pyramidal neurons (Figure 3Bii; somatosensory cortex 60×). KOR-cre also causes recombination in the insular cortex (Figure 3B; asterisk), consistent with previous reports. The role of KOR signaling in the neocortex is not well understood, but these receptors may underlie the altered perception of space and time that is induced by Salvinorin A (Roth et al., 2002; Chavkin, 2011). Another region that shows pronounced expression of tdTomato is the substantia nigra (Figures 3C, Ci, Cii, and D), which is a brain structure in the midbrain that plays important roles in both reward and movement (Isomura et al., 2013). Here, tdTomato is expressed in the pars reticulata of the substantia nigra, which serves as an output from the basal ganglia (Isomura et al., 2013). Interestingly, KOR-Cre mediated recombination is the substantia nigra is observed in axon tracts that are likely from cell bodies in the basal ganglia (Figures 3Ci and Cii).

Figure 3. KOR-cre mediated recombination in the adult mouse brain.

Figure 3

Open in a new tab

Coronal sections through the brain, moving anterior (A) to posterior (D) in an adult KOR-Cre; Rosalsl tdTomato mouse. Scale bar = 1 mm. * marks insular cortex. Ai. 60× confocal image of the region highlighted in A by the dashed box, visualizing cells in the nucleus accumbens. Scale bar = 50 μm. Bi. 20× confocal image from the region highlighted, in B, by the dashed box, showing tdTomato expression in the somatosensory cortex. Scale bar = 100 μm. Bii. Further magnification (60×) of the region in Bi showing tdTomato expression in pyramidal neurons. Scale bar = 50 μm. Ci. 20× confocal image of the substantia nigra as seen in C. Scale bar = 100 μm. Cii. KOR-cre-positive fibers in the substantia nigra (60×; scale bar = 50 μm). Sections through the entire mouse brain are available in the Supporting Information.

In general, we observe KOR-cre mediated recombination in brain regions that previously have been reported to express KOR. Thus, we find tdTomato expression in the anterior olfactory nucleus, olfactory tubercle including the islands of Calleja, caudate putamen, the lateral septum, the thalamus, the claustrum, the hypothalamus, the amygdala, nucleus accumbens, superior colliculus, substantia nigra, central gray, the ventral tegmental area, the brainstem including the raphe, the dorsal cochlear nucleus, and the trigeminal nucleus (Figure 3 and Supplemental Information). These findings are consistent with previous reports describing the distribution of KOR mRNA and protein (Mansour et al., 1994; Arvidsson et al., 1995; Zhu et al., 1998). However, it should be noted that we see a somewhat broader distribution of KOR-cre mediated recombination than one would expect based on the mRNA transcript expression seen in an adult mouse. For instance, whereas KOR mRNA was reported in a limited number of cortical areas (Mansour et al., 1994), we find KOR-cre mediated recombination in many regions of the cortex, including the anterior cingulate, motor, somatosensory, visual and insular cortices. Whether this discrepancy reflects the recombination of cells with very low levels of KOR expression or cells with a developmental history of KOR expression remains unknown.

Opioids also play an important role outside of the nervous system. Previous work suggests that KOR acts to inhibit the growth of ventricular myocytes and the heart during development (Wang et al., 2004). Consistent with this, we observed that KOR-Cre mediates recombination in the neonatal heart (Figure 4A). In adult animals, KOR regulates arrhythmias and protects against severe ischemia (Wu et al., 1999; Schultz and Gross, 2001). Our knowledge of KOR expression in the heart is based primarily on studies using agonist-binding assays, which reveal strong KOR expression in the right atrium (Krumins et al., 1985; Tai et al., 1991; Zhang et al., 1996; Pugsley, 2002). Here, we show that the KOR-Cre allele causes recombination in subsets of cells throughout the heart. In both neonatal (P1) and adult mice, the Cre is expressed the myocardium and endocardium of both the right and left ventricle (Figure 4). Cre is also expressed in the atrioventricular valve (Figure 4 Ciii).

Figure 4. KOR-cre mediated recombination in the heart.

Figure 4

Open in a new tab

A. KOR-cre mediated recombination in the heart at post-natal day 1 (P1; KOR-Cre; Rosalsl tdTomato). Ai. Magnification of the wall of the right ventricle (20×). TdTomato is expressed in the myocardium and endocardium. B. TdTomato is expressed in the heart wall of the adult KOR-Cre; Rosalsl tdTomato mouse. Bi. Magnified view of the wall of the left ventricle in B (20×). C. TdTomato is expressed in the wall of atrium in adult mouse. Ci, Cii. Magnified view of right atrium wall and Ciii. Atrioventricular valve from C (20×). Scale bar = 50 μm in all images.

Kappa agonists are known to be diuretics. Some of this effect is likely mediated via inhibition of vasopressin release (Floyd et al., 2009). However, bilateral adrenal demedullation significantly attenuates the diuretic response to KOR agonists (Blackburn et al., 1986; Ashton et al., 1989; Borkowski, 1989), raising the possibility that kappa agonists act, at least in part, on cells in the adrenal medulla. Autoradiography binding assays (Quirion et al., 1983) as well as RT-PCR and Northern analysis (Wittert et al., 1996) suggest KOR expression in the kidney and adrenal gland. Consistent with this, we see KOR-Cre mediated recombination in the kidney as well as adrenal glands, both in the cortex and medulla (Figure 5A, B).

Figure 5. KOR-cre mediated recombination in the adrenal gland and kidney.

Figure 5

Open in a new tab

A. KOR-cre mediated recombination in adrenal gland and kidney (P1; KOR-Cre; Rosalsl tdTomato). Ai. Magnified view of adrenal gland and cortex of the kidney from A (20×). tdTomato expression was found mainly in the cortex of adrenal gland (ctx) and the kidney (kid). B-C. TdTomato expression in adrenal gland (B, Bi) and cortex of the kidney (C, Ci) in the adult KOR-Cre; Rosalsl tdTomato mouse. TdTomato expression was primarily found mainly in cortex of adrenal gland (ctx) and the cortex of the kidney. Note the clusters of small cells in the medulla (med). Scale bar = 50 μm.

Previous work suggested that KOR is expressed in the retina (Husain et al., 2009), but the specific cell types were unknown. To address this question, we analyzed the expression of a ChR2-eYFP fusion reporter (Rosalsl ChR2-eYFP; also known as Ai32; Jax lab) upon KOR-Cre mediated recombination. Because eYFP is fused to channel rhodopsin, this protein is localized to the membrane, enabling a clear view of the neuronal processes. We find that KOR-Cre causes recombination in several retinal cell types, giving rise to two prominent bands of innervation in the inner plexiform layer (Figure 6A). To identify which sublaminae are stratified by KOR-Cre expressing cells, we co-staining with the layer-specific marker, ChAT. This analysis revealed that KOR-Cre-recombined cells target predominantly layers 1 and 5 of the IPL (Figure 3B). Based on their location within the inner plexiform layer, KOR-Cre appears to cause recombination of both bipolar cells and amacrine cells. To investigate this idea further, we co-stained with the amacrine cell marker, Pax6. These co-labeling experiments revealed that numerous KOR-Cre recombined cells are Pax6-positive, indicating they are amacrine cells (34% of amacrine cells show KOR-cre mediated recombination; Figures 6C-6E). Thus, it is likely that Cre expressing cells in the retinal ganglion layer are displaced amacrine cells, rather than retinal ganglion cells. Together these findings indicate that KOR-Cre causes recombination in at least two retinal subtypes: bipolar cells and amacrine cells, which primarily stratify in layers 1 and 5 of the inner plexiform layer.

Figure 6. KOR-cre mediated recombination in the retina.

Figure 6

Open in a new tab

A. KOR-Cre causes recombination in many cells in the retina, as observed by expression of the ChR2-eYFP reporter, which is membrane localized (transverse sections; KOR-Cre;Rosalsl ChR2-eYFP; scale bar = 100 μm). B. Left, cartoon stratification of retina based on ChAT immunostaining. Right, ChAT expression (red) and ChR2-eYFP expression (green) in the inner plexiform layer (IPL). C. KOR-Cre causes recombination in bipolar cells in the inner nuclear layer (INL) and in amacrine cells the ganglion cell layer (GCL). C-E. Transverse sections of mouse retina showing ChR2-eYFP (C) Pax6 (D) or Merge (E). Examples of KOR-cre recombined amacrine cells are marked by the arrowheads. B, C, scale bar = 10 μm.

In summary, we show that the KOR-cre knockin mouse line causes recombination in a number of cell types throughout the body, including many brain regions that have been reported to express KOR (Mansour et al., 1994). Thus, this allele may be useful for conditional manipulation of cells that mediate KOR signaling.

MATERIALS AND METHODS

Animal Husbandry

KOR-Cre mice were generated as described below and genotyped using the following primers: F: GGTGAATCCAAGCAAGATAAACGG; R: CAGCACAGGTAGGTCAGCTC. Mice were given free access to food and water and housed under standard laboratory conditions. The use of animals was approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh.

Generation of KOR-Cre knockin mouse

The targeting vector was constructed from 129s6/SvEvTAC mouse genomic fragments, which were amplified by PCR and sequenced. The 5’ and 3’ homologous arms were PCR amplified from genomic DNA using the following primers: 5’ arm (F: TAAAAGACCCGTCCCTTGTG and R: GTTCACGATGTCGAAGCTCA) and the 3’ arm (F: GGGGAACTTCCTGACTAGGG and R: CTTGTGAAGCCTGCAAAACA). To replace the coding region of the OPRK1 gene in exon 2 with that of Cre Recombinase followed by a strong polyadenylation sequence. This manipulation was confirmed by restriction digest and sequencing. These arms, along with the fusion product, were subcloned into the targeting vector (PL450-nCrepA) (Taniguchi et al., 2011). The targeting construct was sequenced in its entirety prior to its use in gene targeting. Linearized targeting vectors were electroporated into Sv129 (J1) mouse ES cells (Li et al., 1992) and G418-resistant clones were screened for homologous recombination at the KOR locus by PCR. Confirmed ES cells were injected into C57BL/6 blastocysts and implanted into pseudopregnant females to generate chimeric offspring. Mice homozygous for the KOR-cre allele are viable. Mice were bred for at least three generations onto a C57BL/6 background. Mice are available upon request.

Genotyping PCR

For routine genotyping, the primers were as follows: Forward Primer (common): CTAGTGCTTCTTGGGGTTGC; WT reverse primer: AAGCACTGGGAGAGCAGGTA, KOR-cre reverse primer: CATGTTTAGCTGGCCCAAAT. These primers give PCR products of 403 bp for the WT allele and 648 bp for the KOR-cre knockin allele.

Immunohistochemistry

For immunohistochemistry, heterozygous mice were fixed with 4% paraformaldehyde in PBS by intracardial perfusion. Tissues were post-fixed for 1h to overnight at 4°C. E14.5 mice were dated with E0.5 at time of plug detection. Embryos were drop fixed in 4% paraformaldehyde immediately after dissection. After post-fix, all tissue was washed extensively with PBS, cryopreserved in 30% sucrose in PBS overnight, embedded in OTC (Sakura Finetek, Torrance, CA), and frozen. Sections were cut at 20 μm on a cryostat and placed on slides. For immunostaining, sections were blocked in 10% goat serum and 0.25% triton-X in PBS for 1 h at RT. Sections were incubated with primary antibodies in block overnight at 4°C. Slides were washed 4 × 5 min in PBS containing 0.1% triton-X. Detection of antibodies was carried out using Alexa-fluor secondary antibodies (Life Technologies) diluted 1: 500 in blocking solution. Sections were washed, as above, and coverslipped. The following primary antibodies used were: rabbit anti-GFP (1:1,000, Life Technologies), goat anti-ChAT (1:500, Millipore), mouse anti-PAX6 (1:200, Developmental Studies Hybridoma Bank). Secondary antibodies: Alexa Fluor-488 donkey anti-rabbit (1:500, Life Technologies), Alexa Fluor-555 donkey anti-goat (1:500, Life Technologies), Alexa-Fluor-555 donkey anti-mouse (1:500, Life Technologies).

Imaging

All sections were imaged with either a Nikon A1R confocal microscope (Nikon, Tokyo Japan; 20× or 60× oil-immersion objective) or an Olympus BX53 florescence microscope (Olympus, Tokyo Japan, 4× or 10× objective).

Supplementary Material

Supp Info

ACKNOWLEDGEMENTS

This research was supported by NIH grants R01 AR063772 and R21 AR064445 to S.E.R and R37 AA10422 to G.E.H.. L.M.S. and M.S.K. are supported by a T32 NS 73548-3. Part of this work was supported by a grant from the Rita Allen Foundation to S.E.R., who is a Rita Allen Foundation Pain Scholar. The KOR-cre line was generated with help from the Mouse Gene Manipulation Facility of the Boston Children's Hospital Intellectual and Developmental Disabilities Research Center (IDDRC), which is supported by NIHP30-HD 18655.

LITERATURE CITED

  1. Arvidsson U, Riedl M, Chakrabarti S, Vulchanova L, Lee JH, Nakano AH, Lin X, Loh HH, Law PY, Wessendorf MW, et al. The kappa-opioid receptor is primarily postsynaptic: combined immunohistochemical localization of the receptor and endogenous opioids. Proceedings of the National Academy of Sciences of the United States of America. 1995;92:5062–5066. doi: 10.1073/pnas.92.11.5062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ashton N, Balment RJ, Blackburn TP. Kappa-opioid-induced changes in renal water and electrolyte management and endocrine secretion. British journal of pharmacology. 1989;97:769–776. doi: 10.1111/j.1476-5381.1989.tb12015.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blackburn TP, Borkowski KR, Friend J, Rance MJ. On the mechanisms of kappa-opioid-induced diuresis. British journal of pharmacology. 1986;89:593–598. doi: 10.1111/j.1476-5381.1986.tb11160.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borkowski KR. Studies on the adrenomedullary dependence of kappa-opioid agonist-induced diuresis in conscious rats. British journal of pharmacology. 1989;98:1151–1156. doi: 10.1111/j.1476-5381.1989.tb12659.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bruchas MR, Chavkin C. Kinase cascades and ligand-directed signaling at the kappa opioid receptor. Psychopharmacology. 2010;210:137–147. doi: 10.1007/s00213-010-1806-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Butelman ER, Yuferov V, Kreek MJ. kappa-opioid receptor/dynorphin system: genetic and pharmacotherapeutic implications for addiction. Trends in neurosciences. 2012;35:587–596. doi: 10.1016/j.tins.2012.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cahill CM, Taylor AM, Cook C, Ong E, Moron JA, Evans CJ. Does the kappa opioid receptor system contribute to pain aversion? Frontiers in pharmacology. 2014;5:253. doi: 10.3389/fphar.2014.00253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carroll FI, Carlezon WA., Jr. Development of kappa opioid receptor antagonists. Journal of medicinal chemistry. 2013;56:2178–2195. doi: 10.1021/jm301783x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chavkin C. The therapeutic potential of kappa-opioids for treatment of pain and addiction. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology. 2011;36:369–370. doi: 10.1038/npp.2010.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chavkin C, Sud S, Jin W, Stewart J, Zjawiony JK, Siebert DJ, Toth BA, Hufeisen SJ, Roth BL. Salvinorin A, an active component of the hallucinogenic sage salvia divinorum is a highly efficacious kappa-opioid receptor agonist: structural and functional considerations. The Journal of pharmacology and experimental therapeutics. 2004;308:1197–1203. doi: 10.1124/jpet.103.059394. [DOI] [PubMed] [Google Scholar]
  11. Crowley NA, Kash TL. Kappa opioid receptor signaling in the brain: Circuitry and implications for treatment. Progress in neuro-psychopharmacology & biological psychiatry. 2015;62:51–60. doi: 10.1016/j.pnpbp.2015.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Floyd BN, Camilleri M, Busciglio I, Sweetser S, Burton D, Wong GY, Kell S, Khanna S, Hwang S, Zinsmeister AR. Effect of a kappa-opioid agonist, i.v. JNJ-38488502, on sensation of colonic distensions in healthy male volunteers. Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society. 2009;21:281–290. doi: 10.1111/j.1365-2982.2008.01202.x. [DOI] [PubMed] [Google Scholar]
  13. Husain S, Potter DE, Crosson CE. Opioid receptor-activation: retina protected from ischemic injury. Investigative ophthalmology & visual science. 2009;50:3853–3859. doi: 10.1167/iovs.08-2907. [DOI] [PubMed] [Google Scholar]
  14. Inan S, Dun NJ, Cowan A. Nalfurafine prevents 5′-guanidinonaltrindole- and compound 48/80-induced spinal c-fos expression and attenuates 5′-guanidinonaltrindole-elicited scratching behavior in mice. Neuroscience. 2009;163:23–33. doi: 10.1016/j.neuroscience.2009.06.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Inui S. Nalfurafine hydrochloride to treat pruritus: a review. Clinical, cosmetic and investigational dermatology. 2015;8:249–255. doi: 10.2147/CCID.S55942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Isomura Y, Takekawa T, Harukuni R, Handa T, Aizawa H, Takada M, Fukai T. Reward-modulated motor information in identified striatum neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2013;33:10209–10220. doi: 10.1523/JNEUROSCI.0381-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kardon AP, Polgar E, Hachisuka J, Snyder LM, Cameron D, Savage S, Cai X, Karnup S, Fan CR, Hemenway GM, Bernard CS, Schwartz ES, Nagase H, Schwarzer C, Watanabe M, Furuta T, Kaneko T, Koerber HR, Todd AJ, Ross SE. Dynorphin acts as a neuromodulator to inhibit itch in the dorsal horn of the spinal cord. Neuron. 2014;82:573–586. doi: 10.1016/j.neuron.2014.02.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Krumins SA, Faden AI, Feuerstein G. Opiate binding in rat hearts: modulation of binding after hemorrhagic shock. Biochemical and biophysical research communications. 1985;127:120–128. doi: 10.1016/s0006-291x(85)80134-0. [DOI] [PubMed] [Google Scholar]
  19. Lalanne L, Ayranci G, Kieffer BL, Lutz PE. The kappa opioid receptor: from addiction to depression, and back. Frontiers in psychiatry. 2014;5:170. doi: 10.3389/fpsyt.2014.00170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Land BB, Bruchas MR, Lemos JC, Xu M, Melief EJ, Chavkin C. The dysphoric component of stress is encoded by activation of the dynorphin kappa-opioid system. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2008;28:407–414. doi: 10.1523/JNEUROSCI.4458-07.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell. 1992;69:915–926. doi: 10.1016/0092-8674(92)90611-f. [DOI] [PubMed] [Google Scholar]
  22. Mansour A, Fox CA, Burke S, Meng F, Thompson RC, Akil H, Watson SJ. Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study. The Journal of comparative neurology. 1994;350:412–438. doi: 10.1002/cne.903500307. [DOI] [PubMed] [Google Scholar]
  23. Piros ET, Hales TG, Evans CJ. Functional analysis of cloned opioid receptors in transfected cell lines. Neurochemical research. 1996;21:1277–1285. doi: 10.1007/BF02532368. [DOI] [PubMed] [Google Scholar]
  24. Pugsley MK. The diverse molecular mechanisms responsible for the actions of opioids on the cardiovascular system. Pharmacology & therapeutics. 2002;93:51–75. doi: 10.1016/s0163-7258(02)00165-1. [DOI] [PubMed] [Google Scholar]
  25. Quirion R, Finkel MS, Mendelsohn FA, Zamir N. Localization of opiate binding sites in kidney and adrenal gland of the rat. Life sciences. 1983;33(Suppl 1):299–302. doi: 10.1016/0024-3205(83)90502-7. [DOI] [PubMed] [Google Scholar]
  26. Ross SE, Mardinly AR, McCord AE, Zurawski J, Cohen S, Jung C, Hu L, Mok SI, Shah A, Savner EM, Tolias C, Corfas R, Chen S, Inquimbert P, Xu Y, McInnes RR, Rice FL, Corfas G, Ma Q, Woolf CJ, Greenberg ME. Loss of inhibitory interneurons in the dorsal spinal cord and elevated itch in Bhlhb5 mutant mice. Neuron. 2010;65:886–898. doi: 10.1016/j.neuron.2010.02.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Roth BL, Baner K, Westkaemper R, Siebert D, Rice KC, Steinberg S, Ernsberger P, Rothman RB. Salvinorin A: a potent naturally occurring nonnitrogenous kappa opioid selective agonist. Proceedings of the National Academy of Sciences of the United States of America. 2002;99:11934–11939. doi: 10.1073/pnas.182234399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Schultz JE, Gross GJ. Opioids and cardioprotection. Pharmacology & therapeutics. 2001;89:123–137. doi: 10.1016/s0163-7258(00)00106-6. [DOI] [PubMed] [Google Scholar]
  29. Tai KK, Jin WQ, Chan TK, Wong TM. Characterization of [3H]U69593 binding sites in the rat heart by receptor binding assays. Journal of molecular and cellular cardiology. 1991;23:1297–1302. doi: 10.1016/0022-2828(91)90086-2. [DOI] [PubMed] [Google Scholar]
  30. Taniguchi H, He M, Wu P, Kim S, Paik R, Sugino K, Kvitsiani D, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB, Huang ZJ. A resource of Cre driver lines for genetic targeting of GABAergic neurons in cerebral cortex. Neuron. 2011;71:995–1013. doi: 10.1016/j.neuron.2011.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Togashi Y, Umeuchi H, Okano K, Ando N, Yoshizawa Y, Honda T, Kawamura K, Endoh T, Utsumi J, Kamei J, Tanaka T, Nagase H. Antipruritic activity of the kappa-opioid receptor agonist, TRK-820. European journal of pharmacology. 2002;435:259–264. doi: 10.1016/s0014-2999(01)01588-6. [DOI] [PubMed] [Google Scholar]
  32. Vardy E, Robinson JE, Li C, Olsen RH, DiBerto JF, Giguere PM, Sassano FM, Huang XP, Zhu H, Urban DJ, White KL, Rittiner JE, Crowley NA, Pleil KE, Mazzone CM, Mosier PD, Song J, Kash TL, Malanga CJ, Krashes MJ, Roth BL. A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron. 2015;86:936–946. doi: 10.1016/j.neuron.2015.03.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang G, Wang H, Yang Y, Wong TM. Kappa-opioid receptor stimulation inhibits growth of neonatal rat ventricular myocytes. European journal of pharmacology. 2004;498:53–58. doi: 10.1016/j.ejphar.2004.07.082. [DOI] [PubMed] [Google Scholar]
  34. Wittert G, Hope P, Pyle D. Tissue distribution of opioid receptor gene expression in the rat. Biochemical and biophysical research communications. 1996;218:877–881. doi: 10.1006/bbrc.1996.0156. [DOI] [PubMed] [Google Scholar]
  35. Wu S, Li HY, Wong TM. Cardioprotection of preconditioning by metabolic inhibition in the rat ventricular myocyte. Involvement of kappa-opioid receptor. Circulation research. 1999;84:1388–1395. doi: 10.1161/01.res.84.12.1388. [DOI] [PubMed] [Google Scholar]
  36. Yamamizu K, Hamada Y, Narita M. kappa Opioid receptor ligands regulate angiogenesis in development and in tumours. British journal of pharmacology. 2015;172:268–276. doi: 10.1111/bph.12573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang WM, Jin WQ, Wong TM. Multiplicity of kappa opioid receptor binding in the rat cardiac sarcolemma. Journal of molecular and cellular cardiology. 1996;28:1547–1554. [PubMed] [Google Scholar]
  38. Zhu Y, Hsu MS, Pintar JE. Developmental expression of the mu, kappa, and delta opioid receptor mRNAs in mouse. The Journal of neuroscience : the official journal of the Society for Neuroscience. 1998;18:2538–2549. doi: 10.1523/JNEUROSCI.18-07-02538.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Info
NIHMS739262-supplement-Supp_Info.docx (47.4KB, docx)

RESOURCES