Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2016 Jan 13;113(5):1393–1398. doi: 10.1073/pnas.1515071113

The LMO2 oncogene regulates DNA replication in hematopoietic cells

Marie-Claude Sincennes a,b,1, Magali Humbert a,1, Benoît Grondin a, Véronique Lisi a,b, Diogo F T Veiga a, André Haman a, Christophe Cazaux c,2, Nazar Mashtalir d, EL Bachir Affar d, Alain Verreault a,b,e, Trang Hoang a,b,e,3
PMCID: PMC4747768  PMID: 26764384

Significance

Understanding how cell cycle and cell differentiation are coordinated during normal hematopoiesis will reveal molecular insights in leukemogenesis. LIM-only 2 (LMO2) is a transcriptional regulator that controls the erythroid lineage via activation of an erythroid-specific gene expression program. Here, we uncover an unexpected function for LMO2 in controlling DNA replication via protein–protein interactions with essential DNA replication enzymes. To our knowledge, this work provides the first evidence for a nontranscriptional function of LMO2 that drives the cell cycle at the expense of differentiation in the erythroid lineage and in thymocytes when misexpressed following genetic alterations. We propose that the nontranscriptional control of DNA replication uncovered here for LMO2 may be a more common function of oncogenic transcription factors than previously appreciated.

Keywords: LMO2, cell cycle, DNA replication, hematopoietic cells, T-cell acute lymphoblastic leukemia

Abstract

Oncogenic transcription factors are commonly activated in acute leukemias and subvert normal gene expression networks to reprogram hematopoietic progenitors into preleukemic stem cells, as exemplified by LIM-only 2 (LMO2) in T-cell acute lymphoblastic leukemia (T-ALL). Whether or not these oncoproteins interfere with other DNA-dependent processes is largely unexplored. Here, we show that LMO2 is recruited to DNA replication origins by interaction with three essential replication enzymes: DNA polymerase delta (POLD1), DNA primase (PRIM1), and minichromosome 6 (MCM6). Furthermore, tethering LMO2 to synthetic DNA sequences is sufficient to transform these sequences into origins of replication. We next addressed the importance of LMO2 in erythroid and thymocyte development, two lineages in which cell cycle and differentiation are tightly coordinated. Lowering LMO2 levels in erythroid progenitors delays G1-S progression and arrests erythropoietin-dependent cell growth while favoring terminal differentiation. Conversely, ectopic expression in thymocytes induces DNA replication and drives these cells into cell cycle, causing differentiation blockade. Our results define a novel role for LMO2 in directly promoting DNA synthesis and G1-S progression.


More than 70% of recurring chromosomal translocations in T-cell acute lymphoblastic leukemia (T-ALL) involve transcription factors that are master regulators of cell fate. These oncogenic transcription factors determine the gene signature and leukemic cell types (1). Whether these DNA-bound factors may have additional roles beyond modulating gene expression remains unknown. LMO2, a 17-kDa protein defined by tandem zinc finger domains, is an essential nucleation factor that assembles a multipartite transcriptional regulatory complex on gene regulatory regions via direct interaction with the TAL1/SCL transcription factor, LDB1, and other DNA binding transcription factors (2–4, reviewed in refs. 5, 6). These complexes drive gene expression programs that determine hematopoietic cell fates at critical branchpoints both during embryonic development (7) and in adult hematopoietic stem cells (8, 9). Lmo2 function is essential in highly proliferative erythroid progenitors (10, reviewed in refs. 5, 6). Interestingly, Lmo2 down-regulation is required for terminal erythroid differentiation (11, 12). Because commitment to terminal differentiation is coordinated with growth arrest (13), Lmo2 may have additional molecular functions that impede this critical step marked by growth cessation.

In mouse models of T-ALL, LMO1 or LMO2 collaborates with SCL to inhibit the activity of two basic helix–loop–helix (bHLH) transcription factors that control thymocyte differentiation, E2A/TCF3 and HEB/TCF12, causing differentiation arrest (reviewed in ref. 14). However, this inhibition is not sufficient, per se, for leukemogenesis, because both TAL1 and LYL1 inhibit E proteins but require interaction with LMO1/2 to activate the transcription of a self-renewal gene network in thymocytes (15, 16) and to induce T-ALL (17, 18). Of note, downstream target genes cannot substitute for LMO1/2 to induce T-ALL, suggesting additional functions for LMO1/2.

Together, these studies underscore the dominant oncogenic properties of LMO2, as revealed by recurring retroviral integrations upstream of LMO2 in the gene therapy trial (19, 20) or by recurrent chromosomal rearrangements in T-ALL (21). As a consequence, LMO2 is misexpressed in the T lineage, where it is normally absent. In addition, LMO proteins are frequently deregulated in breast cancers (22) and neuroblastomas (23), pointing to their importance in cell transformation. In particular, in patients who eventually developed T-ALL associated with LMO2 activation after gene therapy, T-cell hyperproliferation was observed early during the preleukemic stage (19). How LMO2 affects erythroid progenitor or T-cell proliferation cannot be inferred from its downstream target genes (12, 24–28).

To understand LMO2 functions, we performed an unbiased screen for LMO2 interaction partners. We show that LMO2 associates with three replication proteins, minichromosome 6 (MCM6), DNA primase (PRIM1), and DNA polymerase delta (POLD1), and that LMO2 influences cell cycle progression and DNA replication in hematopoietic cells, indicating an unexpected function for LMO2.

Results

Identification of New LMO2 Protein–Protein Interactions in Hematopoietic Progenitors.

Lmo2 is expressed in c-Kit+ hematopoietic stem and progenitor cells (HSPCs) and in immature prothymocytes, but not at later stages of T-cell differentiation (29). To identify new LMO2 binding proteins in HSPCs, we constructed a cDNA library from purified murine Kit+Lin− hematopoietic progenitors for a yeast two-hybrid screen and used LMO2 as bait. In addition to known LMO2-interacting proteins, such as LDB1, and to proteins associated with transcription, we unexpectedly identified interactions with three essential components of prereplication complexes (pre-RCs), namely, MCM6, POLD1, and PRIM1 (30) (Fig. 1A and Table S1). In comparison, a screen performed using GAL4-SCL identified only known interactions (Table S1). LMO2 interaction was specific to these three replication proteins, as confirmed by independent yeast two-hybrid assays with full-length cDNAs (Fig. 1 B and C). In addition, we identified BAZ1A/ACF1, required for DNA replication through heterochromatin (31); SetD8, for replication licensing (32); MYST2/HBO1, controlling MCM loading via ORC1 binding (33); and CCNA2-CDK1, regulating origin firing (34) (Fig. 1A). The top-ranking pathways by gene set enrichment analysis were cell cycle, DNA synthesis, and DNA replication (Fig. 1D), concurring with the view that LMO2 controls these processes via its protein partners. Finally, LMO2 coimmunoprecipitated with PRIM1, MCM6, and MYST2 in mammalian cells, and both LIM domains contributed to this interaction (Fig. 1E), whereas LDB1 binding required mostly LIM1, as expected (4). We conclude that in addition to its association with transcription regulators, LMO2 engages in protein–protein interactions with DNA replication proteins.

Fig. 1.

Fig. 1.

LMO2 interacts with DNA replication proteins. (A) New LMO2 protein–protein interactions in hematopoietic progenitors revealed by yeast two-hybrid screens using LMO2 as bait (*). (B and C) LMO2 specifically interacts with MCM6, PRIM1, and POLD1 by yeast two-hybrid assay. (D) Gene set enrichment analysis for LMO2 interaction partners. Shown are the top seven Reactome pathways significantly enriched in the LMO2 Y2H screen [false discovery rate (FDR): q < 0.001] according to the Molecular Signatures database v5.0 (PubMed identifier 16199517). (E) Both LIM domains of LMO2 are required for interaction with PRIM1, MCM6, and MYST2. GAL4-LMO2 WT or LIM1/2 mutants were cotransfected with Flag-tagged PRIM1, MCM6, or MYST2. Protein extracts were immunoprecipitated with anti-FLAG Ab, followed by Western blotting. (F) DNA replication proteins coimmunoprecipitate with LMO2 (**). Immunoprecipitation of TF-1 chromatin extracts with Abs against LMO2. Inputs (4%) and immune pellets (IP) were analyzed by IB. (G) SCL does not stably associate with DNA replication proteins. SCL or isotype control Abs were analyzed as in F (*). IB, immunoblotting; IP, immune pellet; SN, supernatant. Data shown are typical of at least two (*) or three (**) independent experiments.

Table S1.

List of proteins identified by yeast two-hybrid screening with Lmo2 or Tal1

Bait Target (official gene symbol) Aliases Identification Complete gene name GST or IP Nuclear
Lmo2 Bub1b Bubr1 NM_009773 Budding uninhibited by benzimidazoles 1 homolog, beta (Saccharomyces cerevisiae) + Yes
Lmo2 Mcm6 NM_008567 Minichromosome maintenance deficient 6 (MIS5 homolog, Schizosaccharomyces pombe) (S. cerevisiae) + Yes
Lmo2 Appl2 Dip3b NM_145220 Adaptor protein, phosphotyrosine interaction, PH domain and Leu zipper containing 2 + Yes
Lmo2 Flii Fliih NM_022009 Flightless I homolog (Drosophila) + Yes
Lmo2 Hipk2 Stank NM_010433 Homeodomain interacting protein kinase 2 + Yes
Lmo2 Kars LysRS NM_053092 Lysyl-tRNA synthetase + Yes
Lmo2 Kmt2b Mll2, Wbp7 NM_029274 Lys (K)-specific methyltransferase 2B + Yes
Lmo2 Ldb1 Nli, Clim2 NM_010697 LIM domain binding 1 + Yes
Lmo2 Lrch4 Sap25 NM_146164 Leu-rich repeats and calponin homology (CH) domain containing 4 + Yes
Lmo2 Nsun2 Misu NM_145354 NOL1/NOP2/Sun domain family member 2 + Yes
Lmo2 Pold1 NM_011131 Polymerase (DNA directed), delta 1, catalytic subunit + Yes
Lmo2 Prim1 NM_008921 DNA primase, p49 subunit + Yes
Lmo2 Psmc1 Rpt2 NM_008947 Protease (prosome, macropain) 26S subunit, ATPase 1 + Yes
Lmo2 Psme3 PA28 gamma, REG gamma, Ki NM_011192 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) + Yes
Lmo2 Taf6l Paf65a NM_146092 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor + Yes
Lmo2 Ndufa8 NM_026703 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 8 + No
Lmo2 Kat7 Myst2, Hbo1 NM_177619 K(Lys) acetyltransferase 7 − Yes
Lmo2 Rai1 Gt1 NM_009021 Retinoic acid induced 1 − Yes
Lmo2 Setd8 PR-SET7 NM_030241 SET domain containing (Lys methyltransferase) 8 − Yes
Lmo2 Tab2 Map3k7ip2 NM_138667 TGF-beta activated kinase 1/MAP3K7 binding protein 2 − Yes
Lmo2 Tubg1 Tubg NM_134024 Tubulin, gamma 1 − Yes
Lmo2 Uhrf1 Np95, Icbp90 NM_010931 Ubiquitin-like, containing PHD and RING finger domains, 1 − Yes
Lmo2 Atp5c1 1700094F02Rik NM_020615 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma-polypeptide 1 − No
Lmo2 Pck1 Pepck NM_011044 Phosphoenolpyruvate carboxykinase 1, cytosolic − No
Lmo2 Zfp106 NM_011743 Zinc finger protein 106 − No
Lmo2 Adap1 Centa1, p42(IP4) NM_172723 ArfGAP with dual PH domains 1 N/A Yes
Lmo2 Appbp2 PAT1 NM_025825 Amyloid-beta precursor protein (cytoplasmic tail) binding protein 2 N/A Yes
Lmo2 Baz1a Acf1 NM_013815 Bromodomain adjacent to zinc finger domain 1A N/A Yes
Lmo2 Cactin 2510012J08Rik NM_027381 Cactin, spliceosome C complex subunit N/A Yes
Lmo2 Capn15 Solh NM_015830 Calpain 15 N/A Yes
Lmo2 Capza2 Cappa2 NM_007604 Capping protein (actin filament) muscle Z-line, alpha 2 N/A Yes
Lmo2 Ccna2 Ccn1, Ccna NM_009828 Cyclin A2 N/A Yes
Lmo2 Cdk9 NM_130860 Cyclin-dependent kinase 9 (CDC2-related kinase) N/A Yes
Lmo2 Cxxc1 Cfp1, Cgbp NM_028868 CXXC finger 1 (PHD domain) N/A Yes
Lmo2 Egln2 NM_053208 Egl-9 family hypoxia-inducible factor 2 N/A Yes
Lmo2 Gtf3c2 TFIIIC110 NM_027901 General transcription factor IIIC, polypeptide 2, beta N/A Yes
Lmo2 Myl6 Mlc3 NM_010860 Myosin, light polypeptide 6, alkali, smooth muscle and nonmuscle N/A Yes
Lmo2 Wdr46 Bing4 NM_020603 WD repeat domain 46 N/A Yes
Lmo2 Ylpm1 ZAP3 NM_178363 YLP motif containing 1 N/A Yes
Lmo2 Atg2a 1810013C15Rik NM_194348 Autophagy related 2A N/A No
Lmo2 B4Galnt1 GalNAc-T NM_008080 Beta-1,4-N-acetyl-galactosaminyl transferase 1 N/A No
Lmo2 Ckap2l Radmis NM_181589 Cytoskeleton associated protein 2-like N/A No
Lmo2 Dennd5a Rab6ip1 NM_021494 DENN/MADD domain containing 5A N/A No
Lmo2 Hyou1 Orp150 NM_021395 Hypoxia up-regulated 1 N/A No
Lmo2 Itm2b Bri2 NM_008410 Integral membrane protein 2B N/A No
Lmo2 Lias NM_024471 Lipoic acid synthetase N/A No
Lmo2 Mpo NM_010824 Myeloperoxidase N/A No
Lmo2 Nans Sas NM_053179 N-acetylneuraminic acid synthase (sialic acid synthase) N/A No
Lmo2 Pitrm1 Ntup1 NM_145131 Pitrilysin metallopeptidase 1 N/A No
Lmo2 Rpl17 NM_001002239 Ribosomal protein L17 N/A No
Lmo2 Rps11 NM_013725 Ribosomal protein S11 N/A No
Lmo2 Ypel3 Suap NM_025347 Yippee-like 3 (Drosophila) N/A No
Tal1 Tcf3 E2A, E47 NM_011548 Transcription factor 3 + Yes
Tal1 Tcf4 E2-2 NM_013685 Transcription factor 4 + Yes
Tal1 Erg p55; Erg-3 NM_133659 Avian erythroblastosis virus E-26 (v-ets) oncogene-related N/A Yes
Tal1 Fli1 Sic1; EWSR2; Fli-1; SIC-1 NM_008026 Friend leukemia integration 1 N/A Yes
Tal1 Drg1 Nedd3; AA408859; AI132520 NM_007879 Developmentally regulated GTP binding protein 1 N/A No
Tal1 Tusc1 TSG-9; 2200001D17Rik NM_026954 Tumor suppressor candidate 1 N/A Yes

Illustrated are proteins for which there were at least two independent clones per screen (analysis of 6 × 106 clones from a cDNA library of Kit+LIN− hematopoietic cells). LMO2 interacts with 52 proteins, including two Lys methyltransferases, MLL2 and SetD8, both controlling erythroid gene expression (61, 62). In contrast, TAL1 interacts with six proteins only, mostly E protein transcription factors, DRG1 as well as ERG and FLI1. IP, immunoprecipitation; N/A, not available.

LMO2 Associates with Replication Complexes.

We next addressed the question of whether LMO2 associates with the pre-RC in hematopoietic cells. Because pre-RC formation often requires a DNA template (35), we prepared DNA-containing chromatin extracts from CD34+Kit+ progenitors (TF-1 cells) (3, 13, 36, 37) to assess the interaction of LMO2 with endogenous replication proteins by immunoprecipitation. We found that POLD1, PRIM1, and MCM6, but not lamin B or beta-actin (negative controls), reproducibly and specifically coimmunoprecipitate with LMO2, but not with control Ig, in TF-1 chromatin extracts (Fig. 1F). We also detected the other members of the MCM hexameric complex (MCM2–MCM7), as well as ORC2, CDC6, CDT1, and PCNA, albeit with weaker efficiency for the latter three (Fig. 1F). In contrast, MCM6, POLD1, and PRIM1 did not coimmunoprecipitate with SCL (Fig. 1G), whereas LMO2 and LDB1 were found with SCL in this assay, as expected. Therefore, replication proteins do not stably associate with the SCL transcription complex but more specifically with LMO2.

LMO2 Binds to Origins of Replication.

LMO2 shares important transcriptional targets with SCL (15, 16, 25, 36). Nonetheless, LMO2 is rarely found at gene promoters (3%) by ChIP sequencing in multipotent progenitors, whereas SCL is more frequently observed within transcriptional start sites (28%) (24), suggesting that LMO2 has SCL-independent functions. We assessed whether LMO2 associates with DNA replication origins, using ChIP of TF-1 cells with anti-LMO2, or anti-MCM5 antibodies. We first studied seven well-characterized human DNA replication origins (38) and found that both MCM5 and LMO2 occupied four of these replication origins, c-MYC, G6PD, TOP1, and MCM4 (Fig. 2A), all mapping to early replicating G1 (ERG1) segments (39, 40) (Fig. S1A). In contrast, MCM5 did not bind the GYPA promoter, a well-defined SCL-LMO2 transcriptional target (36), whereas LMO2 occupancy was confirmed, together with SCL and GATA1, two LMO2 transcription factor partners. SCL was detected at two of the seven tested origins, although binding was 10- to 20-fold lower compared with GYPA, whereas GATA1 binding was below the detection limit (Fig. 2A). Therefore, LMO2 is recruited to well-characterized DNA replication origins with MCM5, in the absence of GATA1 and frequently of SCL.

Fig. 2.

Fig. 2.

LMO2 and MCM5 occupy DNA replication origins. (A) ChIP of well-characterized DNA replication origins in TF-1 cells with anti-LMO2, anti-MCM5, anti-SCL, and anti-GATA1 Abs. Shown are the ratio of enrichment over control Ig and background (c-Kit, −20 kb). GYPA promoter sequences were amplified as a control (36). (Left) Maps depicting the location of well-characterized DNA replication origins and PCR probes. Gene exons are illustrated by black boxes. PCR primers are shown as red bars. E, E47 consensus sites; G, GATA1/2 consensus sites. n.d., not detectable. (B) LMO2-bound replication initiation zones (gray, first column) are preferentially enriched within ERG1 segments. Forty-five replication initiation zones found in common in two studies (38, 41) were analyzed by ChIP for LMO2 binding. The replication timing of these origins according to two datasets is illustrated: study 1 [Gilbert and coworkers (42)] in leukemic patients and lymphoblastoid cell lines and study 2 [Stamatoyannopoulos and coworkers (39)] in B cells and ES cells. A higher proportion of early replicating segments (gray, last column) is found in LMO2-bound origins (P = 0.02). Mix: Some samples from study 1 showed early replication, whereas others showed late replication. (C) Diagram illustrating the synthetic DNA replication assay. Plasmid DNA was transfected into HEK293 cells and detected by PCR (primer pairs as shown). (Left) Dpn1 sensitivity distinguishes unreplicated methylated plasmid DNA (sensitive) from replicated hemi- or unmethylated DNA (resistant). (D) LMO2 fused to GAL4 stimulates the replication of a GAL4-responsive plasmid in mammalian cells. HEK293 cells were transfected with the indicated GAL-fusion genes. After Dpn1 digestion, Dpn1-resistant extrachromosomal DNA was quantified by real-time PCR (n = 2). P < 0.05. (E) LMO2-induced DNA replication depends on LMO2 tethering to DNA via GAL4 binding sites (UAS). The experiment was performed as in D. (F) LMO2 binding to artificial origins of replication is sufficient to recruit DNA replication proteins specifically. DNA capture was performed using immobilized WT or mutant UAS sequences on beads. Bound proteins were revealed by Western blotting. Data are the mean ± SD of at least two independent experiments performed in duplicate.

Fig. S1.

Fig. S1.

(A) Replication timing of DNA replication origins in leukemic and lymphoblastoid cells [study 1 (40)] and in B lymphoblastic (Bly) and ES cells [study 2, (39)]. LMO2 binding assessed by ChIP (Fig. 2A) is illustrated. (B) Subset of 45 initiation zones is identified in common by two different studies (38, 41). (C) LMO2 and MCM5 co-occupy the above initiation zones (shown in B), which are numbered according to the system of Cadoret et al. (38). Primer pairs are listed in Tables S2 and S3. Immunoprecipitated chromatin levels are indicated as the ratio of enrichment over control isotype Ig, after normalization with a negative control DNA sequence (c-Kit, −20-kb upstream sequence). Three additional background regions (bg1, bg2, and bg3) used by Karnani et al. (41) are also shown.

These results led us to assess LMO2 occupancy of replication initiation zones identified in two independent tiling array-based studies in HeLa cells, using Lambda-exonuclease digestion (38, 41) and anti-BrdU immunoprecipitation to purify origin-centered nascent DNA strands. We focused on a subset of 45 replication initiation zones that overlapped within a distance of 1 kb between the two studies (Fig. 2B and Fig. S1 B and C). In TF-1 cells, MCM5 and LMO2 were each detected on 20 and 19 replication initiation zones, respectively, nearly half of which were positive for both (Fig. 2B). We aligned these 45 replication initiation zones with ERG1 segments identified in mammalian cells (39, 42) and found that 68% of LMO2-bound zones mapped to ERG1 segments, which is almost twice the percentage of ERG1 segments found in the absence of LMO2 (Fig. 2B). Therefore, LMO2 is recruited to a significant proportion of initiation zones in TF-1 cells, corresponding, in most part, to ERG1 segments.

Tethering LMO2 to DNA Recruits Replication Proteins and Induces DNA Replication.

To determine whether LMO2 tethering to DNA was sufficient to stimulate DNA replication, we optimized a synthetic DNA replication assay in mammalian cells described by Takeda et al. (43). We assessed whether LMO2 fused to the DNA binding domain of GAL4 can drive DNA replication from GAL4 binding sites (5XUAS) in transfected 293 cells (Fig. 2C). Newly replicated DNA is hemimethylated or unmethylated and can be distinguished from transfected, bacterially derived DNA by its resistance to Dpn1 digestion (43). As expected, GAL4-ORC2 induced an approximately fivefold increase in newly synthesized DNA compared with control GAL4-VP16 (Fig. 2D). In this assay, GAL4-LMO2 reproductively directed a dose-dependent increase of newly replicated DNA, reaching a maximum of eightfold (Fig. 2D), whereas GAL4-SCL did not produce the same results. This activity was abrogated when GAL4-binding UAS sequences were mutated (Fig. 2E) or absent (pBluescript vector). We therefore conclude that LMO2 anchoring to DNA was sufficient to direct DNA replication. LMO2-driven DNA replication occurred most likely in the absence of transcription because 293T cells lack hematopoietic transcription factors that recruit LMO2 to DNA, namely SCL and GATA1/2. To determine if DNA-bound GAL4-LMO2 could recruit DNA replication proteins to the UAS template, we performed DNA capture as previously described (44), using UAS sequences immobilized on beads. LMO2 recruited POLD1, MCM5, and, to a lesser extent, CDT1 and PCNA to DNA, and this recruitment required the integrity of the GAL4 binding site (Fig. 2F). Together, our results indicate that LMO2 tethering to DNA was sufficient to nucleate the assembly of prereplication/preinitiation complexes specifically at the site of binding and to direct DNA replication.

LMO2 Expression Levels Control the Rate of DNA Synthesis and Cellular Outcome in the Erythroid Lineage.

Cell cycle is highly regulated in the erythroid lineage because ∼80% of primary proerythroblasts (E1 stage; Fig. 3A) are in S phase, exactly at the onset of erythropoietin (Epo) dependence (45), and this proportion sharply drops at the E3 and E4 stages of terminal differentiation. We observed that the E1 population segregated into cells with high and low endogenous LMO2 protein levels (Fig. 3B), corresponding to high and low proportions of cells in S/G2/M (Fig. 3C). Strikingly, LMO2 protein levels decrease from the E1hi to E4 stage, directly correlating with a decrease in the proportion of cells in S phase (Fig. 3C), whereas GATA1 and SCL protein levels increase (Fig. 3D). This process is highly coordinated because most LMO2 partners identified here, including CCNA2, are synchronously down-regulated with Lmo2 during differentiation from proerythroblast to orthochromatic erythroblasts (Fig. S2).

Fig. 3.

Fig. 3.

LMO2 levels determine the proliferation of erythroid progenitors. (A) Diagram of erythroid differentiation according to flow cytometry profiles. (B) LMO2 levels in bone marrow erythroid progenitors (Lin−CD71+Ter119−) correlate with their cell cycle status by Hoechst staining: E1low and E1high (P ≤ 0.05). The mean fluorescence intensity (MFI) for LMO2 per cell was assessed by flow cytometry. (C) Correlation between LMO2 levels and the proportion of cells in S/G2/M during erythroid differentiation (E1 to E4). (D) Expression levels of LMO2, SCL, and GATA1 during erythroid differentiation. (E) Decreased LMO2 in erythroid progenitors reduced the fraction of cells in S phase. The shRNA Lmo2 was delivered in Ter119− fetal liver cells, which were then stimulated with Epo for 2 d. The cell cycle in erythroid progenitors (E1, CD71+Ter119−) was analyzed by DAPI staining. (F) Lmo2 is required for the response of proerythroblasts to Epo. NT, nontarget (control). (G) LMO2 levels control the proliferation of erythroid progenitors in culture. (H) Decreased LMO2 abolishes the growth of erythroid progenitors (E1) in response to Epo but favors terminally differentiating erythroid cells (E4). (I) Decreased DNA synthesis induced by shRNA-mediated Lmo2 depletion. MEL cells were purified in G0/G1 and released in culture for different times in the presence of α32P-dCTP. After electrophoresis, total DNA was quantified by autoradiography (n = 2). The slopes of the two curves were 0.48 ± 0.02 (Vector) and 0.29 ± 0.01 (shLmo2). *P < 0.0001. (J) Decreased proportion of cells in S phase after Lmo2 depletion. MEL cells expressing shLmo2 or control (Vector) were purified in G0/G1 and analyzed for cell cycle progression at different time points in culture by Hoechst staining (n = 3). All data shown are typical of at least two independent experiments.

Fig. S2.

Fig. S2.

Gene expression during the five stages of erythroid differentiation in the human and mouse. Shown are the genes encoding proteins that interact with LMO2 (Fig. 1A) within the DNA replication and cell cycle categories. RNA-sequencing data [reads assigned per kilobase of target per million mapped reads (RPKM)] were obtained from human cells (59) (A) or murine cells (60) (B).

We addressed the functional importance of LMO2 by decreasing LMO2 protein levels in erythroid progenitors via RNAi (shRNA Lmo2) (Fig. S3A). Lmo2 depletion in Ter119− fetal liver erythroid progenitors decreased by twofold the proportion of cells in S phase as determined by DAPI staining and flow cytometry analysis, compared with control cells (Fig. 3E). In addition, Lmo2 depletion almost abrogated the proliferation of primary erythroid progenitors at a key commitment step marked by Epo responsiveness (Fig. 3 F and G), while enhancing the generation of mature E4 cells (CD71−Ter119+) (Fig. 3H). Therefore, high LMO2 levels are required for the Epo-dependent proliferation of CD71+ erythroid precursors, whereas lowering LMO2 accelerates terminal erythroid differentiation.

Fig. S3.

Fig. S3.

(A) Decreased LMO2 protein levels in MEL-expressing Lmo2-directed shRNA 867 were selected for further analysis. (B) Cells with reduced levels of LMO2 were not apoptotic. MEL cells infected as indicated were stained with the Annexin V apoptosis marker. Dead cells were stained with propidium iodide (PI). (C) Decreased proliferation of MEL cells expressing shRNA Lmo2. (D) Decreased LMO2 expression does not affect the transcriptional level of replication genes. RNA levels were normalized over HPRT and are shown as the ratio of expression levels in shRNA Lmo2 cells over control cells (empty vector) (n = 2 independent experiments performed in duplicate). Peptidylprolyl isomerase A (Ppia) served as an additional control. (E) MEL cells can be synchronized in G0/G1 by flow cytometry. (Left) Forward scatter (FSC) and side scatter (SSC) properties. (Lower Right) Cell cycle status of asynchronous MEL cells shown by DAPI staining. (Upper Right) Cell cycle status of the 10% smallest cells determined by the FSC/SSC profile. More than 90% of these cells are in G0/G1. (Right) Representative cell cycle profile of MEL cells after sorting (t = 0), and at the indicated times after release in culture. Note that when control cells were in late S phase, cells expressing shLmo2 were in early S phase. Finally, after overnight (O/N, 16 h) incubation, control cells have resumed normal cell cycle profiles, whereas Lmo2 knocked-down cells are still delayed in S phase.

Decreased LMO2 levels caused a twofold decrease in the rate of DNA synthesis monitored by the kinetics of 32P orthophosphate incorporation into synchronized mouse erythroleukemia (MEL) cells (Fig. 3I), without causing apoptosis (Fig. S3B). Consequently, these cells failed to proliferate in culture (Fig. S3C). Decreased DNA synthesis was unlikely due to decreased expression levels for replication genes assessed by RT-quantitative PCR (Fig. S3D), consistent with transcriptome analysis of erythroid cells and lymphoid cells in which Lmo2 was knocked down or overexpressed, respectively (12, 46). Furthermore, replication genes were not occupied by the SCL–LMO2 complex in leukemic T cells (25). Together, these observations indicate a critical role for LMO2 in erythroid cell fate, via the control of DNA replication and the cell cycle that drives Epo-dependent expansion of erythroid progenitors while impeding their commitment to terminal maturation.

LMO2 Expression Regulates S-Phase Entry.

We next addressed the importance of LMO2 levels on the kinetics of cell cycle progression (Fig. 3J). Briefly, we found that viable MEL cells with low side and forward scatter properties are mostly in G0/G1 (Fig. S3E). These G0/G1 cells were purified and released in culture medium to analyze their DNA content by Hoechst staining (Fig. S3E). Decreased LMO2 (shRNA Lmo2) reproducibly caused a 2-h delay in G1/S transition, occurring at 3 h after release compared with 1 h for control cells (Vector), as well as delayed S-phase progression (Fig. 3J and Fig. S3E), indicating that LMO2 levels control S-phase entry in erythroblasts.

To mimic retroviral integration upstream of the LMO2 locus in the X-SCID gene therapy trial (19, 20, 46) and define the consequences of ectopic LMO2 expression in vivo, we delivered LMO2 in hematopoietic stem cells by retroviral infection, (Fig. 4 A–F). Upon transplantation, LMO2-transduced bone marrow cells induced T-ALL in 60% of recipient mice, with a median of 270 days (46) (Fig. 4B and Fig. S4). During the preleukemic stage (30 days), LMO2 overexpression mostly affected thymocytes and led to an accumulation of CD44+CD25−CD4−D8− double-negative thymocyte (DN) cells and a decrease in CD4+CD8+ double-positive thymocyte (DP) cells in the thymus, reproducing the differentiation blockade at the DN stage reported in LMO2 transgenic mice (Fig. 4C), despite the fact that the retroviral vector allowed for transgene expression in all cells. Elevating LMO2 in thymocytes modified the cell cycle status of thymocyte progenitors (Fig. 4D) without affecting bone marrow stem cells (Fig. S4B), consistent with the role of LMO2 as a T-cell specific oncogene (46). Interestingly, elevating LMO2 enhanced the cell cycle status of both DN1 and DP cells, suggesting that differentiation blockade (lower number of DP cells) could be due to increased cell cycle. Furthermore, when DN1 thymocytes were synchronized in G0/G1 and released in culture, LMO2-expressing cells entered more rapidly into S phase compared with control cells (vector) (Fig. 4E), indicating that LMO2 facilitates the G1-S transition and S phase progression.

Fig. 4.

Fig. 4.

Ectopic LMO2 expression in thymocytes triggers G1/S transition, T-cell hyperproliferation, and T-ALL development. (A) Experimental strategy to deliver LMO2 in hematopoietic cells using the murine stem cell virus (MSCV) retroviral vector. BM, bone marrow. (B) LMO2 overexpression induces T-ALL in mice. Kaplan–Meier curves showing the time of leukemia onset in mice transplanted with MSCV-LMO2 or MSCV transduced cells. (C and D) LMO2 overexpression leads to an increase of the DN1 thymocyte subset but a decrease in DP cells in vivo, despite higher proportions of cycling cells in both populations. (E) LMO2 overexpression induces an increase in the percentage of DN1 cells in S phase. DN1 cells were purified in G0/G1 and analyzed for cell cycle progression by DAPI staining at different time points after coculture with MS5-DL4 stromal cells. (F) LMO2-expressing thymocytes are more sensitive to 5-FU treatment in vitro. Cells were cocultured on MS5-DL4 stromal cells and treated with 5-FU at the indicated doses. Viable Thy1+ cells were scored by flow cytometry. (G) Proposed model: LMO2 controls DNA replication, favors progenitor cell proliferation, and inhibits commitment to terminal differentiation in the erythroid and T-lymphoid lineages. Data shown are typical of at least two independent experiments.

Fig. S4.

Fig. S4.

(A) Murine bone marrow cells were transduced with LMO2 or the empty vector (MSCV-YFP) and purified into YFP+ and YFP− cells. The human LMO2 transgene was revealed by PCR of genomic DNA. Murine Otx1 served as a positive control for DNA loading. (B) Cell cycle analysis of hematopoietic stem cells [Kit+Sca+Lin− (KSL)] and progenitors [Kit+Sca−Lin− (KL)] ectopically expressing LMO2. (C) Typical spleen from a leukemic mouse transplanted with LMO2-overexpressing cells, compared with control. (D) Immunological phenotype of LMO2-induced leukemias. Representative flow cytometry analysis of MSCV-LMO2–induced leukemia cells, compared with cells from a healthy mouse. In the thymus, an expansion of the double-negative compartment is observed. Leukemic cells express Thy1, appear as blast cells (FSC profile), and invade the bone marrow and the spleen.

The above results indicate that LMO2 overexpression in hematopoietic cells reproduced the T-cell proliferation phenotype reported for preleukemic patients in the X-SCID gene therapy trial. Actively dividing cells are more sensitive to 5-fluorouracil (5-FU), an antimetabolite that inhibits thymidylate synthase and therefore depletes the pool of dTTP. Consistent with increased DNA replication, LMO2-expressing thymocytes cocultured with MS5 stromal cells expressing DL4 were 100-fold more sensitive than WT thymocytes to 5-FU (EC50 of 5 nM vs. 500 nM) (Fig. 4F).

Discussion

LMO2 has a well-established function in transcriptional regulation via direct interaction with transcription factors, mostly of the bHLH family, SCL/TAL1, TAL2, and LYL1 or GATA proteins (2–4). In this study, we revealed unexpected new functions of LMO2 in hematopoiesis and leukemogenesis through a yeast two-hybrid screen of LMO2 interaction partners in hematopoietic progenitors. Our observations indicate that LMO2 controls cell fate by directly promoting DNA replication, a hitherto unrecognized mechanism that might also account for its oncogenic properties.

Our study unravels unexpected interactions between LMO2 and three essential replication proteins, MCM6, PRIM1, and POLD1 (30), as well as chromatin-modifying enzymes that have well-characterized roles in DNA replication, BAZ1A, SETD8, MYST2, and UHRF1 (31–33, 47). More importantly, tethering LMO2 to DNA via the GAL4-DNA binding domain was sufficient to recruit MCM5 and POLD1 to DNA and to transform UAS into origins of replication, indicating that LMO2 directly controls DNA replication. Unlike other transcription complexes that have a dual role in DNA replication (48), LMO2 interaction with the RC is distinct from the well-known recruitment of LMO2 to the SCL transcription complex. Our data are in line with the observations that there is only a partial overlap between SCL and LMO2 chromatin occupancy in hematopoietic progenitors (24).

LMO2 binding to replication initiation zones reported here overlaps with early G1 replication segments described in lymphoid cells (39, 42), a possibility that may be favored by its interaction with MLL2 (Fig. 1A). Indeed, the H3K4me3 histone mark found in early replicating domains (40) can be controlled by MLL2. In eukaryotes, origins are licensed in excess, and not all licensed origins are active during a given cell cycle, which requires recruitment of DNA polymerases to initiate DNA synthesis (30). Accordingly, we show that LMO2 levels influence the rate of DNA replication in MEL cells.

Although we focused on the basic components of the pre-RC in the present study, several other proteins identified in the screen could have a regulatory function. For example, cyclin A2-CDK2 favors the onset of DNA replication at the G1-S transition and prevents rereplication during S phase (49). These possibilities would be consistent with the effects of LMO2 levels on the kinetics of G1-S transition that we observed in two cell types, delayed when Lmo2 is knocked down in murine erythroleukemic cells and, conversely, accelerated in LMO2-overexpressing DN1 thymocytes. In addition, LMO2 associates with two cell cycle checkpoint proteins, CDK9 and BUB1B (Table S1). CDK9 associates with cyclin K in replication stress response and prevents DNA damage in replicating cells (50). BUB1B is an essential component of the mitotic checkpoint. The importance of these cell cycle proteins for LMO2-induced cell proliferation remains to be addressed.

Cell cycle is a highly regulated process in the erythroid lineage. CD71+Ter119− proerythroblasts represent a critical transitional stage marked by Epo dependency (51) and elevated DNA replication (45), both shown here to require high LMO2 protein expression. Conversely, terminal erythroid differentiation to the CD71−Ter119+ stage is necessarily coordinated with growth arrest (13, 51), which we now show to be favored by Lmo2 down-regulation, in agreement with previous work indicating that LMO2 overexpression prevents terminal erythroid differentiation (11). We conclude that LMO2 down-regulation is required for the switch to terminal erythroid differentiation due to the implication of LMO2 in DNA replication/cell cycle (Fig. 4G).

It is well established that transcription factor gene networks drive hematopoietic cell development and lineage outcome, via synergistic or antagonistic interactions (reviewed in refs. 52 and 53). It is unclear how LMO2 inhibits cell differentiation in both the erythroid (11) and T-lymphoid lineages (reviewed in ref. 53). We now propose that LMO2-dependent DNA replication in both lineages governs the switch between a proliferative state in progenitors and commitment to terminal differentiation (Fig. 4G). Failure to regulate this proliferative switch caused by ectopic LMO2 expression (19) may lead to T-ALL.

Oncogene-induced DNA replication stress (54) could lead to replication errors and ultimately cause genetic lesions, such as activating NOTCH1 mutations (55, 56), that convert preleukemic stem cells (15, 16) into leukemia initiating cells (15). Two other LIM-only proteins, LMO1 and LMO4, are also important determinants of cell cycle progression in neuroblastoma (23) and in breast cancer associated with genomic instability (22), respectively, suggesting that the mechanism(s) described here may be extended to these proteins. Emerging evidence indicates that oncogenes, such as c-MYC or HOXD13, can be part of nontranscriptional complexes involved in DNA replication (54, 57). Taken together, we propose that oncogenic transcription factors in acute leukemias and possibly other tumor types transform cells by at least two DNA-dependent mechanisms, the control of gene expression programs, as initially proposed (1), but also by deregulating DNA replication (42), with both processes being important determinants of cell fate.

Materials and Methods

Yeast Two-Hybrid.

LMO2 full-length protein was subcloned in the pGBKT7 vector and transformed in the Y187 yeast strain. The cDNA library from c-Kit+Lin− murine bone marrow cells was constructed in the pGADT7 vector with the Matchmaker Library Construction and Screening Kit (BD Biosciences) and transformed in the AH109 yeast strain. The screen (selection of Ade+His+Leu+Trp+ colonies) was performed by yeast mating. Positive clones were isolated and sequenced. To confirm the interactions and check for specificity, full-length cDNAs for Polδ1, Prim1, Mcm2-5-6-10, Cdt1, Pcna, and Caf1 were subcloned into pGADT7 and transformed in AH109 cells.

Retroviral Gene Transfer and RNAi.

LMO2 retroviral gene transfer and mouse bone marrow transplantation were performed as described (8). For RNAi experiments, vesicular stomatitis virus (VSV-G)–producing cells were transfected with plasmids encoding shRNAs against LMO2, with a nontarget shRNA or with the empty pLKO.1 vector (Sigma). MEL cells or Lin− fetal liver cells were incubated with VSV-G supernatant for 48 h and then selected with puromycin as described (8). All mice were kept under pathogen-free conditions according to institutional animal care and use guidelines. The protocols for gene transfer and transplantation in mice were approved by the Committee of Ethics and Animal Deontology of the University of Montreal.

Flow Cytometry, Cell Cycle Analysis, and Cell Sorting.

Flow cytometry, cell cycle analysis, and cell sorting are described in Supporting Information.

32P Orthophosphate Labeling and Quantification of de Novo DNA Synthesis.

MEL cells synchronized in G0/G1 were incubated with α32P-dCTP (100 μCi/mL; PerkinElmer) in DMEM [10 mM Hepes (pH 7.4), 10% (vol/vol) FCS] at 8 × 105 cells per milliliter for the indicated times. Cells were lysed in DNA extraction buffer [80 mM Tris⋅HCl (pH 8.0), 8 mM EDTA, 100 mM NaCl, 0.5% (g/100 mL) SDS]. After proteinase K digestion and phenol/chloroform extraction, DNA was resolved on an alkaline (NaOH) agarose gel. The gel was dried on a Biodyne membrane (Pall Corporation). 32P incorporation was visualized by autoradiography and quantitated using ImageQuant software (GE Healthcare).

Protein Extraction, Immunoprecipitation, Immunoblot, Abs, RNA, and ChIP Analysis.

Protein extraction, immunoprecipitation, immunoblot (IB), Abs, RNA, and ChIP analysis methods are fully described in Supporting Information. Primer sequences used are shown in Tables S2 and S3, and Abs used for ChIP, IB, and immunofluorescence are listed in Table S4.

Table S2.

List of primer pairs

Real-time PCR oligos (ChIP)
 c-Myc Fw ATACGTGGCAATGCGTTGCT
 c-Myc Rv GAGCCGCATGAATTAACTAC
 G6PD Fw ACTCCACAATGACCTGGA
 G6PD Rv AGAGGGTCTTAACCAATCC
 Top1 Fw CACTGCCTAGCAGAGGGGCTGGG
 Top1 Rv AGCAGTTGTGTAACAGCCTAAGTTCGC
 MCM4 Fw AAACCAGAAGTAGGCCTCGCTCGG
 MCM4 Rv GTCTGACCTGCGGAGGTAGTTTGG
 Hsp70 Fw AGACTCTGGAGAGTTCTGAGCA
 Hsp70 Rv TTTCCCTTCTGAGCCAATCACC
 LaminB2 Fw GGCTGGCATGGACTTTCATTTC
 Lamin B2 Rv CTTAGACATCCGCTTCATTAG
 Dnmt1 Fw AACTGGGTTTGGTGGCATGT
 Dnmt1 Rv ATGCAATCACGGCTCACTGT
 Gpa Fw CCACTTTCATAGCCCCAAGA
 Gpa Rv TCATGAGCTGGTTCCTGAAG
Real-time PCR oligos (RT-PCR)
 LMO2 Fw TACTTCCTGAAAGCCATCGACC
 LMO2 Rv GATCCCATTGATCTTGGTCCAC
 Orc2 Fw TCATCAACGGCTACTTTCCTGG
 Orc2 Rv GTACCCACATGACTGAGGACAT
 Orc5 Fw TGAACCTCACCTGAAGAAGGCA
 Orc5 Rv CAGTTGTCCTGGGTCTGTGTTA
 MCM2 Fw AGACCTCACAGAGCCCATCATT
 MCM2 Rv GCCACCATTAGTCAACCCTTCA
 MCM3 Fw AGCTGTGTCCTGCGTTTGTT
 MCM3 Rv ATCCAACCTTGTCATCTGCCTG
 MCM4 Fw ACCAAAGTGAGGAGCAAGTGGA
 MCM4 Rv TCGAGGGTAAGCAGAAACCATC
 MCM5 Fw AGCCGCATTGAGAAGCAACT
 MCM5 Rv TTCGGATAGCGTGCTCTGGATA
 MCM6 Fw TACTGCCGAATCTCGAACCTCA
 MCM6 Rv TCGCTTCTCTTTAGTGCCGACT
 MCM7 Fw ATTCGACCTCCTCTGGCTGATT
 MCM7 Rv TGGTGGACATAGGTGATGTGCT
 Cdc6 Fw AGTCCTCAAACCACTCTCCGAA
 Cdc6 Rv AGCAAACCAGGATCTTCTGCTG
 Cdt1 Fw ACTATGGAGGTGGTCTGTGCAA
 Cdt1 Rv AGCTTGACGTAGGTATCCGTG
 Pold1 Fw TCATCACCAAAGAGTTGACCCG
 Pold1 Rv CACCCTTAGCAGCACCAATGAT
 Prim1 Fw ACCAGTCTAGCACCGTATGTGA
 Prim1 Rv TTCACGTTGGTTTGATGGGAGC
 PCNA Fw AGCCACTCCACTGTCTCCTA
 PCNA Rv CTGGCATCTCAGGAGCAATCT
 Cdc45 Fw GTCATGTGTCCCGTCATAACCA
 Cdc45 Rv TTAAACCTGGCTGCTGTGTAGC
 PPIA Fw GTGCCAGGGTGGTGACTTTACACG
 PPIA Rv TCCCAAAGACCACATGCTTGCCA
 Hprt Fw GGCCAGACTTTGTTGGATTTG
 Hprt Rv CACAGGACTAGAACACCTGC
PCR oligos (presence and expression of transduced LMO2)
 MSCV-LMO2 Fw AAGAGCCTGGACCCTTCA
 MSCV-LMO2 Rv TCCCCTACCCGGTAGAAT
 Otx1 Fw GTCTTACCTCAAACAACCCCCA
 Otx1 Rv AAGATGTCTGGGTAGCGAGT
 LMO2 Fw AGGAACCAGTGGATGAGGTG
 LMO2 Rv CGATGGCCTTCAGGAAGTAG
 S16 Fw AGGAGCGATTTGCTGGTGTGG
 S16 Rv GCTACCAGGGCCTTTGAGATG

Fw, forward; Rv, reverse.

Table S3.

List of primer pairs

Replication zones Forward Reverse
Region_20 GGCCTTTGAAAATTGAGGAG TACACTTCTACCACCCTCCCTA
Region_23a GATAATTAACAGGCAGCGTGAG TCTATCTACCCTTCCACCTCAA
Region_23b GATTCTGTAGATTCTGGGCAAG TTACACACTACTGCCACTGCAT
Region_23c CAGCAACACTTCCCTGGATA CTGCACTGGTAATGATGTCTCA
Region_24 ACTGGTATTGTTCTCTGAGCTAGG GAGCTCTTATGCTCCTCTGCTA
Region_29 GGGAGGATGTAGGGGTATCG TTCTGTGGTTAGGCAAATAGC
Region_50 AGCTCTTTCGGACTTGGACT ACGAAGCGATTCTTACTGTCC
Region_53a GAAGGGGGTCTTTCCTACTTTA CAATTCTTGAGACAGTCAGTGC
Region_53b ATCTGTTGGGGAGAAGGAAG GAGCTATCCCAAGGATAAAGGA
Region_54 GGTTGAGTTGGGGGTATTTTCT GAACATCTGGTTCTCAATCTGG
Region_87a AGAGGATGGTATGTGAGGTGAG TAGTGATGTCTGGTCATTCTGC
Region_87b AATAGCCATGCCTGGATACAC TAGAGGTGGGTGTAGGTTTGAG
Region_87c GCTGAGGTAAGGAGAGATGAGA GTTCTGTGCCCTCAACAGAT
Region_88 CTTAGTGTTTCCTGGAGAAGGA AGGCAAGAGAAAATATGGACAC
Region_93 GGTGTGAGATCTGAGCTTGATT ATAGTCTCTGCCTGGACCCAAC
Region_105a ACTGCTGTGTCTCTTTCTGCTT CCAAACATACATATGCCTACCC
Region_105b AGGACAACGTGCTGTGAGTAAT CAGACAGAATAGGTAGGGGTCA
Region_105c CTCTTCATGTAGGTCAGGCTTC TCTTCTGGTGCCTGGTAAGATA
Region_117a CAGATAGAATCGTCTGCAACAC GCAGGTGACTTCTGTTCTAAGC
Region_117b TGGCTGATTACCCAGTAAGTCT TTGATCTACAGGGCCAGTCTAC
Region_117c CCAGTTCTATCACATTTCAGCA AGACAGAAAGATGGAGTCTTCG
Region_126 CAGCTACTGTGGTTCTTCAAGC TCTATCTACGTGAGGCACTCCT
Region_130a GGACCATGATGTCAGAAGTTG GGTATGTTAAGTGCCTCTTGGT
Region_130b CAGACCCTCCTTAGGAAGAGA CCTCACATCCTACTAGTCTTCCA
Region_130c CCTGTCTCAAAGTTGTGAGGAT AGCAAGACCCTGTCTCAAAATA
Region_151a GACCAAAGGTCATCTGCTGTAG CATAGTCTTTCCCATCTTGAGC
Region_151b ACACATCTCACCAGTTTGACAC TCTATGAGAGGCCTGTGGACTA
Region_151c ACTCTCCATTCCCATCTTACCT CTCAGCTATGCTGTCTTCCAGT
Region_155 GAGACTTCCCAAGGGTTACATA CACTCACAGTCAGAAGGAAGTG
Region_162 ATGCACCTAAGCCTGTCTTGT GGATAACAGCTGGAAGAAGGTA
Region_163 GTGGTAACTTCTGACCTGCATT GGTGAGGGAGGAAACTAAGAAG
Region_165 GCAGTGTATTGAATCCTTGGAG AGCAGAGCCAAGAAATCTACAG
Region_167 AGTCAGAACCCTGGTCTTTGGT AGTGGCAGCCAGAACTTGAAAC
Region_188a ACAACCAAAGCTATAGTAGACTGGA CTCCACTTTTATTGGAGGAACA
Region_188b GTGCAGTGCTCTTGAAAGAAGT CTTAAAAGCTGCCTCAGTTACG
Region_188c CAAGGTACTTCCCTTTATGTCG TTCCCAGCATATACAGTTGAGG
Region_188d AACGGCCATTATTACCATGA ATAAGTTGGAAGCAGGAAGGTC
Region_190 GATATGACTCACCTCCTCCAAA AGGGAGAGGAAAGGAGTAAAGA
Region_193a CTCATGTCATCAGCCTTGAGTA AGGTTCTGAGGCTAAACAACAG
Region_193b GGTTGTCGATGTGAGAGCTAA CTGTGGAGGTGTTGCTTCTATC
Region_193c AGCTGGTGCACCTTAGTTGAT AGTGTCTCCAGGCTTAGGAAAT
Region_194a AGGATTGGAGGAAATCTACTGG CCAATGGGTGAAGTAAGGTG
Region_194b CATCAGTGTAAGCAGTCGGTAA AAGGTACTTACCCCATCCTAGC
Region_194c GCGAAGACATATTGCCACAG GCTCAGGAGTTTGAAAGAAAGG
Region_202 ATAGAGCTACAGGGAGGAAAGG TCACTCGGTAACAGGGATCTAC
Region_206 AGAGCTCAAAGCTAACAGGTTG ACTTCCTTTGTATGAGCCAGTG
Region_207 GTCAGAGATCTGGCAGTGAATC GTCTTTTGAAGAGTTCCACCAC
Region_208 ATGGGATTGGAGAGAAACTAGG CAGAATTCTCCACGTCCATC
Region_209a CGCTGACTTCAAAATGAGATTC AGATCTGTGGTCTCTGTCTTGG
Region_209b ATCTCAAGGAGCCAGAATCAC CCAGTAGCCAATAGGAACAGAA
Region_209c GCAAAGGTTGGAAAGGGAGCAA TATCTGGCTCTTGCCTGTCTCT
Region_210 TCAAACCTAACACAGGTGGTAAC CACAAAAGTAGTGCTGAAGATCC
Region_212 AGAATCTGTTTCGGACTTCCTC AGGACATCAGACAGTCAAGGTT
Region_217 CTAGCAAATGAGCCTATTGACC CTAGACTTTCAACCTGGGAATG
Region_218a ATATTCAGTCTGGCCTCAACC GAACAAGCAAGGGTGTCATAGT
Region_218b CATCGCTTTATTGGCTGAGA GAGTAGGCAGTTGAGGTTGTTG
Region_219a GTCTCTGTTACTCTGCCAATCA GATCAGTCTTGGGTGAAACAGT
Region_219b ACGGACCAGTCCTACATTGAT GAGCATCTAGAGTTTCCCTTTG
Region_219c GAATTCCTCCAGGGCTCCTA TTTCTTGCCCTACCCTTCTT
Region_219d CTCCTGTTTTTCAGTTCCCAGT GTGGAGAGGAATGGTATGGTTA
Region_219e TCTAGCTTGGCACTTTACCTG GGTGATCAACTGACTAGCAGGA
Region_220 GTTAACCCAGCAAGCTACAAAG TGTCTTCTGGTAAGTCTCTGCAC
Region_221 GAACTGCTGCTCTCTTAATTCG GTCAAAATTAGCAGGGTTCTCC
Region_225 GGCACAGGTGTACCTTGAATCT CTGCAGTGAGCTGTGATCATGT
Region_228a GAGCTATGAAAACCTGCTGAAC GTGGTCACCCAAATACAGTACA
Region_228b GCTGATTGAATAGAGAGCCACA GAAGGGGGAAAACCAATAAACC
Region_230a GTCCCCTATTTTCAGTGACCTA ACCTTCATTTGGCACACAGAC
Region_230b CTCTGCTTGGCAGTTTTCAT CCAATTTCCCTCCCAAGTAT
Region_230c ACCTTCAGTCCTCCTCTTTCAT AGTTAATGGGCACAGGGATAC
Region_233a TGTCCTCTGTCTACGGGTTACT TTGCACAGCACAGTTAGGTATC
Region_233b TATGTCTAAGGGAGGGGAAGAG ATCCTAATAGGGTTAGGGCAAA
Region_233c ACAGAGGCTGAGAGAGTTCAGA ACAGGCTGAAGTCCTGTCTATG
Region_237 ATGCCAGACCTAGAGGATACAA CTAGTTAAACCCTGCATGAGCA
Region_241 CTAGTGTTTGGAGCCAGATCAT CAGAACCAGTATGGAGCAAGAT
Region_259a CTAACCATTCTCTTGGGTTCTG AGAAACCAGGGAAGGTACAGTT
Region_259b TGCCTAGAACATGGAAGGTACT AGGATGGGGAATAGGAGTAAGA
Region_264 GTGGGAAACAGCATCAAGTAGT TGTCGAAAGTACAGCGGTTT
Region_272a TATAGGGACCCAGCAGATTTC GAAGCATATACGGCCTCAGTAG
Region_272b CATTGCACCCACATTTTCTC TCTATGAGAGTGTGAGCACTGG
Region_272c CACCTACTTGTTCCTGCTAGATG CCCATTCCATGAATTTCTGC
Region_bg_1 CACTGTCAAAAGTCTGTGAAGCTATT AGGCCAAACGTTTTTCTCTTG
Region_bg_2 TAGGCGCAGCTTGTAGGACT CAGGATTTGGGACAACTTGG
Region_bg_3 CTTGCACAATGCCTCACTCA GAAAACACCAGCCACCAGAA

Table S4.

List of Abs

Company Antibody
FACS Abs
 BD Pharmingen CD4 (RM4-5)
CD25 (PC61)
CD34 (RAM34)
Sca1 (E13-161.7)
CD71 (C2)
B220 (RA3-6B2)
CD3ε (145-2C11)
 eBioscience CD8a (Ly-2)
CD44 (IM7)
CD45.2 (104)
CD16/32 (93)
c-Kit (2B8)
Ter-119 (11-5921)
FCεR1 (MAR-1)
Gr-1 (RB6-8C5)
Thy1.2 (30-H12)
IP, ChIP, and IB Abs
 Millipore Mouse anti-Cdc6 (05-550)
Mouse anti-CDT1 (04-1524)
 Cell Signaling Technology Rat anti-Prim1 (4725S)
 Bethyl Laboratories Rabbit anti-MCM5 (A300-195A)
 Santa Cruz Biotechnologies rat anti-GATA1 (sc-265)
Goat anti-lamin B (sc-6217)
Goat anti-Ldb1 (sc-11198)
Goat anti-MCM3 (sc-9850)
Mouse anti-MCM7 (sc-56429)
Rabbit anti-PCNA (sc-7907)
 BD Biosciences Mouse anti-MCM2 (610700)
Mouse anti-MCM6 (611622)
Mouse anti-Orc2 (51-6875GR)
Mouse anti-Pold1 (610972)
Mouse anti-sc35 (556363)

The BTL-73 mouse anti-SCL/Tal1 antiserum was generously provided by D. Mathieu (Institut de Génétique Moléculaire, Montpellier, France).

Transient Replication Assay in Mammalian Cells.

The transient replication assay is adapted from Takeda et al. (43) and described in Supporting Information.

Flow Cytometry, Cell Cycle Analysis, and Cell Sorting

For DNA content staining, cells were incubated with the Hoechst 33342 (10 μg/mL) in DMEM (10 mM Hepes, pH 7.4) supplemented with 2% FCS for 30 min at 37 °C, and then washed and analyzed on a FACSAria cell sorter (BD Biosciences). Cell cycle was analyzed with FloJow software (www.flowjo.com). For synchronization experiments, MEL cells were purified according to cell size (forward scatter/side scatter profile) because small cells are in G0/G1 (Fig. S3E). Cells were seeded in six-well plates at 105 cells per well and incubated at 37 °C for the indicated times. Cells were then harvested, fixed, and permeabilized with BD Cytofix/CytopermTM Fixation/Permeabilization Kit (BD Biosciences) before Hoechst staining (10 min). DN1 thymocytes were harvested from thymus of murine stem cell virus (MSCV) or LMO2 transplanted mice. Before cell sorting, CD4+ cells and CD8+ cells were depleted using magnetic beads (QIAGEN). The remaining fraction was stained with anti-CD44 and anti-CD25 Abs conjugated to allophycocyanin-cyanin 7 (APC-Cy7) or phycoerythrin-cyanin 7 (PE-Cy7), respectively, as well as Thy-PE, CD4–PE-Cy5, CD8-APC, and sorted using a FACSAria cell sorter. The DN1 subset was identified as the PE+PE-Cy5−APC−PE-Cy7−APC-Cy7+ population. DN cells were cocultured with stroma cell line OP9-DL1 in the presence of 5 ng/μL FLT3 and 5 ng/μL IL-7 (BD Biosciences).

Protein Extraction, Immunoprecipitation, ChIP, IB, Abs

TF-1 and MEL nuclear extracts were prepared as documented previously (36). Chromatin extracts of TF-1 cells were performed with or without cross-linking using formaldehyde at a final concentration of 0.5%. After 10 min, cross-linking was quenched by the addition of Gly to a final concentration of 0.125 M. Cells were harvested and washed with PBS, and protein extraction was performed by incubation with radioimmunoprecipitation (RIPA) buffer [10 mM Tris⋅HCl (pH 8.0), 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% deoxycholate]. Extracts were sonicated. For immunoprecipitation, 2 mg of protein was incubated overnight at 4 °C with 10 μg of Ab against LMO2 (AF2726; R&D Systems) in RIPA buffer. Protein complexes were immunoprecipitated by adding appropriately conjugated Pansorbin cells (Calbiochem) for 4 h at 4 °C, washed three times with RIPA buffer, and subjected to SDS/PAGE. After transfer on PVDF membranes (Millipore), proteins were visualized by IB using ECL Plus (GE Healthcare). Co-IP experiments in HEK293T were done as described in ref. 58. Abs used for ChIP and IB are listed in Tables S2 and S3.

RNA and ChIP Analysis

For ChIP, the same procedure used for TF-1 immunoprecipitation was applied, except that we used 500 μg of extracts with 1 μg of Ab. After precipitation, the immune pellet was recovered by addition of elution buffer [50 mM Tris⋅HCl (pH 8.0), 10 mM EDTA, 1% SDS], treatment with proteinase K, and phenol/chloroform extraction (36). For new replication initiation zones, we focused on 45 regions identified by Cadoret et al. (38) that showed an overlap within a 1-kb distance with 47 origins identified by Karnani et al. (41). We reasoned that these DNA regions are more likely to contain efficient origins in human cells. We designed 80 PCR primer pairs covering (i) the overlapping region when the two origins directly overlapped or (ii) each region, in addition to the “gap” region(s), when the origins were separated by a short DNA segment. After validation, these primer pairs were used to detect the presence of these origins in chromatin extracts from TF-1 cells immunoprecipitated with anti-MCM5 and anti-LMO2 Abs. For RT-PCR, total RNA was prepared from 50,000 cells as described previously (29). Primer sequences used are shown in Tables S2 and S3. Real-time quantitative PCR was done with PerfeCTaTM SYBR Green FastMixTM ROX (Quanta Biosciences) on a StepOnePlus RealTime PCR System (Applied Biosystems).

Transient Replication Assay in Mammalian Cells

This assay is adapted from Takeda et al. (43). The 5XUAS-CAT, the 5XUASmut-CAT, or the pBluescript plasmids were cotransfected in HEK293 cells with GAL4-VP16, GAL4-ORC2 (43), GAL4-LMO2, or GAL4-SCL expression vectors by calcium phosphate as described previously (36). pGEM4 was used to keep the total amount of transfected DNA equal. Cells (1–3 × 106) were harvested 2–3 days later and subjected to Hirt extraction for isolation of extrachromosomal DNA. After 2–24 h at 4 °C, the extracts were centrifuged at 15,000 × g and the supernatants were extracted successively with phenol and with phenol-chloroform-isoamyl alcohol. The DNA was precipitated overnight at −80 °C with 50 μg of carrier tRNA and 0.7 vol of isopropanol. Half of the Hirt DNA was digested with Dpn1 (New England Biolabs) for 16 h at 37 °C, along with the original 5UAS-CAT or 5XUASmut-CAT plasmids used as Dpn1 digestion positive controls. One-tenth of the Dpn1 digestion was further treated with 5 units of Lambda-exonuclease in a final volume of 20 μL according to the manufacturer’s instructions. Dpn1-resistant or undigested plasmids from Hirt extraction, along with digestion control 5XUAS-CAT plasmids, were detected by quantitative PCR amplification using the forward TAC ACA TAC GAT TTA GGT GAC ACT ATA GAA and reverse GAT GAA TTC GAG CTC GGT ACC oligonucleotides. Threshold cycles (Cts) obtained from the Dpn1-digested samples were normalized with the Cts obtained with the corresponding undigested samples. Digestion control plasmids confirmed that Dpn1 followed by the Lambda-exonuclease treatment allowed us to cut 99% or more of the methylated 5XUAS-CAT plasmids. Dpn1-resistant 5XUAS-CAT plasmids obtained from GAL4-ORC2 and GAL4-LMO2 were expressed as fold above the Dpn1-resistant 5XUAS-CAT plasmids obtained from the GAL4-VP16 negative control.

Acknowledgments

We thank Danièle Gagné [Institute of Research in Immunology and Cancer (IRIC)] for her assistance with flow cytometry, Véronique Litalien for mouse handling, Geneviève Boucher for bioinformatic analyses, Francis Migneault and David Flaschner for assistance with the yeast two-hybrid confirmation assays, Drs. Jalila Chagraoui and Richard Martin for help with the retroviral gene transfer and the yeast two-hybrid, and Dr. Jana Krosl for critical comments on the manuscript. This work was funded by the Cancer Research Society, Inc. (2012–2014); the Canadian Institutes for Health Research (CIHR; Grant MOP111050, 2011–2016); Canadian Cancer Society Research Institute Grant 019222 (to T.H.); the Leukemia & Lymphoma Society (2013–2015) (T.H. and E.B.A.); CIHR Grant 89928 (to A.V.); a CIHR multiuser grant to support the flow cytometry and imaging service; and a group grant from the Fonds de Recherche du Québec-Santé to support, in part, IRIC infrastructure. M.-C.S. was supported by a Canada Graduate Scholarship Doctoral Award (CIHR) and a doctoral award from the Cole Foundation. M.H. was supported by a postdoctoral fellowship award of the Swiss National Foundation (PBBEP3 144798), by Swiss Foundation for Fellowships in Medicine and Biology, and by Novartis (P3SMP3 151720). V.L. and D.F.T.V. were supported by Cole Foundation awards.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1515071113/-/DCSupplemental.

References

  • 1.Ferrando AA, et al. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell. 2002;1(1):75–87. doi: 10.1016/s1535-6108(02)00018-1. [DOI] [PubMed] [Google Scholar]
  • 2.Wadman I, et al. Specific in vivo association between the bHLH and LIM proteins implicated in human T cell leukemia. EMBO J. 1994;13(20):4831–4839. doi: 10.1002/j.1460-2075.1994.tb06809.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lécuyer E, et al. Protein stability and transcription factor complex assembly determined by the SCL-LMO2 interaction. J Biol Chem. 2007;282(46):33649–33658. doi: 10.1074/jbc.M703939200. [DOI] [PubMed] [Google Scholar]
  • 4.El Omari K, et al. Structural basis for LMO2-driven recruitment of the SCL:E47bHLH heterodimer to hematopoietic-specific transcriptional targets. Cell Reports. 2013;4(1):135–147. doi: 10.1016/j.celrep.2013.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lécuyer E, Hoang T. SCL: From the origin of hematopoiesis to stem cells and leukemia. Exp Hematol. 2004;32(1):11–24. doi: 10.1016/j.exphem.2003.10.010. [DOI] [PubMed] [Google Scholar]
  • 6.Love PE, Warzecha C, Li L. Ldb1 complexes: The new master regulators of erythroid gene transcription. Trends Genet. 2014;30(1):1–9. doi: 10.1016/j.tig.2013.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Org T, et al. Scl binds to primed enhancers in mesoderm to regulate hematopoietic and cardiac fate divergence. EMBO J. 2015;34(6):759–777. doi: 10.15252/embj.201490542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lacombe J, et al. Scl regulates the quiescence and the long-term competence of hematopoietic stem cells. Blood. 2010;115(4):792–803. doi: 10.1182/blood-2009-01-201384. [DOI] [PubMed] [Google Scholar]
  • 9.Li L, et al. Nuclear adaptor Ldb1 regulates a transcriptional program essential for the maintenance of hematopoietic stem cells. Nat Immunol. 2011;12(2):129–136. doi: 10.1038/ni.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Warren AJ, et al. The oncogenic cysteine-rich LIM domain protein rbtn2 is essential for erythroid development. Cell. 1994;78(1):45–57. doi: 10.1016/0092-8674(94)90571-1. [DOI] [PubMed] [Google Scholar]
  • 11.Visvader JE, Mao X, Fujiwara Y, Hahm K, Orkin SH. The LIM-domain binding protein Ldb1 and its partner LMO2 act as negative regulators of erythroid differentiation. Proc Natl Acad Sci USA. 1997;94(25):13707–13712. doi: 10.1073/pnas.94.25.13707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fujiwara T, Lee HY, Sanalkumar R, Bresnick EH. Building multifunctionality into a complex containing master regulators of hematopoiesis. Proc Natl Acad Sci USA. 2010;107(47):20429–20434. doi: 10.1073/pnas.1007804107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Goardon N, et al. ETO2 coordinates cellular proliferation and differentiation during erythropoiesis. EMBO J. 2006;25(2):357–366. doi: 10.1038/sj.emboj.7600934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Anderson MK. At the crossroads: Diverse roles of early thymocyte transcriptional regulators. Immunol Rev. 2006;209:191–211. doi: 10.1111/j.0105-2896.2006.00352.x. [DOI] [PubMed] [Google Scholar]
  • 15.Gerby B, et al. SCL, LMO1 and Notch1 reprogram thymocytes into self-renewing cells. PLoS Genet. 2014;10(12):e1004768. doi: 10.1371/journal.pgen.1004768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.McCormack MP, et al. The Lmo2 oncogene initiates leukemia in mice by inducing thymocyte self-renewal. Science. 2010;327(5967):879–883. doi: 10.1126/science.1182378. [DOI] [PubMed] [Google Scholar]
  • 17.Chervinsky DS, et al. Disordered T-cell development and T-cell malignancies in SCL LMO1 double-transgenic mice: Parallels with E2A-deficient mice. Mol Cell Biol. 1999;19(7):5025–5035. doi: 10.1128/mcb.19.7.5025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Homminga I, et al. Characterization of a pediatric T-cell acute lymphoblastic leukemia patient with simultaneous LYL1 and LMO2 rearrangements. Haematologica. 2012;97(2):258–261. doi: 10.3324/haematol.2011.051722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hacein-Bey-Abina S, et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science. 2003;302(5644):415–419. doi: 10.1126/science.1088547. [DOI] [PubMed] [Google Scholar]
  • 20.Howe SJ, et al. Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients. J Clin Invest. 2008;118(9):3143–3150. doi: 10.1172/JCI35798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Boehm T, Foroni L, Kaneko Y, Perutz MF, Rabbitts TH. The rhombotin family of cysteine-rich LIM-domain oncogenes: Distinct members are involved in T-cell translocations to human chromosomes 11p15 and 11p13. Proc Natl Acad Sci USA. 1991;88(10):4367–4371. doi: 10.1073/pnas.88.10.4367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Montañez-Wiscovich ME, et al. LMO4 is an essential mediator of ErbB2/HER2/Neu-induced breast cancer cell cycle progression. Oncogene. 2009;28(41):3608–3618. doi: 10.1038/onc.2009.221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang K, et al. Integrative genomics identifies LMO1 as a neuroblastoma oncogene. Nature. 2011;469(7329):216–220. doi: 10.1038/nature09609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wilson NK, et al. Combinatorial transcriptional control in blood stem/progenitor cells: Genome-wide analysis of ten major transcriptional regulators. Cell Stem Cell. 2010;7(4):532–544. doi: 10.1016/j.stem.2010.07.016. [DOI] [PubMed] [Google Scholar]
  • 25.Sanda T, et al. Core transcriptional regulatory circuit controlled by the TAL1 complex in human T cell acute lymphoblastic leukemia. Cancer Cell. 2012;22(2):209–221. doi: 10.1016/j.ccr.2012.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Palii CG, et al. Differential genomic targeting of the transcription factor TAL1 in alternate haematopoietic lineages. EMBO J. 2011;30(3):494–509. doi: 10.1038/emboj.2010.342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kassouf MT, et al. Genome-wide identification of TAL1's functional targets: Insights into its mechanisms of action in primary erythroid cells. Genome Res. 2010;20(8):1064–1083. doi: 10.1101/gr.104935.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Palomero T, et al. Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia. Blood. 2006;108(3):986–992. doi: 10.1182/blood-2005-08-3482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Herblot S, Steff AM, Hugo P, Aplan PD, Hoang T. SCL and LMO1 alter thymocyte differentiation: Inhibition of E2A-HEB function and pre-T alpha chain expression. Nat Immunol. 2000;1(2):138–144. doi: 10.1038/77819. [DOI] [PubMed] [Google Scholar]
  • 30.Remus D, Diffley JF. Eukaryotic DNA replication control: Lock and load, then fire. Curr Opin Cell Biol. 2009;21(6):771–777. doi: 10.1016/j.ceb.2009.08.002. [DOI] [PubMed] [Google Scholar]
  • 31.Collins N, et al. An ACF1-ISWI chromatin-remodeling complex is required for DNA replication through heterochromatin. Nat Genet. 2002;32(4):627–632. doi: 10.1038/ng1046. [DOI] [PubMed] [Google Scholar]
  • 32.Beck DB, et al. The role of PR-Set7 in replication licensing depends on Suv4-20h. Genes Dev. 2012;26(23):2580–2589. doi: 10.1101/gad.195636.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wu ZQ, Liu X. Role for Plk1 phosphorylation of Hbo1 in regulation of replication licensing. Proc Natl Acad Sci USA. 2008;105(6):1919–1924. doi: 10.1073/pnas.0712063105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Katsuno Y, et al. Cyclin A-Cdk1 regulates the origin firing program in mammalian cells. Proc Natl Acad Sci USA. 2009;106(9):3184–3189. doi: 10.1073/pnas.0809350106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Méndez J, Stillman B. Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: Assembly of prereplication complexes in late mitosis. Mol Cell Biol. 2000;20(22):8602–8612. doi: 10.1128/mcb.20.22.8602-8612.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lahlil R, Lécuyer E, Herblot S, Hoang T. SCL assembles a multifactorial complex that determines glycophorin A expression. Mol Cell Biol. 2004;24(4):1439–1452. doi: 10.1128/MCB.24.4.1439-1452.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kitamura T, et al. Efficient screening of retroviral cDNA expression libraries. Proc Natl Acad Sci USA. 1995;92(20):9146–9150. doi: 10.1073/pnas.92.20.9146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cadoret JC, et al. Genome-wide studies highlight indirect links between human replication origins and gene regulation. Proc Natl Acad Sci USA. 2008;105(41):15837–15842. doi: 10.1073/pnas.0805208105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hansen RS, et al. Sequencing newly replicated DNA reveals widespread plasticity in human replication timing. Proc Natl Acad Sci USA. 2010;107(1):139–144. doi: 10.1073/pnas.0912402107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ryba T, et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Res. 2010;20(6):761–770. doi: 10.1101/gr.099655.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Karnani N, Taylor CM, Malhotra A, Dutta A. Genomic study of replication initiation in human chromosomes reveals the influence of transcription regulation and chromatin structure on origin selection. Mol Biol Cell. 2010;21(3):393–404. doi: 10.1091/mbc.E09-08-0707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ryba T, et al. Abnormal developmental control of replication-timing domains in pediatric acute lymphoblastic leukemia. Genome Res. 2012;22(10):1833–1844. doi: 10.1101/gr.138511.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Takeda DY, Shibata Y, Parvin JD, Dutta A. Recruitment of ORC or CDC6 to DNA is sufficient to create an artificial origin of replication in mammalian cells. Genes Dev. 2005;19(23):2827–2836. doi: 10.1101/gad.1369805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Grondin B, et al. c-Jun homodimers can function as a context-specific coactivator. Mol Cell Biol. 2007;27(8):2919–2933. doi: 10.1128/MCB.00936-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pop R, et al. A key commitment step in erythropoiesis is synchronized with the cell cycle clock through mutual inhibition between PU.1 and S-phase progression. PLoS Biol. 2010;8(9):e1000484. doi: 10.1371/journal.pbio.1000484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Treanor LM, et al. Functional interactions between Lmo2, the Arf tumor suppressor, and Notch1 in murine T-cell malignancies. Blood. 2011;117(20):5453–5462. doi: 10.1182/blood-2010-09-309831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Nishiyama A, et al. Uhrf1-dependent H3K23 ubiquitylation couples maintenance DNA methylation and replication. Nature. 2013;502(7470):249–253. doi: 10.1038/nature12488. [DOI] [PubMed] [Google Scholar]
  • 48.Karmakar S, Mahajan MC, Schulz V, Boyapaty G, Weissman SM. A multiprotein complex necessary for both transcription and DNA replication at the β-globin locus. EMBO J. 2010;29(19):3260–3271. doi: 10.1038/emboj.2010.204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Girard F, Strausfeld U, Fernandez A, Lamb NJ. Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell. 1991;67(6):1169–1179. doi: 10.1016/0092-8674(91)90293-8. [DOI] [PubMed] [Google Scholar]
  • 50.Yu DS, et al. Cyclin-dependent kinase 9-cyclin K functions in the replication stress response. EMBO Rep. 2010;11(11):876–882. doi: 10.1038/embor.2010.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zhang J, Socolovsky M, Gross AW, Lodish HF. Role of Ras signaling in erythroid differentiation of mouse fetal liver cells: Functional analysis by a flow cytometry-based novel culture system. Blood. 2003;102(12):3938–3946. doi: 10.1182/blood-2003-05-1479. [DOI] [PubMed] [Google Scholar]
  • 52.Graf T, Enver T. Forcing cells to change lineages. Nature. 2009;462(7273):587–594. doi: 10.1038/nature08533. [DOI] [PubMed] [Google Scholar]
  • 53.Yui MA, Rothenberg EV. Developmental gene networks: A triathlon on the course to T cell identity. Nat Rev Immunol. 2014;14(8):529–545. doi: 10.1038/nri3702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Srinivasan SV, Dominguez-Sola D, Wang LC, Hyrien O, Gautier J. Cdc45 is a critical effector of myc-dependent DNA replication stress. Cell Reports. 2013;3(5):1629–1639. doi: 10.1016/j.celrep.2013.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Tremblay M, et al. Modeling T-cell acute lymphoblastic leukemia induced by the SCL and LMO1 oncogenes. Genes Dev. 2010;24(11):1093–1105. doi: 10.1101/gad.1897910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Weng AP, et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science. 2004;306(5694):269–271. doi: 10.1126/science.1102160. [DOI] [PubMed] [Google Scholar]
  • 57.Salsi V, et al. HOXD13 binds DNA replication origins to promote origin licensing and is inhibited by geminin. Mol Cell Biol. 2009;29(21):5775–5788. doi: 10.1128/MCB.00509-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mashtalir N, et al. Autodeubiquitination protects the tumor suppressor BAP1 from cytoplasmic sequestration mediated by the atypical ubiquitin ligase UBE2O. Mol Cell. 2014;54(3):392–406. doi: 10.1016/j.molcel.2014.03.002. [DOI] [PubMed] [Google Scholar]
  • 59.An X, et al. Global transcriptome analyses of human and murine terminal erythroid differentiation. Blood. 2014;123(22):3466–3477. doi: 10.1182/blood-2014-01-548305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Wong P, et al. Gene induction and repression during terminal erythropoiesis are mediated by distinct epigenetic changes. Blood. 2011;118(16):e128–e138. doi: 10.1182/blood-2011-03-341404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Demers C, et al. Activator-mediated recruitment of the MLL2 methyltransferase complex to the beta-globin locus. Mol Cell. 2007;27(4):573–584. doi: 10.1016/j.molcel.2007.06.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.DeVilbiss AW, et al. Epigenetic Determinants of Erythropoiesis: Role of the Histone Methyltransferase SetD8 in Promoting Erythroid Cell Maturation and Survival. Mol Cell Biol. 2015;35(12):2073–2087. doi: 10.1128/MCB.01422-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES