Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2016 Jan 25;6:19005. doi: 10.1038/srep19005

The Regulation of Exosporium-Related Genes in Bacillus thuringiensis

Qi Peng 1, Guiwei Kao 1, Ning Qu 1,2, Jie Zhang 1, Jie Li 2, Fuping Song 1,a
PMCID: PMC4750369  PMID: 26805020

Abstract

Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis (Bt) are spore-forming members of the Bacillus cereus group. Spores of B. cereus group species are encircled by exosporium, which is composed of an external hair-like nap and a paracrystalline basal layer. Despite the extensive studies on the structure of the exosporium-related proteins, little is known about the transcription and regulation of exosporium gene expression in the B. cereus group. Herein, we studied the regulation of several exosporium-related genes in Bt. A SigK consensus sequence is present upstream of genes encoding hair-like nap proteins (bclA and bclB), basal layer proteins (bxpA, bxpB, cotB, and exsY ), and inosine hydrolase (iunH). Mutation of sigK decreased the transcriptional activities of all these genes, indicating that the transcription of these genes is controlled by SigK. Furthermore, mutation of gerE decreased the transcriptional activities of bclB, bxpB, cotB, and iunH but increased the expression of bxpA, and GerE binds to the promoters of bclB, bxpB, cotB, bxpA, and iunH. These results suggest that GerE directly regulates the transcription of these genes, increasing the expression of bclB, bxpB, cotB, and iunH and decreasing that of bxpA. These findings provide insight into the exosporium assembly process at the transcriptional level.


Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis (Bt) are spore-forming members of the Bacillus cereus group1. These species vary in terms of host range and virulence2 and are mainly distinguished by the genes contained in their plasmids. Bt forms parasporal crystals during the stationary phase of growth; these crystals are toxic to a wide variety of insect larvae3, making Bt strains the most commonly used biological pesticide worldwide.

The genus Bacillus encompasses species capable of forming highly resistant dormant endospores as a response to harsh environmental conditions. Spores of the B. cereus group are complex, multilayered structures. The nucleoid-containing core is enclosed within a peptidoglycan cortex, which is surrounded by the spore coat4. Spores of all the B. cereus group species are encircled by an additional loose-fitting layer called the exosporium5, which is not present on other species such as Bacillus subtilis, for which the coat constitutes the outermost layer of the mature spore6. The exosporium is a balloon-like layer that acts as the outer permeability barrier of the spore and contributes to spore survival and virulence7. The exosporium also interacts with host cells during infection8.

Many characteristics of the exosporium have been previously elucidated. The exosporium is separated from the spore coat by a region known as the interspace and is the final layer of the spore to be assembled9,10,11,12. It is composed of an external hair-like nap and a paracrystalline basal layer and contains approximately 20 different proteins13,14,15, which are deposited around the spore in a progressive encasement process9,10,11. The assembly of the nap closely follows the progressive assembly of the basal layer9,11. The filaments of the nap are formed by trimers of the collagen-like glycoprotein BclA, which is involved in early interactions with the host surface16. BclA is attached to the underlying basal layer by its N-terminal domain9, which is followed by an extensively glycosylated collagen-like central region17 and a C-terminal globular β-jellyroll domain that promotes trimer formation16,18. A second collagen-like protein, BclB, is also present in the exosporium. BclB possesses an N-terminal sequence that targets it to the exosporium and is similar in sequence to a cognate-targeting region in BclA19. The attachment of nearly all BclA trimers requires the basal layer protein BxpB14, which has been implicated as a foundation upon which nap proteins are assembled. BclA and BxpB form high molecular mass complexes, which are stable under conditions that normally disrupt non-covalent interactions and disulfide bonds10,20. However, BclB lacks sequence similarity to the region of BclA thought to mediate attachment to the basal layer via covalent interactions with BxpB19. In addition, several proteins have been implicated in exosporium formation, including BxpA13, CotB15, CotY21, ExsA22, ExsB23, ExsK24, ExsFB11,20, ExsM25, and ExsY21,26,27. Enzymes associated with the exosporium, including alanine racemase27, inosine hydrolase15, and superoxide dismutase13, may be involved in preventing premature germination and providing protection against macrophages by detoxifying superoxide free radicals28,29.

Despite the extensive studies on the structure of the exosporium-related proteins, little is known about the transcription and regulation of exosporium gene expression in the B. cereus group. Herein, we demonstrate that the transcription of bclA, bclB, bxpA, bxpB, cotB, exsY, and iunH are controlled by RNA polymerase sigma factor SigK in Bt HD73. Furthermore, the expression of bclB, bxpA, bxpB, cotB, and iunH is directly regulated by GerE. gerE encodes the terminal transcription factor in the sporulation regulatory cascade in Bacillus subtilis. GerE is a small DNA-binding protein that is both an activator and a repressor in the mother cell that regulates the transcription of many genes involved in spore coat synthesis and assembly in the late stages of sporulation and germination30,31,32. GerE acts in conjunction with SigK-containing RNA polymerase to turn on the expression of the final class of sporulation genes. The appearance of GerE also switches off the expression of some genes that had been activated by SigK31.

Results

Transcriptional activity of hair-like nap protein genes

We identified 17 exosporium homologous genes with known functions in B. cereus and B. anthracis in Bt HD73 (Table 1) comprising genes encoding the hair-like nap proteins, basal layer proteins, and enzymes. A major component of the hair-like nap is the glycosylated collagen-like protein BclA. A second collagen-like protein, BclB, is also present in the exosporium19. In Bt HD73, HD73_1438 (bclA) and HD73_2664 (bclB) encode BclA and BclB and have 67.8% and 90.0% identity, respecively, to homologous genes in B. anthracis Sterne strain 770233 and B. cereus ATCC 1087634. To determine the transcription start site (TSS) of bclA and bclB, 5′-RACE analysis was performed as described in the Methods. The TSSs of bclA and bclB were confirmed to be a single 5′-end nucleotide residue C and G located 120 bp and 150 bp upstream of the start codon according to the sequences of 20 random clones, respectively (Figs 1A and 2A). Analysis of the bclA and bclB promoter sequences identified sequences CAC(-N16-)CATATGTTA and AGC(-N16-)CATATAATT upstream of the bclA and bclB TSS, respectively, which are similar to the consensus sequences recognized by SigK-containing RNA polymerase35, with the putative binding site centered at -10 and -35 nt with appropriate spacing (16 nt) between these consensus sequences (Figs 1A and 2A). SigK is a sigma factor that plays a role in the late stage of sporulation, and some SigK-dependent genes are negatively or positively regulated by GerE in the late stage of sporulation31. Thus, to study the transcription and regulation of the promoters PbclA and PbclB, PbclA-lacZ and PbclB-lacZ fusions were constructed and transformed into Bt wild-type strain HD73 and mutant strains, HD(ΔsigK) and HD(ΔgerE). The β-galactosidase assay showed that the transcriptional activity of PbclA was sharply decreased from T10 to T23 in HD(ΔsigK) (Fig. 1B). It was slightly increased from T10 to T18 in HD(ΔgerE), and with no significant difference from T18 to T23 compared with that of wild-type strain HD73 (Fig. 1B). However, the transcriptional activity of PbclB was sharply decreased from T9 to T23 both in HD(ΔsigK) and HD(ΔgerE) compared with that of HD73 (Fig. 2B). To determine whether GerE directly or indirectly regulates the PbclA and PbclB, GerE-GST protein was expressed in E. coli and purified. The ability of GerE to bind to a DNA fragment containing the PbclA (267 bp) and PbclB (276 bp) promoters was examined by EMSA. FAM-labeled fragments containing the promoter regions of bclB were incubated with different amounts of GerE and assayed for the formation of protein-DNA complexes. Slower-migrating probe-protein complexes were observed upon incubation with increasing amounts of GerE (Fig. 2C). It indicated that GerE recognizes and specifically binds to sequences within the bclB promoter fragment. To precisely determine the GerE-binding site in the bclB promoter, DNase I footprinting assays were carried out using the same bclB promoter fragment used in the EMSA (Fig. 2D). A 23-bp fragment corresponding to the boxed sequence in the bclB promoter region (Fig. 2A) was protected by GerE binding. In sharp contrast, GerE did not bind to labeled bclA promoter (Additional file 1). This may result from the lack of direct binding, from a purified GerE protein partially defective in binding or from unfavorable in vitro binding conditions. These results indicated that transcription of PbclA and PbclB are controlled by SigK in the late stage of sporulation and that PbclB is directly activated by GerE, while PbclA is negatively regulated by GerE.

Table 1. Exosporium homologous genes in Bt HD73.

Gene ID Gene name Source of homologous gene Identity Structure Ref.
HD73_1438 bclA B. anthracis Sterne strain 7702 67.8% Hairy nap 33
HD73_2664 bclB B. cereus ATCC 10876 90.0% unknown 34,60
HD73_2410 bxpA B. anthracis 75.4% Basal layer 13
HD73_1452 bxpB B. anthracis Ames 97.0% Basal layer 15
HD73_0469 cotB B. anthracis Ames 76.9% Basal layer 15
HD73_1453 cotY B. cereus ATCC 10876 92.9% Basal layer 21
HD73_2208 exsB B. anthracis Sterne 92.0% Basal layer 23
HD73_1449 exsY B. cereus ATCC 10876 87.0% Basal layer 21
HD73_3089 iunH B. anthracis Ames 93.1% Enzyme 15
HD73_4056 cotE B. cereus ATCC 10876 100% Basal layer 34
HD73_4735 exsA B. cereus ATCC 10876 89.4% Basal layer 22
HD73_3082 exsC B. cereus ATCC 10876 93.8% Basal layer 34
HD73_1094 exsD B. cereus ATCC 10876 46.2% Basal layer 34
HD73_1970 exsE B. cereus ATCC 10876 99.6% Basal layer 34
HD73_2393 exsG B. cereus ATCC 10876 100% Basal layer 34
HD73_3464 exsK B. anthracis Ames 64.4% Basal layer 24
HD73_5608 exsM B. cereus ATCC 14579 100% Basal layer 25

Figure 1. Nucleotide sequence and transcriptional activity of the bclA promoter.

Figure 1

(A) Nucleotide sequence analysis. The indicated promoter region, 409 bp upstream and 104 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 120 bp upstream from the start codon of the bclA gene. The SigK consensus sequence is indicated with a gray box, and the putative -35 and -10 sequences are underlined. (B) β-galactosidase activity assay of PbclA in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation.

Figure 2. Nucleotide sequence and transcriptional activity of the bclB promoter.

Figure 2

(A) Nucleotide sequence analysis. The indicated promoter region, 487 bp upstream and 91 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 150 bp upstream from the start codon of the bclB gene. The SigK consensus sequence is indicated, and the putative -35 and -10 sequences are underlined with a gray box. The GerE binding site is boxed. (B) β-galactosidase activity assay of PbclB in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation. (C) Electrophoresis mobility shift assay of the bclB promoter fragment (276 bp) after incubation with GerE. Lane 1, FAM-labeled PbclB probe incubated with GST protein; lane 2, FAM-labeled PbclB probe; lanes 3–10, incubation of the probe with increasing concentrations of purified GerE indicated at the top of the figure. (D) Protection of a 23-bp sequence in the bclB promoter by GerE, as revealed by DNase I footprinting protection assay. The fluorograms correspond to the DNA in the protection reactions (with 0 and 11.6 μg GerE).

Transcriptional activity of basal layer protein genes

We studied the transcription and regulation of four basal layer protein genes bxpA (HD73_2410), bxpB (HD73_1452), cotB (HD73_0469), and exsY (HD73_1449). These genes have 75.4%, 97.0%, 76.9%, and 87.0% identity, respectively, to homologous genes in B. anthracis or B. cereus (Table 1). The TSSs of bxpA, bxpB, cotB, and exsY were confirmed to be a single 5′-end nucleotide residue A, A, G, and G located 26 bp, 24 bp, 33 bp and 33 bp upstream of the start codon according to the sequences of 20 random clones, respectively (Figs 3A, 4A, 5A and 6A). Bioinformatics analysis predicted strong SigK-like consensus binding sequences upstream of the respective start codons of all four genes (Figs 3A, 4A, 5A and 6A). The β-galactosidase assay showed that the transcriptional activities of PbxpB and PcotB were abolished in HD(ΔsigK) and decreased in HD(ΔgerE) compared with those of wild-type strain HD73 (Figs 3B and 4B). The transcriptional activity of PbxpA was also abolished in HD(ΔsigK), whereas it was increased in HD(ΔgerE) compared with HD73 (Fig. 5B). EMSA showed that GerE could bind to the promoters of bxpB, cotB, and bxpA (Figs 3C, 4C and 5C). To precisely determine the GerE-binding site in the bxpB, cotB, and bxpA promoters, DNase I footprinting assays were carried out using the same promoter fragments used in the EMSA. A 37-bp, 23-bp and 31-bp fragments located on bxpB, cotB, and bxpA promoters were protected by GerE binding (Figs 3D, 4D and 5D) (corresponding to the boxed sequence in the bxpB, cotB, and bxpA regions shown in Figs 3A, 4A and 5A). The transcriptional activity of PexsY was sharply decreased in HD(ΔsigK) but showed no significant difference in HD(ΔgerE) (Fig.6B). These results indicated that transcription of PbxpA, PbxpB, PcotB, and PexsY is controlled by SigK in the late stage of sporulation and that PbxpA, PbxpB, and PcotB are directly regulated by GerE.

Figure 3. Nucleotide sequence and transcriptional activity of the bxpB promoter.

Figure 3

(A) Nucleotide sequence analysis. The indicated promoter region, 425 bp upstream and 153 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 24 bp upstream from the start codon of the bxpB gene. The SigK consensus sequence is indicated, and the putative −35 and −10 sequences are underlined with a gray box. The GerE binding site is boxed. (B) β-galactosidase activity assay of PbxpB in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation. (C) Electrophoresis mobility shift assay of the bxpB promoter fragment (278 bp) after incubation with GerE. Lane 1, FAM-labeled PbxpB probe incubated with GST protein; lane 2, FAM-labeled PbxpB probe; lanes 3–10, incubation of the probe with increasing concentrations of purified GerE indicated at the top of the figure. (D) Protection of a 37-bp sequence in the bxpB promoter by GerE, as revealed by DNase I footprinting protection assay. The fluorograms correspond to the DNA in the protection reactions (with 2.9 and 5.8 μg GerE).

Figure 4. Nucleotide sequence and transcriptional activity of the cotB promoter.

Figure 4

(A) Nucleotide sequence analysis. The indicated promoter region, 388 bp upstream and 153 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 33 bp upstream from the start codon of the cotB gene. The SigK consensus sequence is indicated, and the putative −35 and −10 sequences are underlined with a gray box. The GerE binding site is boxed. (B) β-galactosidase activity assay of PcotB in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation. (C) Electrophoresis mobility shift assay of the cotB promoter fragment (355 bp) after incubation with GerE. Lane 1, FAM-labeled PcotB probe incubated with GST protein; lane 2, FAM-labeled PcotB probe; lanes 3–10, incubation of the probe with increasing concentrations of purified GerE indicated at the top of the figure. (D) Protection of a 33-bp sequence in the cotB promoter by GerE, as revealed by DNase I footprinting protection assay. The fluorograms correspond to the DNA in the protection reactions (with 0 and 5.8 μg GerE).

Figure 5. Nucleotide sequence and transcriptional activity of the bxpA promoter.

Figure 5

(A) Nucleotide sequence analysis. The indicated promoter region, 415 bp upstream and 153 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 26 bp upstream from the start codon of the bxpA gene. The SigK consensus sequence is indicated, and the putative −35 and −10 sequences are underlined with a gray box. The GerE binding site is boxed. (B) β-galactosidase activity assay of PbxpA in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation. (C) Electrophoresis mobility shift assay of the bxpA promoter fragment (569 bp) after incubation with GerE. Lane 1, FAM-labeled PbxpA probe incubated with GST protein; lane 2, FAM-labeled PbxpA probe; lanes 3–10, incubation of the probe with increasing concentrations of purified GerE indicated at the top of the figure. (D) Protection of a 31-bp sequence in the bxpA promoter by GerE, as revealed by DNase I footprinting protection assay. The fluorograms correspond to the DNA in the protection reactions (with 0 and 0.5 μg GerE).

Figure 6. Nucleotide sequence and transcriptional activity of the exsY promoter.

Figure 6

(A) Nucleotide sequence analysis. The indicated promoter region, 410 bp upstream and 163 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 33 bp upstream from the start codon of the exsY gene. The SigK consensus sequence is indicated with a gray box, and the putative −35 and −10 sequences are underlined. (B) β-galactosidase activity assay of PexsY in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation.

Transcriptional activity of the inosine hydrolase gene

Inosine hydrolase is encoded by iunH (HD73_3089) in Bt HD73, which has 93.1% identity to the homologous gene bas2693 in the B. anthracis Ames strain15. According to the sequences of 20 random clones, the TSSs of iunH was confirmed to be a single 5′-end nucleotide residue G residue located 10 bp upstream of the start codon (Fig. 7A). SigK consensus binding site was present upstream of iunH (Fig. 7A). The β-galactosidase assay showed that the transcriptional activity of PiunH was abolished from T8 to T22 in HD(ΔsigK) and lower in HD(ΔgerE) than in HD73 (Fig. 7B). EMSA showed that GerE could bind to the iunH promoter (Fig. 7C) and DNase I footprinting assays showed that a 15-bp fragment was protected by GerE binding (Fig. 7D) (corresponding to the boxed sequence in the iunH region shown in Fig. 7A), together suggesting that transcription of iunH is controlled by SigK and is directly regulated by GerE.

Figure 7. Analysis of PiunH transcription.

Figure 7

(A) Nucleotide sequence analysis. The indicated promoter region, 465 bp upstream and 124 bp downstream of the start codon (double-underlined), was fused with lacZ. Transcriptional start site (TSS, indicated by asterisks) is located 10 bp upstream from the start codon of the iunH gene. The SigK consensus sequence is indicated, and the putative −35 and −10 sequences are underlined with a gray box. The GerE binding site is boxed. (B) β-galactosidase activity assay of PiunH in wild-type HD73 (▲), sigK mutant (◼), and gerE mutant (●). T0 is the end of the exponential phase, and Tn is n hours after T0. Values represent mean of at least three independent replicates; error bars represent standard deviation. (C) Electrophoresis mobility shift assay of the iunH promoter fragment (590 bp) after interaction with GerE. Lane 1, FAM-labeled PiunH probe incubated with GST protein; lane 2, FAM-labeled PiunH probe; lanes 3–10, incubation of the probe with increasing concentrations of purified GerE indicated at the top of the figure. (D) Protection of a 15-bp sequence in the iunH promoter by GerE, as revealed by DNase I footprinting protection assay. The fluorograms correspond to the DNA in the protection reactions (with 0 and 1 μg GerE).

Discussion

In a B. subtilis mother cell, a regulatory network with a cascade of four transcription factors (SigE, SpoIIID, SigK, and GerE) controls gene expression in the mother cell during sporulation36. SigE and SigK are sigma subunits of RNA polymerase. SpoIIID and GerE, two small DNA-binding proteins, repress or activate transcription of many mother cell genes31,37. SigK directs the expression of most genes encoding coat structural components and factors required for spore germination, and mother-cell lysis38. The decisive role of SigK in spore coat assembly is evidenced by the large number of genes encoding coat structural components found in the SigK regulon4,38. Unlike the coat that constitutes the outermost layer of the mature B. subtilis spore6, the B. cereus group species are encircled by the exosporium5. Little is known about the transcription and regulation of the expression of exosporium genes in the B. cereus group. Indeed, only exsB is known to undergo SigK-mediated transcription and is positively regulated by GerE, as shown in our pervious study39. In this study, we first confirmed that the transcription of exosporium-related genes bclA, bclB, bxpA, bxpB, cotB, exsY, and iunH are controlled by SigK using a β-galactosidase assay. The SigK consensus sequence is located upstream of these and ten other exosporium-related genes in Bt and is predicted to be present in most B. cereus group strains (Additional file 2). This finding suggested that the transcription mechanisms of exosporium genes are similar throughout the B. cereus group.

In the B. subtilis cascade, the synthesis of each factor depends upon the activity of the prior factor, and there is a feedback loop in which SigK RNAP transcribes gerE, which then negatively regulates transcription of the sigK gene31,40. Some SigK-dependent genes such as oxalate decarboxylase encoded gene oxdD41 and the germination gene gerT 30 are negatively regulated by GerE. In contrast, other SigK-dependent genes encoding spore coat proteins such as cotB31, cotC31, yxeE42, and yeeK43 are positively regulated by GerE in B. subtilis. We observed similar effects under the current conditions. The transcription of bclA and bxpA is negatively regulated by GerE, which could bind to the promoter of bxpA. Furthermore, the transcription of bclB, bxpB, cotB, and iunH is positively regulated by GerE, and their promoters could bind to GerE.

The collagen-like glycoproteins BclA and BclB require BxpB to assemble the hair-like nap of exosporium, and the assembly timing of the three proteins is similar19. Based on transcriptional level, we demonstrated that transcription of these three genes occurs nearly at the same stage (T10). BxpA is located below the spore coat associated with the cortex and is synthesized during sporulation and assembled into the spore before mother cell lysis, but it is not found in vegetative cells in B. anthracis Ames44. Furthermore, the SigK consensus sequence is found upstream of bxpA13. We provide new evidence that transcription of bxpA initiates at T8 and is abolished in the sigK mutant. ExsY is a homologue of B. subtilis cysteine-rich spore coat proteins CotY and CotZ45, that participates in assembly of an intact exosporium21. The time of synthesis of ExsY protein in the sporulation phase was detected by western-blot21. We confirmed that transcription of exsY begins at T7 under the control of SigK and is similar to the transcriptional mechanism of cotYZ in B. subtilis46. CotB is similar to ExsY in B. anthracis47 and has 30% amino acid identity to B. subtilis spore coat protein CotB48. We confirmed that the transcription of cotB begins at T10 under the control of SigK, and is regulated by GerE in Bt. The manner of transcription and regulation is similar between Bt and B. subtilis31,36. The transcriptional pattern of bclA, bxpB, cotB, bxpA, exsY, and iunH in wild-type HD73 is very similar, increasing from T8 to T17 and decreasing thereafter, suggesting that these proteins are assembled into the basal layer and hair-like nap simultaneously and are nearly complete at T17. However, the transcription of bclB is significantly higher than that of blcA after T17 with continuous transcriptional activity from T8 to T23. These transcriptional data are differ to previous reports, which have suggested that bclB and bclA are transcribed at an identical stage in sporulation, but with bclB transcribed at an approximately two-fold lower level9,49. The present data provide evidence that transcription of some exosporium genes is controlled by SigK and partially regulated by GerE. These findings provide insight into the exosporium assembly process at the transcriptional level.

Methods

Bacterial strains, plasmids, and growth conditions

The bacterial strains and plasmids used in this study are listed in Table 2. Bt strain HD73 was used throughout the study (accession numbers CP004069)50. Escherichia coli strain TG1 was used as the host for cloning experiments. The Dam-/Dcm- E. coli ET12567 strain (laboratory stock) was used to generate unmethylated DNA for the electrotransformation assay. Bt strains were transformed by electroporation, as described previously51,52. E. coli and Bt strains were cultured in Luria-Bertani (LB) medium, with 220 rpm shaking at 37 °C and 30 °C, respectively. The antibiotic concentrations used for bacterial selection were as follows: 100 μg/ml kanamycin and 10 μg/ml erythromycin for Bt, and 100 μg/ml ampicillin for E. coli.

Table 2. Strains and plasmids.

Strain or plasmid Relevant genotype and characteristicsa Reference or source
Strains
HD73 Bt subsp. Kurstaki carrying the cry1Ac gene Laboratory collection
HD(ΔsigK) Bt HD73 sigK gene mutant; KanR 54
HD(ΔgerE) Bt HD73 gerE gene mutant 54
HD(PbxpA) Bt HD73 carrying pHT-PbxpA plasmid; EmR This study
HD(PbxpB) Bt HD73 carrying pHT-PbxpB plasmid; EmR This study
HD(PbclA) Bt HD73 carrying pHT-PbclA plasmid; EmR This study
HD(PbclB) Bt HD73 carrying pHT-PbclB plasmid; EmR This study
HD(PcotB) Bt HD73 carrying pHT-PcotB plasmid; EmR This study
HD(PexsY) Bt HD73 carrying pHT-PexsY plasmid; EmR This study
HD(PiunH) Bt HD73 carrying pHT-PiunH plasmid; EmR This study
ΔsigK(PbxpA) HD(ΔsigK) carrying pHT-PbxpA plasmid; EmR This study
ΔsigK (PbxpB) HD(ΔsigK) carrying pHT-PbxpB plasmid; EmR This study
ΔsigK (PbclA) HD(ΔsigK) carrying pHT-PbclA plasmid; EmR This study
ΔsigK (PbclB) HD(ΔsigK) carrying pHT-PbclB plasmid; EmR This study
ΔsigK (PcotB) HD(ΔsigK) carrying pHT-PcotB plasmid; EmR This study
ΔsigK (PexsY) HD(ΔsigK) carrying pHT-PexsY plasmid; EmR This study
ΔsigK (PiunH) HD(ΔsigK) carrying pHT-PiunH plasmid; EmR This study
ΔgerE(PbxpA) HD(ΔgerE) carrying pHT-PbxpA plasmid; EmR This study
ΔgerE (PbxpB) HD(ΔgerE) carrying pHT-PbxpB plasmid; EmR This study
ΔgerE (PbclA) HD(ΔgerE) carrying pHT-PbclA plasmid; EmR This study
ΔgerE (PbclB) HD(ΔgerE) carrying pHT-PbclB plasmid; EmR This study
ΔgerE (PcotB) HD(ΔgerE) carrying pHT-PcotB plasmid; EmR This study
ΔgerE (PexsY) HD(ΔgerE) carrying pHT-PexsY plasmid; EmR This study
ΔgerE (PiunH) HD(ΔgerE) carrying pHT-PiunH plasmid; EmR This study
E. coli TG1 Δ(lac-proAB) supE thi hsd-5 (F’ traD36 proA+ proB+ lacIq lacZΔM15), general purpose cloning host Laboratory collection
E. coli ET12567 F- dam-13::Tn9 dcm-6 hsdM hsdR recF143 zjj-202::Tn10 galK2 galT22 ara14 pacY1 xyl-5 leuB6 thi-1, for generation of unmethylated DNA Laboratory collection
BL (pGEXgerE) BL21(DE3) with pGEXgerE plasmid 54
Plasmids
pHT304-18Z Promoterless lacZ vector, EmR, ApR Laboratory collection
pHT-PbxpA pHT304-18Z carrying promoter upstream from bxpA This study
pHT-PbxpB pHT304-18Z carrying promoter upstream from bxpB This study
pHT-PbclA pHT304-18Z carrying promoter upstream from bclA This study
pHT-PbclB pHT304-18Z carrying promoter upstream from bclB This study
pHT-PcotB pHT304-18Z carrying promoter upstream from cotB This study
pHT-PexsY pHT304-18Z carrying promoter upstream from exsY This study
pHT-PiunH pHT304-18Z carrying promoter upstream from iunH This study

DNA manipulation techniques

PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). Amplified fragments were purified using purification kits (Axygen, Union City, CA, USA). Bt chromosomal DNA was extracted with the Puregene kit (Gentra, Minneapolis, MN, USA). Restriction enzymes and T4 DNA ligase (TaKaRa Biotechnology, Dalian, China) were used according to the manufacturer’s instructions. Oligonucleotide primers (Table 3) were synthesized by Sangon (Shanghai, China). E. coli plasmid DNA was extracted using the Axygen Plasmid Extraction Kit. All constructs were confirmed by DNA sequencing (BGI, Beijing, China).

Table 3. Primers sequences.

oligonucleotides sequence (5′-3′)a
PbxpA-F AACTGCAGATAAGACATATTGGCGATGA
PbxpA-R CGGGATCCTTTCTTGATTTTGCGTTG
PbxpB-F AACTGCAGGCATTTGCACCATCTTCA
PbxpB-R CGGGATCCTTGGGTTTGGACTTACGC
PbclA-F AACTGCAGCTCCTTGCGTCGCTTTTGA
PbclA-R CGGGATCCCGGTGGTATCGGTGGTAA
PbclB-F AACTGCAGATGGTTGAATGATAGGCA
PbclB-R CGGGATCCATCGGAACTGTTTGTGGA
PcotB-F AACTGCAGAAAATTCGTGCGCTATTC
PcotB-R CGGGATCCCTGCTTTACAATCTTTCG
PexsY-F CCCAAGCTTCGGTTCCGCAACGATAGG
PexsY-R AACTGCAGGGGCGTGTATTTGCTACTGAT
PiunH-F AACTGCAGGATGAAAGCACCAAACGA
PiunH-R CGGGATCCTTCCCATACTCAGCAACAAT
PbxpB-a AAGACTAATATCAACCTCCAC
PbxpB-b GTAAATTCGCAATCAGAAGA
PbxpA-a ATCCACTTTACCGCCATG
PbxpA-b TTGATTTTGCGTTGTTGC
PbclB-a TGTTAATCGTAAATTCGG
PbclB-b ATTGCAGTGGTTATGACC
PcotB-a AAGACGAAGATTAAACTATG
PcotB-b AACTCACGAGAAAACCC
PiunH-a GATGAAAGCACCAAACGA
PiunH-b TTCCCATACTCAGCAACAAT
bxpARACE GCGTTGTTGCATATGGG
bxpBRACE TTGGGTTTGGACTTACGCTAG
bclARACE CGGTGGTATCGGTGGTAATG
bclBRACE ATCGGAACTGTTTGTGGATTG
cotBRACE CTTCAACTTTCTCTGGGCCA CCACGA
exsYRACE CGGCAGCTAGTAAGGCTTGAAGATGGTG
iunHRACE CCGTAACGATATCTCGTG
UPM AAGCAGTGGTATCAACGCAGAGTACATGGG

aRestriction enzyme sites are underscored.

Total RNA isolation and 5′-RACE analysis

For total RNA purification, strain HD73 was grown as previously described in SSM medium until the T14 stage of stationary phase (corresponding to 14 h after the end of the exponential phase)53. cDNA synthesis and transcriptional start sites (TSSs) of the exosporium genes were determined using the SMARTerTM RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions. Gene-specific primers and the universal primer mix (UPM) (Table 3) were used to amplify the 5′ end of exosporium genes mRNA.

Expression and purification of GerE

GerE protein with a glutathione S-transferase (GST) tag was purified from E. coli54. The E. coli BL21(DE3) strain carrying pGEXgerE plasmid was incubated in LB medium. When the optical density at 600 nm (OD600) reached 0.6, IPTG was added to a final concentration of 1 mM. After 4 h of induction at 37 °C, the bacterial cells were harvested by centrifuging the culture at 13,000 × g for 10 min. The pellet was resuspended in phosphate-buffered saline (PBS) and sonicated on ice. All subsequent procedures were carried out at 4 °C. The supernatant was collected by centrifuging the lysate at 13,000 × g for 20 min and loading it onto a glutathione-Sepharose 4B column previously equilibrated with PBS buffer. The column was washed with 50 mM Tris-HCl containing 10 mM reduced glutathione (pH 8.0). The fractions were analyzed by SDS-PAGE. Fractions with the target protein were pooled and dialyzed against PBS buffer. The purified GST-GerE protein was analyzed by SDS-PAGE on a 12% polyacrylamide gel with a protein molecular standard. All the steps described above were performed according to the manufacturer’s instructions (Amersham Pharmacia Biotech, Little Chalfont, Bucks, UK).

Gel mobility shift assays

The DNA fragment was obtained by PCR of strain HD73 genomic DNA using specific primers (Table 3) labeled with a fluorescent 5′-end 6-FAM modification and confirmed by DNA sequencing. Electrophoresis mobility shift assays (EMSA) were performed as previously described55 to analyze the binding of purified GerE protein to the promoter of exosporium genes. Briefly, the DNA probe (0.1 μg) was incubated with different concentrations of purified GerE at 25 °C for 20 min in binding buffer [10 mM Tris-HCl, 0.5 mM dithiothreitol (DTT), 50 mM NaCl, 500 ng poly(dI:dC), pH 7.5, and 4% (v/v) glycerol] in a total volume of 20 μl. The DNA-protein mixtures were applied to non-denaturing 5% (w/v) polyacrylamide gels in TBE buffer (90 mM Tris-base, 90 mM boric acid, 2 mM EDTA, pH 8.0) for resolution of the complexes using a Mini-PROTEAN system (Bio-Rad) at 160 V for 1 h. Signals were visualized directly from the gel with the FLA Imager FLA-5100 (Fujifilm). The specificity of the shift was confirmed using poly(dI:dC), GST protein, and bovine serum albumin (BSA); the cry1Ac promoter (which does not bind to GerE protein; data not shown) was used as the negative control.

DNase I footprinting assays

DNase I footprinting assays were performed based on a fluorescence labeling procedure56. Briefly, the promoters DNA of exosporium genes were PCR-amplified using the fluorescently labeled primers and purified from an agarose gel. The labeled DNA probe (400 ng) was incubated for 30 min at 25 °C with the different amounts of GerE in a total volume of 40 μl binding buffer (described above for EMSA). DNase I digestion was then performed for 1 min at 25 °C and stopped with stop buffer (Promega). After phenol-chloroform extraction and ethanol precipitation, the samples were loaded on an Applied Biosystems 3730 DNA genetic analyzer with an internal-lane size standard (ROX-500, Applied Biosystems). A dye primer-based sequencing kit (Thermo) was used to precisely determine the sequences after their alignment wtih capillary electrophoresis results. Electropherograms were analyzed with GeneMarker v1.8 (Applied Biosystems).

Construction of the promoters of exosporium genes with lacZ gene fusion

The promoters of exosporium genes were amplified from Bt HD73 genomic DNA using specific primers. Promoter restriction fragments were then ligated into the pHT304-18Z vector containing a promoterless lacZ gene57. Recombinant pHT-Pn (where n indicates the name of exosporium genes) was introduced into Bt HD73, ΔsigK and ΔgerE mutant strains. The resultant strains, HD73(Pn), ΔsigK(Pn), and ΔgerE(Pn), were selected by resistance to erythromycin and tested by PCR to confirm the presence of the promoter fragments in the plasmids.

β-Galactosidase assays

Bt strains containing lacZ transcriptional fusions were cultured in Schaeffer’s sporulation medium (SSM)58 at 30 °C and 220 rpm. A 2-ml volume was collected at 1-h intervals from T8 to T22 (T0 is the end of the exponential phase, and Tn is n hours after T0), from which cells were harvested by centrifugation for 1 min at 10,000 × g. The supernatant was removed, and the pellet was stored at −20 °C or resuspended in 500 μl Buffer Z (0.06 M Na2HPO4, 0.04 M NaH2PO4, 0.01 M KCl, 1 mM MgSO4) with 1 mM dithiothreitol. The β-galactosidase activity was determined as previously described59 and expressed as Miller units. Reported values represent averages from at least three independent assays.

Additional Information

How to cite this article: Peng, Q. et al. The Regulation of Exosporium-Related Genes in Bacillus thuringiensis. Sci. Rep. 6, 19005; doi: 10.1038/srep19005 (2016).

Supplementary Material

Supplementary Information
srep19005-s1.pdf (1MB, pdf)

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (No. 31270111 and 31300085) and the National High Technology Research and Development Program of China (863 Program; 2011AA10A203). We thank Dr. Didier Lereclus from the Institut National de la Recherche Agronomique for his critical suggestions.

Footnotes

Author Contributions F.S. and Q.P. designed the research. G.K. and N.Q. performed the experimental work. Q.P. drafted the manuscript. F.S., J.Z. and J.L. critically revised the manuscript for intellectual content. All authors read and approved the final version of the manuscript.

References

  1. Helgason E. et al. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis–one species on the basis of genetic evidence. Applied and environmental microbiology 66, 2627–2630 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Han C. S. et al. Pathogenomic sequence analysis of Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus anthracis. Journal of bacteriology 188, 3382–3390, 10.1128/JB.188.9.3382-3390.2006 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Schnepf E. et al. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62, 775–806 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Henriques A. O. & Moran C. P. Jr. Structure, assembly, and function of the spore surface layers. Annual review of microbiology 61, 555–588, 10.1146/annurev.micro.61.080706.093224 (2007). [DOI] [PubMed] [Google Scholar]
  5. Beaman T. C., Pankratz H. S. & Gerhardt P. Ultrastructure of the exosporium and underlying inclusions in spores of Bacillus megaterium strains. Journal of bacteriology 109, 1198–1209 (1972). [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. McKenney P. T., Driks A. & Eichenberger P. The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nature reviews. Microbiology 11, 33–44, 10.1038/nrmicro2921 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Rodenburg C. M., McPherson S. A., Turnbough C. L. Jr. & Dokland T. Cryo-EM analysis of the organization of BclA and BxpB in the Bacillus anthracis exosporium. Journal of structural biology 186, 181–187, 10.1016/j.jsb.2014.02.018 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Oliva C., Turnbough C. L. Jr. & Kearney J. F. CD14-Mac-1 interactions in Bacillus anthracis spore internalization by macrophages. Proceedings of the National Academy of Sciences of the United States of America 106, 13957–13962, 10.1073/pnas.0902392106 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Thompson B. M. & Stewart G. C. Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface. Molecular microbiology 70, 421–434, 10.1111/j.1365-2958.2008.06420.x (2008). [DOI] [PubMed] [Google Scholar]
  10. Tan L. & Turnbough C. L. Jr. Sequence motifs and proteolytic cleavage of the collagen-like glycoprotein BclA required for its attachment to the exosporium of Bacillus anthracis. Journal of bacteriology 192, 1259–1268, 10.1128/JB.01003-09 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Thompson B. M., Hsieh H. Y., Spreng K. A. & Stewart G. C. The co-dependence of BxpB/ExsFA and BclA for proper incorporation into the exosporium of Bacillus anthracis. Molecular microbiology 79, 799–813, 10.1111/j.1365-2958.2010.07488.x (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Giorno R. et al. Localization and assembly of proteins comprising the outer structures of the Bacillus anthracis spore. Microbiology 155, 1133–1145, 10.1099/mic.0.023333-0 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Steichen C., Chen P., Kearney J. F. & Turnbough C. L. Jr. Identification of the immunodominant protein and other proteins of the Bacillus anthracis exosporium. Journal of bacteriology 185, 1903–1910 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Steichen C. T., Kearney J. F. & Turnbough C. L. Jr. Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. Journal of bacteriology 187, 5868–5876, 10.1128/JB.187.17.5868-5876.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Redmond C., Baillie L. W., Hibbs S., Moir A. J. & Moir A. Identification of proteins in the exosporium of Bacillus anthracis. Microbiology 150, 355–363 (2004). [DOI] [PubMed] [Google Scholar]
  16. Boydston J. A., Chen P., Steichen C. T. & Turnbough C. L. Jr. Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. Journal of bacteriology 187, 5310–5317, 10.1128/JB.187.15.5310-5317.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Daubenspeck J. M. et al. Novel oligosaccharide side chains of the collagen-like region of BclA, the major glycoprotein of the Bacillus anthracis exosporium. The Journal of biological chemistry 279, 30945–30953, 10.1074/jbc.M401613200 (2004). [DOI] [PubMed] [Google Scholar]
  18. Liu C. Q. et al. Construction, crystal structure and application of a recombinant protein that lacks the collagen-like region of BclA from Bacillus anthracis spores. Biotechnology and bioengineering 99, 774–782, 10.1002/bit.21637 (2008). [DOI] [PubMed] [Google Scholar]
  19. Thompson B. M., Hoelscher B. C., Driks A. & Stewart G. C. Assembly of the BclB glycoprotein into the exosporium and evidence for its role in the formation of the exosporium ‘cap’ structure in Bacillus anthracis. Molecular microbiology 86, 1073–1084, 10.1111/mmi.12042 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Sylvestre P., Couture-Tosi E. & Mock M. Contribution of ExsFA and ExsFB proteins to the localization of BclA on the spore surface and to the stability of the bacillus anthracis exosporium. Journal of bacteriology 187, 5122–5128, 10.1128/JB.187.15.5122-5128.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Johnson M. J. et al. ExsY and CotY are required for the correct assembly of the exosporium and spore coat of Bacillus cereus. Journal of bacteriology 188, 7905–7913, 10.1128/JB.00997-06 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Bailey-Smith K., Todd S. J., Southworth T. W., Proctor J. & Moir A. The ExsA protein of Bacillus cereus is required for assembly of coat and exosporium onto the spore surface. Journal of bacteriology 187, 3800–3806, 10.1128/JB.187.11.3800-3806.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McPherson S. A., Li M., Kearney J. F. & Turnbough C. L. Jr. ExsB, an unusually highly phosphorylated protein required for the stable attachment of the exosporium of Bacillus anthracis. Molecular microbiology 76, 1527–1538, 10.1111/j.1365-2958.2010.07182.x (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Severson K. M. et al. Roles of the Bacillus anthracis spore protein ExsK in exosporium maturation and germination. Journal of bacteriology 191, 7587–7596, 10.1128/JB.01110-09 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Fazzini M. M., Schuch R. & Fischetti V. A. A novel spore protein, ExsM, regulates formation of the exosporium in Bacillus cereus and Bacillus anthracis and affects spore size and shape. Journal of bacteriology 192, 4012–4021, 10.1128/JB.00197-10 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Boydston J. A., Yue L., Kearney J. F. & Turnbough C. L. Jr. The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. Journal of bacteriology 188, 7440–7448, 10.1128/JB.00639-06 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Steichen C. T., Kearney J. F. & Turnbough C. L. Jr. Non-uniform assembly of the Bacillus anthracis exosporium and a bottle cap model for spore germination and outgrowth. Molecular microbiology 64, 359–367, 10.1111/j.1365-2958.2007.05658.x (2007). [DOI] [PubMed] [Google Scholar]
  28. Weaver J. et al. Protective role of Bacillus anthracis exosporium in macrophage-mediated killing by nitric oxide. Infection and immunity 75, 3894–3901, 10.1128/IAI.00283-07 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Cybulski R. J. Jr. et al. Four superoxide dismutases contribute to Bacillus anthracis virulence and provide spores with redundant protection from oxidative stress. Infection and immunity 77, 274–285, 10.1128/IAI.00515-08 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ferguson C. C., Camp A. H. & Losick R. gerT, a newly discovered germination gene under the control of the sporulation transcription factor sigmaK in Bacillus subtilis. Journal of bacteriology 189, 7681–7689, 10.1128/JB.01053-07 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Zheng L. et al. Sporulation regulatory protein GerE from Bacillus subtilis binds to and can activate or repress transcription from promoters for mother-cell-specific genes. J Mol Biol 226, 1037–1050, 10.1016/0022-2836(92)91051-P (1992). [DOI] [PubMed] [Google Scholar]
  32. Eichenberger P. et al. The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PLoS biology 2, e328, 10.1371/journal.pbio.0020328 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sylvestre P., Couture-Tosi E. & Mock M. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Molecular microbiology 45, 169–178 (2002). [DOI] [PubMed] [Google Scholar]
  34. Todd S. J., Moir A. J., Johnson M. J. & Moir A. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. Journal of bacteriology 185, 3373–3378 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Haldenwang W. G. The sigma factors of Bacillus subtilis. Microbiological reviews 59, 1–30 (1995). [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zheng L. B. & Losick R. Cascade regulation of spore coat gene expression in Bacillus subtilis. Journal of molecular biology 212, 645–660 (1990). [DOI] [PubMed] [Google Scholar]
  37. Halberg R. & Kroos L. Sporulation regulatory protein SpoIIID from Bacillus subtilis activates and represses transcription by both mother-cell-specific forms of RNA polymerase. J Mol Biol 243, 425–436, 10.1006/jmbi.1994.1670 (1994). [DOI] [PubMed] [Google Scholar]
  38. Steil L., Serrano M., Henriques A. O. & Volker U. Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology 151, 399–420, 10.1099/mic.0.27493-0 (2005). [DOI] [PubMed] [Google Scholar]
  39. Qu N. et al. [Transcriptional regulation of exosporium basal layer structural gene exsB in Bacillus thuringiensis by SigmaK and GerE]. Wei sheng wu xue bao = Acta microbiologica Sinica 53, 241–248 (2013). [PubMed] [Google Scholar]
  40. Ichikawa H., Halberg R. & Kroos L. Negative regulation by the Bacillus subtilis GerE protein. J Biol Chem 274, 8322–8327 (1999). [DOI] [PubMed] [Google Scholar]
  41. Costa T., Steil L., Martins L. O., Volker U. & Henriques A. O. Assembly of an oxalate decarboxylase produced under sigmaK control into the Bacillus subtilis spore coat. Journal of bacteriology 186, 1462–1474 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Kuwana R., Takamatsu H. & Watabe K. Expression, localization and modification of YxeE spore coat protein in Bacillus subtilis. Journal of biochemistry 142, 681–689, 10.1093/jb/mvm179 (2007). [DOI] [PubMed] [Google Scholar]
  43. Takamatsu H., Imamura D., Kuwana R. & Watabe K. Expression of yeeK during Bacillus subtilis sporulation and localization of YeeK to the inner spore coat using fluorescence microscopy. Journal of bacteriology 191, 1220–1229, 10.1128/JB.01269-08 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Moody K. L. et al. Processing, assembly and localization of a Bacillus anthracis spore protein. Microbiology 156, 174–183, 10.1099/mic.0.033407-0 (2010). [DOI] [PubMed] [Google Scholar]
  45. Zhang J., Fitz-James P. C. & Aronson A. I. Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. Journal of bacteriology 175, 3757–3766 (1993). [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang J., Ichikawa H., Halberg R., Kroos L. & Aronson A. I. Regulation of the transcription of a cluster of Bacillus subtilis spore coat genes. Journal of molecular biology 240, 405–415, 10.1006/jmbi.1994.1456 (1994). [DOI] [PubMed] [Google Scholar]
  47. Lai E. M. et al. Proteomic analysis of the spore coats of Bacillus subtilis and Bacillus anthracis. Journal of bacteriology 185, 1443–1454 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Driks A. Bacillus subtilis spore coat. Microbiology and molecular biology reviews : MMBR 63, 1–20 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Bergman N. H. et al. Transcriptional profiling of the Bacillus anthracis life cycle in vitro and an implied model for regulation of spore formation. Journal of bacteriology 188, 6092–6100, 10.1128/JB.00723-06 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Liu G. et al. Complete genome sequence of Bacillus thuringiensis subsp. kurstaki strain HD73. Genome announcements 1, e0008013, 10.1128/genomeA.00080-13 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Dower W. J., Miller J. F. & Ragsdale C. W. High efficiency transformation of E. coli by high voltage electroporation. Nucleic acids research 16, 6127–6145 (1988). [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Lereclus D., Arantes O., Chaufaux J. & Lecadet M. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS microbiology letters 51, 211–217 (1989). [DOI] [PubMed] [Google Scholar]
  53. Du L. et al. Identification of the promoter in the intergenic region between orf1 and cry8Ea1 controlled by sigma H factor. Applied and environmental microbiology 78, 4164–4168, 10.1128/AEM.00622-12 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yang J. et al. Transcriptional regulation and characteristics of a novel N-acetylmuramoyl-L-alanine amidase gene involved in Bacillus thuringiensis mother cell lysis. Journal of bacteriology 195, 2887–2897, 10.1128/JB.00112-13 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Li R. et al. PolY, a transcriptional regulator with ATPase activity, directly activates transcription of polR in polyoxin biosynthesis in Streptomyces cacaoi. Molecular microbiology 75, 349–364, 10.1111/j.1365-2958.2009.06968.x (2010). [DOI] [PubMed] [Google Scholar]
  56. Zianni M., Tessanne K., Merighi M., Laguna R. & Tabita F. R. Identification of the DNA bases of a DNase I footprint by the use of dye primer sequencing on an automated capillary DNA analysis instrument. Journal of biomolecular techniques : JBT 17, 103–113 (2006). [PMC free article] [PubMed] [Google Scholar]
  57. Agaisse H. & Lereclus D. Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Molecular microbiology 13, 97–107 (1994). [DOI] [PubMed] [Google Scholar]
  58. Schaeffer P., Millet J. & Aubert J. P. Catabolic repression of bacterial sporulation. Proceedings of the National Academy of Sciences of the United States of America 54, 704–711 (1965). [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Perchat S. et al. A cell-cell communication system regulates protease production during sporulation in bacteria of the Bacillus cereus group. Molecular microbiology 82, 619–633, 10.1111/j.1365-2958.2011.07839.x (2011). [DOI] [PubMed] [Google Scholar]
  60. Thompson B. M., Waller L. N., Fox K. F., Fox A. & Stewart G. C. The BclB glycoprotein of Bacillus anthracis is involved in exosporium integrity. Journal of bacteriology 189, 6704–6713, 10.1128/JB.00762-07 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep19005-s1.pdf (1MB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES