IncI1 Plasmids Carrying Various bla_CTX-M Genes Contribute to Ceftriaxone Resistance in Salmonella enterica Serovar Enteritidis in China

Abstract

Resistance to extended-spectrum β-lactams in Salmonella, in particular, in serotypes such as Salmonella enterica serovar Enteritidis that are frequently associated with clinical infections, is a serious public health concern. In this study, phenotypic characterization of 433 clinical S. Enteritidis strains obtained from a nationwide collection of the Chinese Center for Disease Control and Prevention during the period from 2005 to 2010 depicted a trend of increasing resistance to ceftriaxone from 2008 onwards. Seventeen (4%) of the strains were found to be resistant to ceftriaxone, 7% were found to be resistant to ciprofloxacin, and 0.7% were found to be resistant to both ciprofloxacin and ceftriaxone. Most of the ceftriaxone-resistant S. Enteritidis strains (15/17) were genetically unrelated and originated from Henan Province. The complete sequence of an IncI1 plasmid, pSE115, which belonged to a novel sequence type, was obtained. This 87,255-bp IncI1 plasmid was found to harbor a bla_CTX-M-14 gene in a novel multidrug resistance region (MRR) within the tra locus. Although the majority of strains were also found to contain conjugative IncI1 plasmids with a size similar to that of pSE115 (∼90 kb) and harbor a variety of bla_CTX-M group 1 and group 9 elements, the novel MRR site at the tra locus in pSE115 was not detectable in the other IncI1 plasmids. The findings from this study show that cephalosporin resistance in S. Enteritidis strains collected in China was mainly due to the dissemination of IncI1 plasmids carrying bla_CTX-M, resembling the situation in which IncI1 plasmids serve as major vectors of bla_CTX-M variants in other members of the Enterobacteriaceae.

INTRODUCTION

Foodborne salmonellosis is a serious public health problem worldwide and the leading cause of foodborne illnesses in many countries, including the United States and China. Salmonella enterica subsp. enterica serovar Enteritidis is the most common serotype that causes human infections in China (1). In the United States, S. Enteritidis has become the most clinically prevalent serotype since 2008, accounting for ∼17% of all salmonellosis cases (2). In other countries, the prevalence of S. Enteritidis is even higher, reaching >50% in European countries and Hong Kong (1, 3–5). Most importantly, S. Enteritidis is commonly associated with outbreaks of foodborne illness and is sometimes associated with invasive Salmonella infections worldwide (6). Although antimicrobials are usually not required for the treatment of salmonellosis due to the self-limiting nature of this disease, they can be lifesaving in patients with invasive infections, which normally occur in children, the elderly, and immunocompromised patients (7).

Ceftriaxone and ciprofloxacin are the key drugs of choice for the treatment of invasive Salmonella infections in humans (8). Resistance to ceftriaxone or other extended-spectrum β-lactams is usually due to the production of extended-spectrum β-lactamases (ESBLs), among which the CTX-M-type ESBLs are largely responsible for cephalosporin resistance in Salmonella (9). To date, over 150 CTX-M variants have been discovered, with CTX-M-9, CTX-M-14, and CTX-M-15 being the most commonly reported (10–12). CTX-M-type ESBLs are usually carried by transmissible plasmids, which tend to disseminate among members of the Enterobacteriaceae (13). Among the various plasmid types, IncI1 plasmids have been the most frequently associated with CTX-M-type ESBL carriage (14).

A considerable number of studies have been conducted to elucidate the cephalosporin resistance mechanisms in S. Enteritidis in different countries. Nevertheless, information on the prevalence and mechanisms of resistance in China is still not available. In this work, strains from a nationwide collection of clinical S. Enteritidis strains from the Chinese Center for Disease Control and Prevention (CDC) were characterized for their susceptibilities to different antibiotics, in particular, cephalosporins, and the underlying mechanisms of resistance concerned. Our data revealed that resistance to ceftriaxone in S. Enteritidis is mainly due to the transmission of various IncI1 conjugative plasmids carrying various bla_CTX-M genes. Our data corroborate the results of recent studies that these types of plasmids have the potential to be spread in Salmonella and other bacterial species (15, 16). Future studies should focus on monitoring the transmission routes and assessing the dissemination potential of such mobile resistance elements in China and other parts of the world.

MATERIALS AND METHODS

Bacterial strain isolation and serotyping.

Human clinical S. Enteritidis strains were collected from the State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention (ICDC), Beijing, People's Republic of China. Nonduplicate human clinical Salmonella strains were collected from stool and blood samples from hospital patients in eight participating cities and provinces in the People's Republic of China, namely, the provinces of Guangdong, Guangxi, Henan, Fujian, and Sichuan and the cities of Beijing, Shanghai, and Chongqing, during the period from 2005 to 2010. All confirmed Salmonella strains were sent to laboratories of the Chinese CDC for further characterization. All strains were serotyped according to the Kauffmann-White scheme. A portion of the S. Enteritidis strains was randomly selected from the collection and characterized in this study.

Antimicrobial susceptibility testing.

Confirmed S. Enteritidis strains were subjected to antimicrobial susceptibility test using the agar dilution method, and the results were interpreted according to the CLSI guidelines (17). Thirteen antimicrobials were tested: ampicillin, cefotaxime, ceftazidime, ceftriaxone, amoxicillin-clavulanic acid, sulfamethoxazole, gentamicin, tetracycline, chloramphenicol, ciprofloxacin, nalidixic acid, trimethoprim, and streptomycin. Escherichia coli strains ATCC 25922 and ATCC 35218, Enterococcus faecalis strain ATCC 29212, Staphylococcus aureus strain ATCC 29213, and Pseudomonas aeruginosa strain ATCC 27853 were used for quality control.

ESBL screening and PCR mapping.

The existence of ESBL determinants among the test strains was also determined, using PCR assays that target genes encoding different classes of β-lactamases, as previously described (18). Full-length CTX-M β-lactamase genes were amplified by the use of specific primers and sequenced to determine their specific type. The genetic environments of bla_CTX-M group 1 and 9 variants on various plasmids were determined by PCR mapping with reference to popular transposon structures. The primers used are listed in Table 1.

TABLE 1.

Primers used in this study

Primer	Sequence (5′–3′)	Target
CTX-M-1-F	ATGGTTAAAAAATCACTGCG	blaCTX-M group 1, full length
CTX-M-1-R	TTACAAACCGTCGGTGAC
CTX-M-2-F	ATGATGACTCAGAGCATTCGC	blaCTX-M group 2, full length
CTX-M-2-R	TCAGAAACCGTGGGTTACGAT
CTX-M-9-F	ATTCAGAGCTCATGGTGACAAAGAGAGTGC	blaCTX-M group 9, full length
CTX-M-9-R	TAGTAGGATCCTTACAGCCCTTCGGCGATG
Tnp-CTX-F	ATTTTGGGCGAATGAAGCCG	ISEcp1-blaCTX-M group 1
Tnp-CTX-R	GCTAAGCTCAGCCAGTGACA
CTX-ORF-F	TTGTTAGGAAGTGTGCCGCT	blaCTX-M group 1 Δorf477
CTX-ORF-R	CGGAAGGAGAACCAGGAACC
IS26-F	GCCCAGCGGCCATTGACCTT	IS26-iroN
IroN-R	TCTCTGCCGGGAGGGGATTT
IroN-F	AAGCCCGGACTGACCATCGG	iroN-IS903
IS903-R	AGCAGGCGGGCAAAGTCGGT
IS903-F	GTCAACTGCCAGATGCAGCTT	IS903-blaCTX-M group 9
CTX-9-R	GGGTCATGCGCTGGGCGAAA
CTX-9-F	GCGCATGGTGACAAAGAGAGTGCAA	blaCTX-M group 9-ISEcp1
ISEcp-R	CTGCAAACGGTGCTGCGGAA

Conjugation experiments.

A conjugation experiment was carried out as previously described using the sodium azide-resistant E. coli J53 strain as the recipient (19). Briefly, overnight cultures of donor and recipient strains were mixed (1:3) and collected on a filter, and the mixture was subjected to overnight incubation at 37°C on a blood agar plate. The mixture was then spread on double-selective blood agar plates containing ceftriaxone (2 μg/ml) and sodium azide (100 μg/ml).

Salmonella strains and plasmid typing.

The clonal relationship between the Salmonella strains that were concurrently resistant to both ceftriaxone and nalidixic acid was examined by pulsed-field gel electrophoresis (PFGE) according to the PulseNet PFGE protocol for salmonella (20). An S1 nuclease PFGE (S1-PFGE) was conducted to determine the size of large plasmids extracted from 15 Salmonella strains with concurrent resistance to both ceftriaxone and nalidixic acid, as well as the corresponding transconjugants. Briefly, DNA embedded in agarose was digested with S1 nuclease (New England BioLabs) at 37°C for 1 h. The restriction fragments were separated by electrophoresis for 18 h in 0.5 Tris-borate-EDTA buffer at 14°C using a contour-clamped homogeneous electric field Mapper electrophoresis system (Bio-Rad, Hercules, CA) with pulse times of 2.16 to 63.8 s. A phage lambda PFGE ladder (New England BioLabs) was used as a DNA size marker. The gels were stained with GelRed, and DNA bands were visualized with UV transillumination (Bio-Rad). The major incompatibility (Inc) groups of plasmids from transconjugants and parental strains were identified by the PCR-based replicon typing (PBRT) method (21). Plasmid multilocus sequence typing (pMLST) was performed on the IncI1 plasmids extracted from the transconjugants as previously described (http://pubmlst.org/plasmid/) (22).

Plasmid sequencing.

Plasmid pSE115 was extracted from transconjugant E. coli J53/SE115T using a Qiagen plasmid midiprep kit. Plasmid sequencing was performed on a PacBio RS II single-molecule real-time sequencer at the Wuhan Institute of Biotechnology, People's Republic of China. Reads were assembled by the hierarchical genome assembly process (HGAP) of SMRT analysis software. The plasmid sequence was annotated by use of the Rapid Annotation Using Subsystem Technology (RAST) server, followed by manual review using the BLASTP program.

Nucleotide sequence accession numbers.

The complete sequence of pSE115 has been deposited in the GenBank database under accession number KT868530.

RESULTS AND DISCUSSION

Antimicrobial resistance and clonal relationship of clinical S. Enteritidis strains.

A total of 3,710 Salmonella strains were collected from the State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention (ICDC), of China during the period from 2005 to 2010. Among these 3,710 strains, 1,057 were S. Enteritidis, accounting for 28% of all Salmonella strains. In this study, 433 S. Enteritidis strains were randomly selected for further characterization. Antimicrobial susceptibility tests on these S. Enteritidis strains depicted a striking 94% rate of resistance to nalidixic acid, with both the MIC₅₀ and MIC₉₀ being greater than 128 μg/ml; however, only 7% (31/433) of the test strains were resistant to ciprofloxacin (MICs ≧ 1 μg/ml), and the majority of these strains exhibited a ciprofloxacin MIC of between 1 μg/ml and 2 μg/ml. Our data are consistent with the common findings in the literature, in that ciprofloxacin-resistant S. Enteritidis strains with ciprofloxacin MICs of greater than 4 μg/ml were rare. On the other hand, 17 (4%) of the strains exhibited resistance to ceftriaxone (MICs ≧ 4 μg/ml) and other extended-spectrum cephalosporins. The rate of resistance to other antimicrobials is shown in Table 2. All 17 ceftriaxone-resistant S. Enteritidis strains were also resistant to nalidixic acid, and 3 of these strains also exhibited resistance to ciprofloxacin. These strains also exhibited a slightly higher rate of resistance to other antimicrobials, such as ciprofloxacin (18%), trimethoprim (24%), and gentamicin (18%), compared to the overall resistance rate of the S. Enteritidis strains tested (Table 2). The prevalence of ceftriaxone-resistant S. Enteritidis was found to have increased significantly since 2008. Out of the 17 ceftriaxone-resistant S. Enteritidis strains, only 3 were detected before 2008 (in 2005 and 2007) and 14 were detected in or after the year 2008. Our data indicate that the majority of these 17 S. Enteritidis strains were isolated from stool samples from patients, whereas the 2 strains which exhibited resistance to both ciprofloxacin and ceftriaxone were isolated from blood samples (Table 2). The clonal relationship among the 17 ceftriaxone-resistant S. Enteritidis strains was determined by PFGE. The strains produced unique PFGE patterns, except for two pairs of strains, S. Enteritidis strains 395 and 389 and strains 412 and 413, which were found to exhibit identical PFGE patterns (Fig. 1). These findings suggest that the spread of ceftriaxone- and nalidixic acid-resistant strains was not due to the expansion of a single clone.

TABLE 2.

Antimicrobial resistance profiles of S. Enteritidis strains

Antimicrobial	Breakpoint (μg/ml)	MIC (μg/ml)		% resistance
		50%	90%	All strains (n = 433)	CROa-resistant strains (n = 17)
Ampicillin	≧32	>128	>128	42	100
Amoxicillin-clavulanic acid (Augmentin)	≧32/16	1/0.5	8/4	1	12
Cefotaxime	≧4	≦0.06	0.25	4	100
Ceftazidime	≧16	0.12	0.25	2	35
Ceftriaxone	≧4	≦0.06	0.25	4	100
Chloramphenicol	≧32	4	16	6	18
Gentamicin	≧16	0.5	64	11	18
Streptomycin		4	>128	34	24
Nalidixic acid	≧32	>128	>128	94	100
Ciprofloxacin	≧4	0.12	0.5	7	18
Sulfamethoxazole	≧512	128	>1024	36	35
Tetracycline	≧16	2	>64	21	32
Trimethoprim	≧16	0.25	2	2	24

^aCRO, ceftriaxone.

FIG 1.

PFGE patterns of 15 ceftriaxone- and quinolone-resistant S. Enteritidis clinical strains.

Transmission of IncI1 plasmids carrying CTX-M variants contributed to the increasing prevalence of ceftriaxone resistance in S. Enteritidis.

The cellular basis of ceftriaxone resistance in 17 S. Enteritidis strains was investigated. The ESBL gene bla_CTX-M-14 was detectable in 12 strains, bla_CTX-M-79 was found to be present in 2 strains, and bla_CTX-M-15, bla_CTX-M-24, and bla_CTX-M-101 were recoverable from one strain each (Table 3). The bla_CTX-M-79 and bla_CTX-M-101 elements each differed from bla_CTX-M-15 by a single nucleotide polymorphism (SNP); likewise, bla_CTX-M-24 differed from bla_CTX-M-14 by one SNP; these three bla_CTX-M variants are reported for the first time in Salmonella. No other ESBL genes were detectable in these strains. A conjugation experiment showed that 15 out of the 17 S. Enteritidis strains were able to transfer their ESBL-carrying plasmids to E. coli recipient strain J53 (Table 3). The S1-PFGE data showed that the S. Enteritidis strains harbored plasmids ranging from ∼30 to 260 kb in size, with the majority carrying two plasmids with sizes of ∼48 kb and 90 kb, respectively (Table 3). S. Enteritidis strains 395 and 389, which exhibited identical PFGE profiles, had different plasmid profiles (Fig. 1 and 2). S. Enteritidis 395 harbored three plasmids of ∼48, 100, and 160 kb in size, with the ∼100-kb plasmid being an IncI1-Iγ-type conjugative plasmid, whereas strain 389 harbored only two plasmids of ∼48 and 95 kb in size.

TABLE 3.

Characteristics of S. Enteritidis strains and the corresponding transconjugants^a

S. Enteritidis strain	MIC (μg/ml)			Non-β-lactam resistance profile	β-Lactamase	Inc plasmid replicon(s) (IncI1 ST)	Approximate plasmid size(s)b (kb)
	CIP	CRO	CEF
86	0.25	≧128	2	NAL-GEN-SUL	CTX-M-14	I1-Iγ	30, 100, 110
86 TC	<0.025	32	1	GEN	CTX-M-14	I1-Iγ (ST162)	100
115	0.25	≧128	4	NAL-SUL	CTX-M-14	I1-Iγ, FIIA	48, 90
115 TC	<0.025	32	1		CTX-M-14	I1-Iγ (new ST)	90
134	0.1	≧128	4	NAL	CTX-M-14	I1-Iγ, FIIA	48, 90
134 TC	<0.025	32	1		CTX-M-14	I1-Iγ (new ST)	90
154	1	≧128	32	NAL	CTX-M-14	I1-Iγ, FIIA	48, 90
154 TC	<0.025	32	8		CTX-M-14	I1-Iγ (ND)	90
329	0.1	≧128	4	NAL	CTX-M-14	I1-Iγ, FIIA	48, 90
329 TC	<0.025	16	1		CTX-M-14	I1-Iγ (ST166)	90
380	2	≧128	4	NAL-CIP- GEN-SUL-TRI	CTX-M-14	HI2, FIIA	210, 260
380 TC	<0.025	32	2	SUL	CTX-M-14	FIIA	260
389	0.1	≧128	4	NAL-GEN	CTX-M-14	I1-Iγ, FIIA	48, 90
389 TC	<0.025	32	1		CTX-M-14	I1-Iγ (ST162)	90
395	0.1	≧128	4	NAL-GEN	CTX-M-14	I1-Iγ, FIIA	48, 100,160
395 TC	<0.025	32	2	GEN	CTX-M-14	I1-Iγ (ST162)	100
407	0.1	≧128	4	NAL-GEN	CTX-M-14	I1-Iγ, FIIA	48, 90
407 TC	<0.025	32	1		CTX-M-14	I1-Iγ (ND)	90
92	0.25	≧128	16	NAL-SUL-TET	CTX-M-15	I1-Iγ, FIIA	48, 90
92 TC	<0.025	≧128	4		CTX-M-15	I1-Iγ (ST16)	90
435	0.1	≧128	16	NAL	CTX-M-15	I1-Iγ, FIIA	30, 48, 90
435 TC	<0.025	64	4		CTX-M-15	I1-Iγ (ND)	90
111	0.1	≧128	1	NAL	CTX-M-24	F	48
111 TC	<0.025	64	1		CTX-M-24	F	48
166	0.1	≧128	≧64	NAL	CTX-M-79	I1-Iγ, FIIA	30, 48, 90
166 TC	<0.025	64	64		CTX-M-79	I1-Iγ (ST167)	90
451	1	≧128	32	NAL-GEN-SUL	CTX-M-79	I1-Iγ, FIIA	30, 50, 75
451 TC	<0.025	64	4		CTX-M-79	I1-Iγ (ST16)	75
118	0.1	≧128	64	NAL-SUL	CTX-M-101	I1-Iγ, FIIA	48, 90
118 TC	<0.025	≧128	32		CTX-M-101	I1-Iγ (ST16)	90
413	0.25	≧128	8	NAL-SUL-TRI	CTX-M-14	L/M, FIIA	ND
412	0.25	≧128	8	NAL-SUL-TRI	CTX-M-14	L/M, FIIA	ND

^aTC, transconjugant; CIP, ciprofloxacin; CRO, ceftriaxone; CEF, ceftazidime; NAL, nalidixic acid; GEN, gentamicin; SUL, sulfamethoxazole; TRI, trimethoprim; ND, not determined.

^bThe plasmid size was estimated by S1-PFGE.

FIG 2.

Plasmid profiles of representative S. Enteritidis strains and transconjugants determined by S1-PFGE. Transmissible plasmids from S. Enteritidis and transconjugants (T) are highlighted. ^, 87-kb plasmid sequenced in this study; *, ∼90-kb IncI1-Iγ-type conjugative plasmid; +, ∼100-kb IncI1-Iγ-type conjugative plasmid; #, ∼260-kb IncFIIA conjugative plasmid.

Only a single conjugative plasmid was detectable in each of the 15 transconjugants, 10 of which contained an ∼90-kb plasmid that was responsible for the ESBL resistance phenotype. These ∼90-kb plasmids were found to carry the bla_CTX-M-14 genes (6 strains), followed by bla_CTX-M-15 (2 strains), bla_CTX-M-79 (1 strain), and bla_CTX-M-101 (1 strain) (Table 3). Plasmid replicon typing was performed on plasmids recovered from both the parental strains and the transconjugants. Most of the S. Enteritidis strains carried IncFIIA and IncI1-Iγ-type plasmids, followed by IncHI2-, IncF-, and IncL/M-type plasmids, whereas all but two transconjugants carried IncI1-Iγ-type plasmids. These two strains, namely, the S. Enteritidis strain 380 and 111 transconjugants, were found to contain an ∼260-kb IncFIIA-type plasmid and an ∼48-kb IncF-type plasmid, respectively. The IncFIIA plasmids are known to harbor virulence factors and are often recoverable from S. Enteritidis strains. Our findings suggest that incorporation of the bla_CTX-M-14 gene may result in the formation of a resistance-virulence plasmid; similar findings have also recently been reported in other studies (23, 24).

The ∼90-kb plasmids detected in 10 transconjugants were confirmed to be IncI1-Iγ-type plasmids. In addition, IncI1-Iγ-type conjugative plasmids with sizes of ∼75 kb (1 plasmid) and ∼100 kb (2 plasmids) were also detectable in transconjugants. Studies from different regions of the world also reported the presence of IncI1 plasmids carrying bla_CTX-M-14 and other bla_CTX-M variants in Salmonella (22, 25, 26). Interestingly, the size of some of these plasmids (∼90 kb) was similar to the size of plasmids recoverable from the S. Enteritidis strains tested in this study. Importantly, such plasmids were also present in S. Enteritidis and S. enterica strains of other serovars isolated from both diarrheal patients and farm animals (27, 28). In order to determine whether the IncI1 conjugative plasmids in this study were identical, pMLST was performed to determine the subtypes of those plasmids. For the five IncI1 plasmids harboring the bla_CTX-M-1-group ESBLs (CTX-M-15, -24, -79, and -101), three were found to belong to sequence type (ST) 16 (ST16), one was found to belong to ST167, and one was found to be untypeable (Table 3). For the eight IncI1 plasmids carrying the bla_CTX-M-9-group ESBLs (CTX-M-14), two each were found to belong to ST162, ST166, a new ST type, and an untypeable ST (Table 3). The dominance of ST16 in IncI1 plasmids, which carry the bla_CTX-M-1-group ESBLs, corroborated the strain profiles in the pMLST database, in which all IncI1 plasmids of ST16 were found to be vectors of the bla_CTX-M-1-group ESBLs. Similarly, plasmids of ST162 and ST166 harbored bla_CTX-M-9-group ESBLs on the basis of the information in the database. Taken together, the data obtained in the current study, which suggested that conjugative IncI1 plasmids also play a role in facilitating the transmission of bla_CTX-M-type ESBLs among S. Enteritidis strains in China, are consistent with the data from studies from other regions.

Sequence of bla_CTX-M-14-carrying IncI1 plasmid pSE115.

The complete sequence of an ∼90-kb bla_CTX-M-14-carrying IncI1 plasmid harbored by S. Enteritidis strain 115 was obtained and was designated pSE115 (GenBank accession number KT868530). The plasmid was 87,255 kb in length and had a GC content of 49.76%. Upon review of the annotation data, pSE115 was found to contain 127 open reading frames (ORFs) (Fig. 3). The core structures of IncI plasmids, including genes encoding the transfer protein (tra locus), the pilus formation protein (pil locus), the shufflon-specific DNA recombinase (rci), and the nikAB-trbABC region, were detectable in pSE115. BLASTN searches showed that pSE115 shared the highest level of homology (96% coverage, 99% identity) with pSKLX3330 (GenBank accession number KJ866866.1), a bla_CTX-M-55- plasmid carried by an E. coli strain isolated from a human urine sample. In addition, it also exhibited genetic similarity to several other plasmids, including the Klebsiella pneumoniae plasmid p628-CTXM (GenBank accession number KP987217.1), E. coli plasmids pEK204 (GenBank accession number EU935740.1) and pH1519-88 (GenBank accession number KJ484630.1), as well as a Shigella sonnei plasmid, pSH4469 (GenBank accession number KJ406378.1) (Fig. 3). Interestingly, unlike pSE115, which carries bla_CTX-M-14, all these plasmids were found to harbor bla_CTX-M group 1 variants. bla_CTX-M-14 was the only resistance gene carried by pSE115 and was linked to the transposable elements ISEcp1 upstream and a truncated IS903 downstream, resembling to some extent the genetic arrangement of the bla_CTX-M-9-group ESBL elements harbored by other plasmids (29). Remarkably, instead of being located between the replication initiation protein-encoding gene repZ and site-specific recombinase determinant resD, which is the hot spot of insertion of the multidrug resistance region (MRR) in other IncI1 plasmids, the ISEcp1-bla_CTX-M-14-ΔIS903 fragment of pSE115 was found to be located in the tra locus, where it was sophisticatedly inserted between the traG and traH genes (30). This novel insertion site for MRR has not been identified in other IncI1-bla_CTX-M plasmids.

FIG 3.

Complete map of pSE115 and its genetic similarity to other IncI1 plasmids. Comparison of the pSE115 sequence with the sequences of two other IncI1 plasmids, K. pneumoniae p628-CTXM (GenBank accession number KP987217.1) and Shigella sonnei pSH4469 (GenBank accession number KJ406378.1), was performed by BLAST analysis. Arrows, ORFs; green and dark green, genes associated with plasmid conjugative transfer and pilus formation, respectively; blue, the gene involved in the replication process; red, antimicrobial resistance-associated genes; yellow, genes associated with transposases and integrases. The degree of genetic similarity between the three plasmids is depicted by the shaded area, and a scale indicating the degree of similarity is at the bottom right. The ISEcp1-bla_CTX-M-14-IS903 fragment was inserted within the tra locus in pSE115.

On the basis of the genetic structure of pSE115, PCR mapping targeting a conserved region of IncI1 plasmids was performed on the remaining nine transconjugants that carried IncI1 plasmids, and it revealed that all nine IncI1 plasmids harbored the conserved regions, including repZ, nikA, nikB, pilO, and tra. In addition, the results indicated that none of the plasmids had their bla_CTX-M elements inserted at the same position at which they were inserted in pSE115 (data not shown). The association of bla_CTX-M genes with a variety of transposable elements, as in the case of pSE115, has frequently been reported in plasmids harbored by Enterobacteriaceae. To investigate the genetic environments surrounding the bla_CTX-M genes in other IncI1 plasmids recovered in this study, PCR mapping was performed on transconjugants using primers targeting frequently detectable transposon structures. Four strains which expressed bla_CTX-M group 1 ESBLs, namely, strains 92, 166, 118, and 451, were found to have their bla_CTX-M gene linked with the ISEcp1 element in the upstream region and a truncated orf477 in the downstream region (Fig. 4). In bla_CTX-M-9-group carriers, the typical ISEcp1-bla_CTX-M-14-IS903-iroN structure was detectable in four strains (S. Enteritidis strains 86, 329, 389, 395), whereas the loss of IS903 was observable in S. Enteritidis 134. ISEcp1 has been demonstrated to be the most commonly found insertion sequence associated with bla_CTX-M elements (31). Unlike bla_CTX-M group 1 genes, which are frequently associated with the deletion of orf477, bla_CTX-M group 9 elements are often linked with IS903 and iroN, although the lack of IS903 and/or the iroN element downstream of the bla_CTX-M-9-group genes, as in the case of pSE115 and S. Enteritidis 134, has been previously reported (29, 32). Based on the results presented above, we confirmed that the MRR insertion site in pSE115 was unique and not shared any of the other IncI1 plasmids. Taken together, our data suggest that ceftriaxone resistance in S. Enteritidis in China is mainly due to the dissemination of IncI1 plasmids carrying bla_CTX-M- ESBLs.

FIG 4.

Genetic environment of bla_CTX-M ESBLs in conjugative IncI1 plasmids. (A) Genetic arrangement of bla_CTX-M-1-group ESBLs in four strains. (B) Genetic arrangement of bla_CTX-M-9-group ESBLs in six strains. The labels indicate the strain designation, its respective CTX-M variants, and the IncI1 plasmid ST and size. SE, S. Enteritidis.

Conclusion.

This study reports the antimicrobial susceptibility profiles of S. Enteritidis clinical isolates collected in China. Most of the isolates were resistant to nalidixic acid, followed by ampicillin, sulfamethoxazole, and tetracycline. Seventeen S. Enteritidis strains which exhibited resistance to nalidixic acid and reduced susceptibility to ciprofloxacin were also resistant to ceftriaxone. Such a ceftriaxone resistance phenotype was found to be mediated by the bla_CTX-M group 1 and 9 ESBL determinants that are carried by conjugative IncI1 plasmids of different STs but that have a similar size of about 90 kb. Complete sequencing of one of the IncI1 plasmids revealed a novel MRR insertion site within the tra locus. This genetic arrangement has not been observed in other plasmids. Instead of the clonal expansion of resistant strains, the dissemination of bla_CTX-M-carrying IncI1 plasmids was found to contribute significantly to the increased prevalence of cephalosporin resistance in S. Enteritidis. In summary, the findings of this study reveal the molecular basis of cephalosporin resistance in S. Enteritidis in China and the transmission features of conjugative plasmids in clinical S. Enteritidis strains.