Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2016 Feb 5;82(4):1346–1352. doi: 10.1128/AEM.03704-15

pyrF as a Counterselectable Marker for Unmarked Genetic Manipulations in Treponema denticola

Kurni Kurniyati 1, Chunhao Li 1,
Editor: M A Elliot2
PMCID: PMC4751821  PMID: 26682856

Abstract

The pathophysiology of Treponema denticola, an oral pathogen associated with both periodontal and endodontic infections, is poorly understood due to its fastidious growth and recalcitrance to genetic manipulations. Counterselectable markers are instrumental in constructing clean and unmarked mutations in bacteria. Here, we demonstrate that pyrF, a gene encoding orotidine-5′-monophosphate decarboxylase, can be used as a counterselectable marker in T. denticola to construct marker-free mutants. T. denticola is susceptible to 5-fluoroorotic acid (5-FOA). To establish a pyrF-based counterselectable knockout system in T. denticola, the pyrF gene was deleted. The deletion conferred resistance to 5-FOA in T. denticola. Next, a single-crossover mutant was constructed by reintroducing pyrF along with a gentamicin resistance gene (aacC1) back into the chromosome of the pyrF mutant at the locus of choice. In this study, we chose flgE, a flagellar hook gene that is located within a large polycistronic motility gene operon, as our target gene. The obtained single-crossover mutant (named FlgEin) regained the susceptibility to 5-FOA. Finally, FlgEin was plated on solid agar containing 5-FOA. Numerous colonies of the 5-FOA-resistant mutant (named FlgEout) were obtained and characterized by PCR and Southern blotting analyses. The results showed that the flgE gene was deleted and FlgEout was free of selection markers (i.e., pyrF and aacC1). Compared to previously constructed flgE mutants that contain an antibiotic selection marker, the deletion of flgE in FlgEout has no polar effect on its downstream gene expression. The system developed here will provide us with a new tool for investigating the genetics and pathogenicity of T. denticola.

INTRODUCTION

Treponema denticola is an obligatory anaerobic and highly motile bacterium that is associated with human periodontitis (for a review, see references 13), which is a chronic inflammatory disease that damages the supporting connective tissues around the teeth and ultimately leads to tooth loss. The use of targeted mutagenesis followed by phenotypic characterizations in vitro and in vivo is a routine method for identifying bacterial virulence factors and elucidating their roles in bacterial pathogenicity. Due to its fastidious growth requirements, only a few virulence factors have been characterized in T. denticola (for a review, see references 4 and 5). During the last decade, although tremendous efforts have been devoted to the identification of genetic tools, only a few have been developed for the genetic manipulation of T. denticola (610). Even now, genetic manipulation (e.g., gene deletion) of T. denticola is still inefficient and cumbersome (7, 11). In addition, all of the current genetic tools for T. denticola are built upon positive selection by inserting an antibiotic resistance marker into a targeted gene on the chromosome (6, 8, 9, 12). The drawback of this method is that the insertion of an antibiotic resistance cassette often impairs downstream gene expression, particularly for a gene within a large polycistronic gene cluster. To precisely interpret the function of a targeted gene, the cognate mutant has to be genetically complemented by reintroducing the targeted gene either back into the chromosome or to the cells through a shuttle vector. However, T. denticola is not amenable to the introduction of exogenous genetic elements (e.g., shuttle vectors for trans-complementation), most likely due to its unique DNA modification systems (7, 11, 13). Despite the fact that several shuttle vectors have been developed, very few T. denticola mutants have been complemented to date (11, 1417).

Counterselectable markers have several advantages over positive selection using antibiotic resistance genes (18, 19). For example, they can create a marker-free clean deletion on chromosomes and introduce multiple deletions or mutations into the same bacterial strains. The introduction of deletions and mutations is particularly valuable when a bacterium (e.g., T. denticola) has very few positive-selection markers. URA3/PyrF (orotidine-5′-monophosphate [OMP] decarboxylase) converts OMP into UMP, a key step in de novo pyrimidine biosynthesis (20). If 5-fluoroorotic acid (5-FOA, an analog of pyrimidine) is present, it can be converted to 5-fluoroorotylidate (5-F-OMP) by PyrE (orotate phosphoribosyl-transferase) and then to 5-fluoro-UMP (5-F-UMP) by PyrF. 5-F-UMP is toxic, and its accumulation often leads to cell death (20, 21). Based on this feature, URA3-pyrF has been successfully used as a counterselectable marker for targeted mutagenesis in fungi (22), archaea (23), and bacteria (2426). T. denticola has a single copy of the pyrF gene and is susceptible to 5-FOA, which is indicative of its potential to use pyrF as a counterselectable marker in the spirochete (13, 27). The goal of this report is to explore this potential and establish a marker-free mutagenesis system in T. denticola using pyrF as a counterselectable marker.

MATERIALS AND METHODS

Bacterial strains, culture conditions, and oligonucleotide primers.

T. denticola ATCC 35405 (wild type) and a previously constructed flgE-ermF/AM insertion mutant were used in this study (8, 16). Cells were grown in tryptone-yeast extract-gelatin-volatile fatty acid-serum (TYGVS) medium at 37°C in an anaerobic chamber in the presence of 85% nitrogen, 10% carbon dioxide, and 5% hydrogen. T. denticola isogenic mutants were grown with the appropriate antibiotic(s), erythromycin (50 μg/ml), gentamicin (20 μg/ml), and/or 5-fluoroorotic acid (10 mM) (Thermo Scientific, Rockford, IL), for selective pressure as needed. Escherichia coli strain 5α (New England BioLabs, Ipswich, MA) was used for DNA cloning. The E. coli strains were cultivated in lysogeny broth (LB) supplemented with appropriate concentrations of antibiotics. The oligonucleotide primers for the PCR amplifications used in this study are listed in Table 1. These primers were synthesized by Integrated DNA Technologies (IDT) (Coralville, IA).

TABLE 1.

Oligonucleotide primers used in this study

Primer Sequence (5′–3′)a Notesb
P1 CTTGCGGCAACATCGGTTGC 5′ portion for pyrF inactivation (F)
P2 GAATATTTTATATTTTTGTTCATATTGGCGGTAAGTTTAGCCT 5′ portion for pyrF inactivation (R)
P3 ATGAACAAAAATATAAAATATTCTC Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (F)
P4 TTATTTCCTCCCGTTAAATAATAG Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (R)
P5 TATTTAACGGGAGGAAATAATCAGTTTTTAAAATCTTCAA 3′ portion for pyrF inactivation (F)
P6 GGGCAAGATTAATTTCTATC 3′ portion for pyrF inactivation (R)
P7 AACGTTAATCTCTTAAATATAATAAAT pyrF promoter, pCounter (F)
P8 GTTTTAAGGAGAAGTATAATTTAAAAACTGATGTTGTTTA pyrF promoter, pCounter (R)
P9 TAAACAACATCAGTTTTTAAATTATACTTCTCCTTAAAAC tap1 promoter, pCounter (F)
P10 AACGTTTTAGGTGGCGGTACTTGGGTC aacC1, pCounter (R)
P11 GACGTCCAAGTCAAACTTTTTCTGCT 5′ flanking region of flgE, pFlgEin (F)
P12 ATACCCTATATTATACCATAAATTATTGCCTCCTAATTGT 5′ flanking region of flgE, pFlgEin (R)
P13 ACAATTAGGAGGCAATAATTTATGGTATAATATAGGGTAT 3′ flanking region of flgE, pFlgEin (F)
P14 GACGTCAATTGCTTTTCTATCGGAAG 3′ flanking region of flgE, pFlgEin (R)
P15 GTTTACAACATGGGAAATTC 5′ flanking region of pyrF, PyrFmut PCR analysis (F)
P16 GAAGATAGAGAAAAAATGAC 3′ flanking region of pyrF, PyrFmut PCR analysis (R)
P17 CTATCGTTTCAAGTTCAAGAC flgE, FlgEin, and FlgEout PCR analysis and Southern blot probe (R)
P18 CATCACAGGGCGGAGATCTTC 5′ flanking region of flgE, FlgEin, and FlgEout PCR analysis (F)
P19 ATGATGAGATCATTATTTTCGG flgE, Southern blot probe (F)
P20 ATGAACTACATCGACTTATTAAAAAC pyrF, Southern blot probe (F)
P21 TGTTGTTTA TTG CCG TCT CG pyrF, Southern blot probe (R)
P22 ATGTTACGCAGCAGCAACGATG aacC1, Southern blot probe (F)
P23 TTAGGTGGCGGTACTTGGGTC aacC1, Southern blot probe (R)
a

Underlined sequences are engineered restriction sites for DNA cloning.

b

F, forward; R, reverse.

Construction of a vector for deletion of pyrF.

The pyrF::ermB vector was designed to delete the entire open reading frame of the pyrF gene (tde2110) and replace it with a modified erythromycin resistance cassette (ermB) (9). This vector was constructed by a two-step PCR, as illustrated in Fig. 1A. The upstream flanking region of pyrF and ermB were PCR amplified with primer pairs P1-P2 and P3-P4, respectively, and then fused together using primers P1 and P4, generating fragment 1. The downstream region of pyrF was PCR amplified with primers P5 and P6 and then fused to fragment 1 by PCR using primers P1 and P6, generating pyrF::ermB. The obtained DNA fragment was cloned into the pGEM-T Easy vector (Promega, Madison, WI). The primers used here are listed in Table 1.

FIG 1.

FIG 1

Diagrams illustrating the vectors of pyrF::ermB and pFlgEin. (A) pyrF::ermB was constructed by two-step PCR and used for in-frame replacement of the pyrF gene with the ermB cassette. (B) Plasmid pFlgEin was constructed to reintroduce the pyrF gene back into the chromosome targeted to the flgE gene. The pyrF gene and aacC1 were ligated by PCR. The resulting fragment was cloned into pGEM-T vector at the AclI site within the ampicillin resistance gene, yielding the pCounter vector. The upstream (US′) and downstream (DS′) regions of flgE were amplified and fused by two-step PCR. The resulting fragment was cloned into pCounter at the SpeI and SphI sites, creating the pFlgEin vector. The arrows represent the relative positions and orientations of the PCR primers, which are described in Table 1. MCR, multiple cloning region; ermB, erythromycin resistance cassette; aacC1, gentamicin resistance cassette.

Construction of a suicide plasmid for deletion of flgE using pyrF as a counterselectable marker.

The pFlgEin plasmid (Fig. 1B) was used to delete the flgE gene, utilizing the pyrF gene as a counterselectable marker. This vector was constructed by two-step PCR and DNA cloning. The pyrF gene (along with its upstream promoter sequence) and a previously constructed gentamicin resistance cassette (aacC1) (12) were PCR amplified with primer pairs P7-P8 and P9-P10, respectively, and then fused together using primers P7 and P10, generating the pyrF-aacC1 fragment. The resulting fragment was cloned into the pGEM-T Easy vector. The cloned pyrF-aacC1 fragment was then released by AclI digestion and reinserted into the ampicillin resistance gene in the pGEM-T Easy vector at the same site, yielding the pCounter vector. To target the flgE gene, its upstream (US′) and downstream (DS′) flanking regions were PCR amplified with primer pairs P11-P12 and P13-P14, respectively, and then fused together using primers P11 and P14, generating a US′-DS′ fragment. The resulting fragment was cloned into the pGEM-T Easy vector. The cloned US′-DS′ fragment was then released by SphI and SpeI from the plasmid and inserted into the pCounter vector at the same sites, yielding the pFlgEin vector (Fig. 1B). The primers used in this study are listed in Table 1.

Preparation of T. denticola competent cells and transformations.

The preparation of T. denticola competent cells, transformation, and cell plating were carried out as previously described, with some modifications (28). Briefly, to prepare the competent cells, 50 ml of late-logarithmic-phase T. denticola cultures (108 cells/ml) was centrifuged at 8,000 × g and 4°C for 10 min. The harvested cells were washed four times with ice-cold 15% glycerol containing 50 mM CaCl2 (washing buffer) and then resuspended in 0.5 ml of ice-cold washing buffer. For transformation, 80 μl of competent cells was mixed with 10 μg of either the linearized pyrF::ermB vector or the circular suicide plasmid pFlgEin. The cells were incubated on ice for 10 min, at 50°C for 1 min, and on ice again for 5 min. After the incubations, the cells were immediately inoculated into 10 ml of TYGVS medium. After 2 days of incubation, the cells were plated on TYGVS medium containing 0.75% SeaPlaque agarose with appropriate antibiotics for positive selection. Bacterial colonies on the plates were visible after 5 to 7 days of incubation. The resultant antibiotic-resistant colonies were first screened by PCR. The selected positive clones were further confirmed by Southern blotting, as described below.

Southern blotting.

Southern blotting was carried out as previously described (7, 10). Briefly, total genomic DNA from T. denticola strains was prepared using the ArchivePure DNA purification kit (5 PRIME, Gaithersburg, MD). The purified genomic DNA was digested with either AclI or HindIII, separated on a 1.0% agarose gel, and then transferred to Hybond-N+ membranes (GE Healthcare, Buckinghamshire, United Kingdom). To prepare DNA probes, pyrF (892 bp), flgE (1,392 bp), aacC1 (534 bp), and ermB (738 bp) were amplified by PCR. The resultant PCR products were purified and labeled with digoxigenin (DIG) using the DIG-High Prime DNA labeling and detection starter kit I (Roche Diagnostics, Mannheim, Germany). DNA labeling, hybridization, and detection were carried out according to the manufacturer's protocol.

Measuring T. denticola growth rates and resistance to 5-FOA.

To measure the growth rates, 5 μl of the late-logarithmic-phase T. denticola cultures (108 cells/ml) was inoculated into 5 ml of TYGVS medium with or without 10 mM 5-FOA (27). T. denticola cells in the cultures were enumerated every 24 h or 48 h using a Petroff-Hausser counting chamber (Hausser Scientific, Horsham, PA). Each growth curve is representative of at least three independent cultures, and the results are represented as mean cell numbers ± standard errors of the means (SEM). To test 5-FOA resistance, the late-logarithmic-phase T. denticola cultures (108 cells/ml) were streaked on TYGVS medium containing 0.75% agarose with or without 10 mM 5-FOA and incubated for 5 days.

Western blotting.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting were carried out as previously described (16, 29). For Western blotting, T. denticola cells were harvested in the late-logarithmic phase (∼108 cells/ml). Equal amounts of whole-cell lysates (1 to 5 μg) were separated on SDS-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes. The immunoblots were probed with specific antibodies against T. denticola FlgE and DnaK and E. coli MotB (a gift from the late Robert Macnab at Yale University). The antibodies against T. denticola flagellar hook protein FlgE and DnaK were recently raised in rats (our unpublished data). Immunoblots were developed using a horseradish peroxidase-conjugated secondary antibody with an enhanced chemiluminescence (ECL) luminol assay, and signals were quantified using the Molecular Imager ChemiDoc XRS system with the Image Lab software (Bio-Rad Laboratories), as previously described (16).

Infection studies in mice.

A previously documented mouse skin abscess model was used to assess the virulence of T. denticola (16, 30). For the animal studies, 6- to 8-week-old C57BL/6 mice (Jackson Laboratory, Bar Harbor, ME) were used. Each mouse (4 mice per bacterial strain) received a single subcutaneous injection of 100 μl of bacterial suspension (∼109 cells) on its posterior dorsolateral surface. After the injection, the animals were monitored for symptoms of infection and virulence on a daily basis for a total of 10 days. The diameters of the observed abscesses were measured with a caliper gauge. Each abscess was measured at least three times from different angles, and average sizes were calculated (area = πr2, where r is the radius). The significance of the difference between different experimental groups was evaluated with an unpaired Student t test (P < 0.01). All animal experimentation was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (40). The animal protocol was approved by the SUNY Buffalo Institutional Animal Care and Use Committee (permit no. ORB 23068Y).

RESULTS AND DISCUSSION

Strategy of constructing a pyrF-based gene knockout system in T. denticola.

pyrF-based counterselectable gene knockout systems have successfully been applied to yeast (22), archaea (23), and some bacterial species (2426). In these systems, a wild-type strain is often susceptible to 5-FOA and the deletion of pyrF confers resistance to 5-FOA. Next, a single-crossover mutant (often referred to as a pop-in mutant) is constructed by reintroducing the pyrF gene along with an antibiotic resistance marker back into the mutant chromosome at a targeted gene. Finally, the pop-in mutant is plated to screen for 5-FOA-resistant colonies, from which the pyrF gene, the antibiotic resistance marker, and the targeted gene are excised through allelic exchange recombination, creating a clean marker-free mutant (often called a pop-out mutant). A similar strategy was adopted for T. denticola, as illustrated in Fig. 2. Here, a pyrF deletion mutant (PyrFmut) was first constructed. Next, the flgE gene was selected as a target for reintroducing the pyrF gene back into the chromosome of PyrFmut to create pop-in mutants (FlgEin) and subsequent pop-out mutants (FlgEout). The rationale for choosing the flgE gene as a target is that the function of this gene has been well characterized (6, 8, 14). The location of flgE in a large motility gene operon (31, 32) will also help test the advantage of this new gene knockout system in terms of avoiding potential polar effects on downstream genes, a common issue of previous gene knockout methods based on positive selection in T. denticola.

FIG 2.

FIG 2

Schematic diagram of a pyrF-based knockout system in T. denticola. PyrFmut was first constructed as described in Materials and Methods and used as a parental strain to construct the mutant FlgEin, in which pyrF-aacC1 was inserted into the chromosome at the flgE locus via single-crossover recombination. The resulting mutant was grown in the presence of 5-FOA to screen for the FlgEout mutant, in which the inserted pyrF-aacC1 along with the flgE gene were excised by double-crossover recombination at the US′/US and DS′/DS regions. The phenotypes of these mutants are labeled. 5-FOAR, 5-FOA resistant; 5-FOAs, 5-FOA susceptible; ErmR, erythromycin resistant; GenR, gentamicin resistant; Gens, gentamicin susceptible.

Isolation and characterization of the PyrFmut mutant.

To delete the pyrF gene (tde2110) in frame, the pyrF::ermB vector was constructed (Fig. 1A), linearized, and transformed into T. denticola strain ATCC 35405 (wild type), as described in Materials and Methods. After 5 days of incubation, approximately 50 erythromycin-resistant colonies appeared on the agar plates. Twelve colonies were picked and screened for the presence of ermB and the absence of pyrF by PCR analysis. PyrFmut, one of those positive colonies, was further confirmed by PCR using two primers (P15 and P16) at the flanking regions of pyrF and two primers (P3 and P4) that are specific to ermB (Fig. 3A). PCRs detected two 1.7-kb products in the mutant but not in the wild type (Fig. 3B), indicating that the pyrF gene was deleted and replaced with ermB, as expected. In the TYGVS medium, PyrFmut grew at the same rate as the wild type (Fig. 3C), indicating that T. denticola might have a salvage pathway to acquire pyrimidine and that the deletion of pyrF has no impact on its growth in vitro. In the presence of 10 mM 5-FOA, the growth of the wild type was completely inhibited but that of PyrFmut was not (Fig. 3D). The mutant grew normally and reached the same cell density as in the medium without 5-FOA. These results indicate that T. denticola is susceptible to 5-FOA and that the deletion of pyrF confers resistance to 5-FOA.

FIG 3.

FIG 3

Characterization of the PyrFmut mutant by PCR analysis and growth curves. (A) Diagram showing the PCR analysis of PyrFmut. Primers P15 and P16 locate at the flanking regions of pyrF; primers P3 and P4 locate within the ermB cassette. The numbers are the predicted sizes of the PCR products generated by the primers. (B) Agarose (1%) gel electrophoresis of the PCR products stained with ethidium bromide. The primers are labeled. The numbers represent DNA ladders (in kilobases). (C and D) Growth curves of the wild type (WT) and PyrFmut in TYGVS medium without (C) and with (D) 10 mM 5-FOA. Cell counting was repeated in triplicate with at least three independent samples. The results are expressed as the means ± standard errors of the means (SEM).

Isolation of pop-in and pop-out mutants.

To reintroduce the pyrF gene back into the chromosome of PyrFmut at the flgE locus, the pFlgEin plasmid (Fig. 1B) was constructed and transformed into PyrFmut, as described above. Of note, pFlgEin is a suicide plasmid that cannot replicate in T. denticola, and it was utilized to create single-crossover mutations. After 5 days of incubation, >100 clones appeared on the agar plates in the presence of both erythromycin and gentamicin. Twelve colonies were selected and subjected to PCR to detect the presence of the aacC1 and pyrF genes. One of positive colonies was further characterized by PCR using two pairs of primers: P7 and P10, which are specific to pyrF and aacC1, and P17 and P18, which are specific to the flgE gene and its downstream region. If the suicide plasmid is integrated into the chromosome at the flgE locus via a single-crossover recombination event, a 1.9-kb fragment (pyrF-aacC1) should be detected by P7 and P10 and a 2.4-kb band should be detected by P17 and P18 (Fig. 4A). As shown in Fig. 4B, the predicted products were detected by PCR, indicating that the pyrF gene was reintroduced back into the chromosome at the flgE locus, as expected. The resultant mutant was designated FlgEin.

FIG 4.

FIG 4

Characterization of FlgEin and FlgEout strains by PCR analysis. (A) Diagram showing the PCR analysis. The arrows represent the relative positions and orientations of these primers. The numbers are the predicted sizes of PCR products generated by the corresponding primers, as labeled. P7 is specific for the 5′ end of pyrF, P10 for the 3′ end of aacC1, P17 for the 5′ end of flgE, and P18 for the region downstream of flgE. The sequences of these primers are listed in Table 1. (B) Agarose (1%) gel electrophoresis of the PCR products stained with ethidium bromide. The primers are labeled. The numbers represent DNA ladders (in kilobases).

To screen pyrF pop-out mutants that are resistant to 5-FOA, the FlgEin mutant was first cultured in TYGVS medium, passaged for at least three generations in the presence of 5-FOA, and then plated on the 5-FOA agar plates. After 5 days of incubation, 12 5-FOA-resistant colonies were selected and screened by PCR for the absence of the pyrF gene. Four colonies were positive. One positive colony (designated FlgEout) was further characterized by PCR using the P7-P10 and P17-P18 primer pairs. While the pyrF-aacC1 (1.9 kb) and flgE (2.4 kb) fragments were detected in pFlgEin, neither were detected in FlgEout (Fig. 4B), indicating that the pFlgEin vector and flgE gene were excised from the mutant chromosome.

Characterization of FlgEin and FlgEout mutants.

To further characterize the obtained FlgEin and FlgEout mutants, Southern blotting and 5-FOA resistance analyses were conducted. For the Southern blots (Fig. 5A), the chromosomal DNA from the wild-type (lane 1), PyrFmut (lane 2), FlgEin (lane 3), and FlgEout (lane 4) strains was isolated, digested with either HindIII or AclI, and then blotted against four different DNA probes (pyrF, ermB, aacC1, and flgE). As shown in Fig. 5A, all four of the genes were detected in the FlgEin mutant (lanes 3), but only ermB was detected in the FlgEout mutant, further confirming that pyrF-aacC1 and the flgE gene were excised from the chromosome of FlgEout. Of note, for the flgE probe (Fig. 5A), the size of flgE detected in FlgEin was 5.2 kb (lane 3), which is bigger than that (4.0 kb) detected in the wild type (lane 1) and PyrFmut (lane 2), further confirming that FlgEin is a single-crossover mutant in which the pFlgEin vector was integrated into the chromosome of PyrFmut at the flgE locus. Consistent with the above-mentioned PCR results, for the pyrF probe (Fig. 5A), the pyrF gene was detected in the wild type (lane 1) and FlgEin (lane 3), but not in the PyrFmut (lane 2) and FlgEout mutants (lane 4). Of note, one pyrF fragment (Fig. 5A) was detected in the wild type (lane 1), but two fragments were detected in FlgEin (lane 3), which is consistent with the predicted size of the pyrF gene that was reintroduced into the chromosome at the flgE locus. Along with the presence of pyrF, 5-FOA resistance analysis showed that the wild type and the FlgEin mutant failed to grow on the plates containing 5-FOA, whereas the PyrFmut and FlgEout mutants did grow (Fig. 5B and C). These results further confirm the PCR and Southern blotting results, highlighting the feasibility of using the pyrF gene as a counterselectable marker in T. denticola.

FIG 5.

FIG 5

Characterization of the FlgEin and FlgEout strains by Southern blotting and 5-FOA resistance. For the Southern blots (A), the purified genomic DNA from the wild-type (lane 1), PyrFmut (lane 2), FlgEin (lane 3), and FlgEout (lane 4) strains was digested with either HindIII or AclI and probed with four different DIG-labeled DNA fragments (pyrF, ermB, aacC1, and flgE). For measuring 5-FOA resistance, the wild-type and mutant cells were streaked on TVGVS plates without (B) or with (C) 10 mM 5-FOA and incubated for 5 days.

Marker-free deletion of flgE has no polar effect on its downstream gene expression.

To further confirm the above-mentioned PCR and Southern blotting results, immunoblotting analysis was carried out to detect the FlgE protein among these mutants. The results showed that the expression of FlgE was completely abolished in FlgEout but not in the wild-type, PyrFmut, and FlgEin strains (Fig. 6A). Of note, T. denticola FlgE is crossed-linked and forms high-molecular-weight complexes (HMWC) (14, 33). In Fig. 6A, only a HMWC (>250 kDa) is shown. One of the advantages of counterselectable mutagenesis is that it can avoid a potential polar effect on the expression of genes that are downstream of a targeted gene. To examine if this is also the case for the pyrF-based counterselectable knockout system that we developed, the expression of motB, a gene downstream of flgE (31, 32), was measured by Western blotting. Compared to that in the wild type, the level of MotB was reduced approximately 40% in ΔflgE (Fig. 6B, lane 5), a mutant that was previously constructed via allelic exchange recombination (8), which indicates that the insertion of erm impaired the expression of motB. In contrast, the level of MotB in the FlgEout mutant (lane 4) remained unchanged from that in the wild type (lane 1), indicating that the deletion of flgE using pyrF as a counterselectable marker has no polar effect on the expression of motB. Of note, only a trace of MotB was detected in the FlgEin mutant (lane 3), indicating that insertion of the pFlgEin vector at the flgE locus blocked the expression of motB due to a polar effect. Collectively, these results demonstrate that this newly developed method is able to create marker-free mutants in which the previously observed polar effect can be avoided or minimized.

FIG 6.

FIG 6

Western blotting of the FlgEin and FlgEout strains. Whole-cell lysates were subjected to SDS-PAGE, transferred to a PVDF membrane, and probed against T. denticola FlgE antibody (αFlgE) (A) and E. coli MotB antibody (αMotB) (B). T. denticola DnaK antibody (αDnaK) was used as an internal control. MotB and DnaK signals were quantified using the Molecular Imager ChemiDoc XRS system with the Image Lab software (Bio-Rad).

Deletion of pyrF has no impact on the virulence of T. denticola.

There is a concern that the deletion of pyrF may affect pyrimidine biosynthesis, which in turn would impair T. denticola virulence and survival in vivo. If this were the case, it would limit the application of this newly developed method for the study of T. denticola pathogenicity. To address this concern, the impact of pyrF on T. denticola virulence was measured using a previously established mouse skin abscess model (30). For this study, C57BL/6 mice received a single subcutaneous injection of 100 μl of bacterial suspension (∼109 cells) on their posterior dorsolateral surfaces. Ten days after the injections, the mice were sacrificed and the induced skin abscesses were measured. Demarcated subcutaneous abscesses were observed in all of the infected mice, and the average size of the skin lesions (± standard deviation) induced by PyrFmut (37.5 ± 3.6 mm2, n = 4) was similar (P = 0.536, unpaired Student t test) to that induced by the wild type (41.1 ± 4.7 mm2, n = 4), indicating that the deletion of pyrF has no impact on the virulence of T. denticola, at least in the mouse model that was used.

Conclusion.

T. denticola is one of the most important periodontal pathogens and is notoriously difficult to be harnessed genetically (34, 35). In this report, we demonstrate the feasibility and advantage of using the pyrF gene as a counterselectable marker to create marker-free mutants in T. denticola. This method will provide us with a new genetic tool to study the pathophysiology of T. denticola. More importantly, it will also open a new avenue to develop a similar gene knockout system in other spirochetes and oral bacterial pathogens that have pyrF genes, such as Leptospira interrogans, a causative agent of leptospirosis (36), and red complex bacteria Porphyromonas gingivalis (37) and Tannerella forsythia (38), two keystone pathogens of periodontitis (3, 39).

ACKNOWLEDGMENT

This research was supported by Public Health Service grant DE023080 to C. Li.

REFERENCES

  • 1.Ellen RP, Galimanas VB. 2005. Spirochetes at the forefront of periodontal infections. Periodontol 2000 38:13–32. doi: 10.1111/j.1600-0757.2005.00108.x. [DOI] [PubMed] [Google Scholar]
  • 2.Holt SC, Ebersole JL. 2005. Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: the “red complex,” a prototype polybacterial pathogenic consortium in periodontitis. Periodontol 2000 38:72–122. doi: 10.1111/j.1600-0757.2005.00113.x. [DOI] [PubMed] [Google Scholar]
  • 3.Darveau RP. 2010. Periodontitis: a polymicrobial disruption of host homeostasis. Nat Rev Microbiol 8:481–490. doi: 10.1038/nrmicro2337. [DOI] [PubMed] [Google Scholar]
  • 4.Dashper SG, Seers CA, Tan KH, Reynolds EC. 2011. Virulence factors of the oral spirochete Treponema denticola. J Dent Res 90:691–703. doi: 10.1177/0022034510385242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fenno JC, McBride BC. 1998. Virulence factors of oral treponemes. Anaerobe 4:1–17. doi: 10.1006/anae.1997.0131. [DOI] [PubMed] [Google Scholar]
  • 6.Li Y, Ruby J, Wu H. 2015. Kanamycin resistance cassette for genetic manipulation of Treponema denticola. Appl Environ Microbiol 81:4329–4338. doi: 10.1128/AEM.00478-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bian J, Li C. 2011. Disruption of a type II endonuclease (TDE0911) enables Treponema denticola ATCC 35405 to accept an unmethylated shuttle vector. Appl Environ Microbiol 77:4573–4578. doi: 10.1128/AEM.00417-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Li H, Ruby J, Charon N, Kuramitsu H. 1996. Gene inactivation in the oral spirochete Treponema denticola: construction of an flgE mutant. J Bacteriol 178:3664–3667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Goetting-Minesky MP, Fenno JC. 2010. A simplified erythromycin resistance cassette for Treponema denticola mutagenesis. J Microbiol Methods 83:66–68. doi: 10.1016/j.mimet.2010.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yang Y, Stewart PE, Shi X, Li C. 2008. Development of a transposon mutagenesis system in the oral spirochete Treponema denticola. Appl Environ Microbiol 74:6461–6464. doi: 10.1128/AEM.01424-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Godovikova V, Goetting-Minesky MP, Shin JM, Kapila YL, Rickard AH, Fenno JC. 2015. A modified shuttle plasmid facilitates expression of a flavin mononucleotide-based fluorescent protein in Treponema denticola ATCC 35405. Appl Environ Microbiol 81:6496–6504. doi: 10.1128/AEM.01541-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bian J, Fenno JC, Li C. 2012. Development of a modified gentamicin resistance cassette for genetic manipulation of the oral spirochete Treponema denticola. Appl Environ Microbiol 78:2059–2062. doi: 10.1128/AEM.07461-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Seshadri R, Myers GS, Tettelin H, Eisen JA, Heidelberg JF, Dodson RJ, Davidsen TM, DeBoy RT, Fouts DE, Haft DH, Selengut J, Ren Q, Brinkac LM, Madupu R, Kolonay J, Durkin SA, Daugherty SC, Shetty J, Shvartsbeyn A, Gebregeorgis E, Geer K, Tsegaye G, Malek J, Ayodeji B, Shatsman S, McLeod MP, Smajs D, Howell JK, Pal S, Amin A, Vashisth P, McNeill TZ, Xiang Q, Sodergren E, Baca E, Weinstock GM, Norris SJ, Fraser CM, Paulsen IT. 2004. Comparison of the genome of the oral pathogen Treponema denticola with other spirochete genomes. Proc Natl Acad Sci U S A 101:5646–5651. doi: 10.1073/pnas.0307639101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chi B, Limberger RJ, Kuramitsu HK. 2002. Complementation of a Treponema denticola flgE mutant with a novel coumermycin A1-resistant T. denticola shuttle vector system. Infect Immun 70:2233–2237. doi: 10.1128/IAI.70.4.2233-2237.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Slivienski-Gebhardt LL, Izard J, Samsonoff WA, Limberger RJ. 2004. Development of a novel chloramphenicol resistance expression plasmid used for genetic complementation of a fliG deletion mutant in Treponema denticola. Infect Immun 72:5493–5497. doi: 10.1128/IAI.72.9.5493-5497.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kurniyati K, Zhang W, Zhang K, Li C. 2013. A surface-exposed neuraminidase affects complement resistance and virulence of the oral spirochaete Treponema denticola. Mol Microbiol 89:842–856. doi: 10.1111/mmi.12311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chauhan S, Kuramitsu HK. 2004. Sequence analysis of plasmid pTS1 isolated from oral spirochetes. Plasmid 51:61–65. doi: 10.1016/j.plasmid.2003.11.002. [DOI] [PubMed] [Google Scholar]
  • 18.Reyrat JM, Pelicic V, Gicquel B, Rappuoli R. 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect Immun 66:4011–4017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Drecktrah D, Douglas JM, Samuels DS. 2010. Use of rpsL as a counterselectable marker in Borrelia burgdorferi. Appl Environ Microbiol 76:985–987. doi: 10.1128/AEM.02172-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.O'Donovan GA, Neuhard J. 1970. Pyrimidine metabolism in microorganisms. Bacteriol Rev 34:278–343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Boeke JD, La Croute F, Fink GR. 1984. A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet 197:345–346. doi: 10.1007/BF00330984. [DOI] [PubMed] [Google Scholar]
  • 22.Staab JF, Sundstrom P. 2003. URA3 as a selectable marker for disruption and virulence assessment of Candida albicans genes. Trends Microbiol 11:69–73. doi: 10.1016/S0966-842X(02)00029-X. [DOI] [PubMed] [Google Scholar]
  • 23.Liu H, Han J, Liu X, Zhou J, Xiang H. 2011. Development of pyrF-based gene knockout systems for genome-wide manipulation of the archaea Haloferax mediterranei and Haloarcula hispanica. J Genet Genomics 38:261–269. doi: 10.1016/j.jgg.2011.05.003. [DOI] [PubMed] [Google Scholar]
  • 24.Tripathi SA, Olson DG, Argyros DA, Miller BB, Barrett TF, Murphy DM, McCool JD, Warner AK, Rajgarhia VB, Lynd LR, Hogsett DA, Caiazza NC. 2010. Development of pyrF-based genetic system for targeted gene deletion in Clostridium thermocellum and creation of a pta mutant. Appl Environ Microbiol 76:6591–6599. doi: 10.1128/AEM.01484-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Galvão TC, de Lorenzo V. 2005. Adaptation of the yeast URA3 selection system to Gram-negative bacteria and generation of a ΔbetCDE Pseudomonas putida strain. Appl Environ Microbiol 71:883–892. doi: 10.1128/AEM.71.2.883-892.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Knipfer N, Seth A, Shrader TE. 1997. Unmarked gene integration into the chromosome of Mycobacterium smegmatis via precise replacement of the pyrF gene. Plasmid 37:129–140. doi: 10.1006/plas.1997.1286. [DOI] [PubMed] [Google Scholar]
  • 27.Capone RF, Ning Y, Pakulis N, Alhazzazi T, Fenno JC. 2007. Characterization of Treponema denticola pyrF encoding orotidine-5′-monophosphate decarboxylase. FEMS Microbiol Lett 268:261–267. doi: 10.1111/j.1574-6968.2006.00589.x. [DOI] [PubMed] [Google Scholar]
  • 28.Li H, Kuramitsu HK. 1996. Development of a gene transfer system in Treponema denticola by electroporation. Oral Microbiol Immunol 11:161–165. doi: 10.1111/j.1399-302X.1996.tb00352.x. [DOI] [PubMed] [Google Scholar]
  • 29.Bian J, Shen H, Tu Y, Yu A, Li C. 2011. The riboswitch regulates a thiamine pyrophosphate ABC transporter of the oral spirochete Treponema denticola. J Bacteriol 193:3912–3922. doi: 10.1128/JB.00386-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kesavalu L, Walker SG, Holt SC, Crawley RR, Ebersole JL. 1997. Virulence characteristics of oral treponemes in a murine model. Infect Immun 65:5096–5102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Stamm LV, Bergen HL. 1999. Molecular characterization of a flagellar (fla) operon in the oral spirochete Treponema denticola ATCC 35405. FEMS Microbiol Lett 179:31–36. doi: 10.1111/j.1574-6968.1999.tb08703.x. [DOI] [PubMed] [Google Scholar]
  • 32.Limberger RJ, Slivienski LL, Izard J, Samsonoff WA. 1999. Insertional inactivation of Treponema denticola tap1 results in a nonmotile mutant with elongated flagellar hooks. J Bacteriol 181:3743–3750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Miller KA, Motaleb MA, Liu J, Hu B, Caimano MJ, Miller MR, Charon NW. 2014. Initial characterization of the FlgE hook high molecular weight complex of Borrelia burgdorferi. PLoS One 9:e98338. doi: 10.1371/journal.pone.0098338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Socransky SS, Haffajee AD. 2005. Periodontal microbial ecology. Periodontol 2000 38:135–187. doi: 10.1111/j.1600-0757.2005.00107.x. [DOI] [PubMed] [Google Scholar]
  • 35.Kuramitsu HK. 2003. Molecular genetic analysis of the virulence of oral bacterial pathogens: an historical perspective. Crit Rev Oral Biol Med 14:331–344. doi: 10.1177/154411130301400504. [DOI] [PubMed] [Google Scholar]
  • 36.Ren SX, Fu G, Jiang XG, Zeng R, Miao YG, Xu H, Zhang YX, Xiong H, Lu G, Lu LF, Jiang HQ, Jia J, Tu YF, Jiang JX, Gu WY, Zhang YQ, Cai Z, Sheng HH, Yin HF, Zhang Y, Zhu GF, Wan M, Huang HL, Qian Z, Wang SY, Ma W, Yao ZJ, Shen Y, Qiang BQ, Xia Q C, Guo XK, Danchin A, Saint GI, Somerville RL, Wen YM, Shi MH, Chen Z, Xu J G, Zhao GP. 2003. Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing. Nature 422:888–893. doi: 10.1038/nature01597. [DOI] [PubMed] [Google Scholar]
  • 37.Nelson KE, Fleischmann RD, DeBoy RT, Paulsen IT, Fouts DE, Eisen JA, Daugherty SC, Dodson RJ, Durkin AS, Gwinn M, Haft DH, Kolonay JF, Nelson WC, Mason T, Tallon L, Gray J, Granger D, Tettelin H, Dong H, Galvin JL, Duncan MJ, Dewhirst FE, Fraser CM. 2003. Complete genome sequence of the oral pathogenic bacterium Porphyromonas gingivalis strain W83. J Bacteriol 185:5591–5601. doi: 10.1128/JB.185.18.5591-5601.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Friedrich V, Pabinger S, Chen T, Messner P, Dewhirst FE, Schäffer C. 2015. Draft genome sequence of Tannerella forsythia type strain ATCC 43037. Genome Announc 3(3):e00660-15. doi: 10.1128/genomeA.00660-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hajishengallis G, Darveau RP, Curtis MA. 2012. The keystone-pathogen hypothesis. Nat Rev Microbiol 10:717–725. doi: 10.1038/nrmicro2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.National Research Council. 2011. Guide for the care and use of laboratory animals, 8th ed. National Academies Press, Washington, DC. [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES