pyrF as a Counterselectable Marker for Unmarked Genetic Manipulations in Treponema denticola

Abstract

The pathophysiology of Treponema denticola, an oral pathogen associated with both periodontal and endodontic infections, is poorly understood due to its fastidious growth and recalcitrance to genetic manipulations. Counterselectable markers are instrumental in constructing clean and unmarked mutations in bacteria. Here, we demonstrate that pyrF, a gene encoding orotidine-5′-monophosphate decarboxylase, can be used as a counterselectable marker in T. denticola to construct marker-free mutants. T. denticola is susceptible to 5-fluoroorotic acid (5-FOA). To establish a pyrF-based counterselectable knockout system in T. denticola, the pyrF gene was deleted. The deletion conferred resistance to 5-FOA in T. denticola. Next, a single-crossover mutant was constructed by reintroducing pyrF along with a gentamicin resistance gene (aacC1) back into the chromosome of the pyrF mutant at the locus of choice. In this study, we chose flgE, a flagellar hook gene that is located within a large polycistronic motility gene operon, as our target gene. The obtained single-crossover mutant (named FlgEⁱⁿ) regained the susceptibility to 5-FOA. Finally, FlgEⁱⁿ was plated on solid agar containing 5-FOA. Numerous colonies of the 5-FOA-resistant mutant (named FlgE^out) were obtained and characterized by PCR and Southern blotting analyses. The results showed that the flgE gene was deleted and FlgE^out was free of selection markers (i.e., pyrF and aacC1). Compared to previously constructed flgE mutants that contain an antibiotic selection marker, the deletion of flgE in FlgE^out has no polar effect on its downstream gene expression. The system developed here will provide us with a new tool for investigating the genetics and pathogenicity of T. denticola.

INTRODUCTION

Treponema denticola is an obligatory anaerobic and highly motile bacterium that is associated with human periodontitis (for a review, see references 1–3), which is a chronic inflammatory disease that damages the supporting connective tissues around the teeth and ultimately leads to tooth loss. The use of targeted mutagenesis followed by phenotypic characterizations in vitro and in vivo is a routine method for identifying bacterial virulence factors and elucidating their roles in bacterial pathogenicity. Due to its fastidious growth requirements, only a few virulence factors have been characterized in T. denticola (for a review, see references 4 and 5). During the last decade, although tremendous efforts have been devoted to the identification of genetic tools, only a few have been developed for the genetic manipulation of T. denticola (6–10). Even now, genetic manipulation (e.g., gene deletion) of T. denticola is still inefficient and cumbersome (7, 11). In addition, all of the current genetic tools for T. denticola are built upon positive selection by inserting an antibiotic resistance marker into a targeted gene on the chromosome (6, 8, 9, 12). The drawback of this method is that the insertion of an antibiotic resistance cassette often impairs downstream gene expression, particularly for a gene within a large polycistronic gene cluster. To precisely interpret the function of a targeted gene, the cognate mutant has to be genetically complemented by reintroducing the targeted gene either back into the chromosome or to the cells through a shuttle vector. However, T. denticola is not amenable to the introduction of exogenous genetic elements (e.g., shuttle vectors for trans-complementation), most likely due to its unique DNA modification systems (7, 11, 13). Despite the fact that several shuttle vectors have been developed, very few T. denticola mutants have been complemented to date (11, 14–17).

Counterselectable markers have several advantages over positive selection using antibiotic resistance genes (18, 19). For example, they can create a marker-free clean deletion on chromosomes and introduce multiple deletions or mutations into the same bacterial strains. The introduction of deletions and mutations is particularly valuable when a bacterium (e.g., T. denticola) has very few positive-selection markers. URA3/PyrF (orotidine-5′-monophosphate [OMP] decarboxylase) converts OMP into UMP, a key step in de novo pyrimidine biosynthesis (20). If 5-fluoroorotic acid (5-FOA, an analog of pyrimidine) is present, it can be converted to 5-fluoroorotylidate (5-F-OMP) by PyrE (orotate phosphoribosyl-transferase) and then to 5-fluoro-UMP (5-F-UMP) by PyrF. 5-F-UMP is toxic, and its accumulation often leads to cell death (20, 21). Based on this feature, URA3-pyrF has been successfully used as a counterselectable marker for targeted mutagenesis in fungi (22), archaea (23), and bacteria (24–26). T. denticola has a single copy of the pyrF gene and is susceptible to 5-FOA, which is indicative of its potential to use pyrF as a counterselectable marker in the spirochete (13, 27). The goal of this report is to explore this potential and establish a marker-free mutagenesis system in T. denticola using pyrF as a counterselectable marker.

MATERIALS AND METHODS

Bacterial strains, culture conditions, and oligonucleotide primers.

T. denticola ATCC 35405 (wild type) and a previously constructed flgE-ermF/AM insertion mutant were used in this study (8, 16). Cells were grown in tryptone-yeast extract-gelatin-volatile fatty acid-serum (TYGVS) medium at 37°C in an anaerobic chamber in the presence of 85% nitrogen, 10% carbon dioxide, and 5% hydrogen. T. denticola isogenic mutants were grown with the appropriate antibiotic(s), erythromycin (50 μg/ml), gentamicin (20 μg/ml), and/or 5-fluoroorotic acid (10 mM) (Thermo Scientific, Rockford, IL), for selective pressure as needed. Escherichia coli strain 5α (New England BioLabs, Ipswich, MA) was used for DNA cloning. The E. coli strains were cultivated in lysogeny broth (LB) supplemented with appropriate concentrations of antibiotics. The oligonucleotide primers for the PCR amplifications used in this study are listed in Table 1. These primers were synthesized by Integrated DNA Technologies (IDT) (Coralville, IA).

TABLE 1.

Oligonucleotide primers used in this study

Primer	Sequence (5′–3′)a	Notesb
P1	CTTGCGGCAACATCGGTTGC	5′ portion for pyrF inactivation (F)
P2	GAATATTTTATATTTTTGTTCATATTGGCGGTAAGTTTAGCCT	5′ portion for pyrF inactivation (R)
P3	ATGAACAAAAATATAAAATATTCTC	Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (F)
P4	TTATTTCCTCCCGTTAAATAATAG	Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (R)
P5	TATTTAACGGGAGGAAATAATCAGTTTTTAAAATCTTCAA	3′ portion for pyrF inactivation (F)
P6	GGGCAAGATTAATTTCTATC	3′ portion for pyrF inactivation (R)
P7	AACGTTAATCTCTTAAATATAATAAAT	pyrF promoter, pCounter (F)
P8	GTTTTAAGGAGAAGTATAATTTAAAAACTGATGTTGTTTA	pyrF promoter, pCounter (R)
P9	TAAACAACATCAGTTTTTAAATTATACTTCTCCTTAAAAC	tap1 promoter, pCounter (F)
P10	AACGTTTTAGGTGGCGGTACTTGGGTC	aacC1, pCounter (R)
P11	GACGTCCAAGTCAAACTTTTTCTGCT	5′ flanking region of flgE, pFlgEin (F)
P12	ATACCCTATATTATACCATAAATTATTGCCTCCTAATTGT	5′ flanking region of flgE, pFlgEin (R)
P13	ACAATTAGGAGGCAATAATTTATGGTATAATATAGGGTAT	3′ flanking region of flgE, pFlgEin (F)
P14	GACGTCAATTGCTTTTCTATCGGAAG	3′ flanking region of flgE, pFlgEin (R)
P15	GTTTACAACATGGGAAATTC	5′ flanking region of pyrF, PyrFmut PCR analysis (F)
P16	GAAGATAGAGAAAAAATGAC	3′ flanking region of pyrF, PyrFmut PCR analysis (R)
P17	CTATCGTTTCAAGTTCAAGAC	flgE, FlgEin, and FlgEout PCR analysis and Southern blot probe (R)
P18	CATCACAGGGCGGAGATCTTC	5′ flanking region of flgE, FlgEin, and FlgEout PCR analysis (F)
P19	ATGATGAGATCATTATTTTCGG	flgE, Southern blot probe (F)
P20	ATGAACTACATCGACTTATTAAAAAC	pyrF, Southern blot probe (F)
P21	TGTTGTTTA TTG CCG TCT CG	pyrF, Southern blot probe (R)
P22	ATGTTACGCAGCAGCAACGATG	aacC1, Southern blot probe (F)
P23	TTAGGTGGCGGTACTTGGGTC	aacC1, Southern blot probe (R)

^aUnderlined sequences are engineered restriction sites for DNA cloning.

^bF, forward; R, reverse.

Construction of a vector for deletion of pyrF.

The pyrF::ermB vector was designed to delete the entire open reading frame of the pyrF gene (tde2110) and replace it with a modified erythromycin resistance cassette (ermB) (9). This vector was constructed by a two-step PCR, as illustrated in Fig. 1A. The upstream flanking region of pyrF and ermB were PCR amplified with primer pairs P₁-P₂ and P₃-P₄, respectively, and then fused together using primers P₁ and P₄, generating fragment 1. The downstream region of pyrF was PCR amplified with primers P₅ and P₆ and then fused to fragment 1 by PCR using primers P₁ and P₆, generating pyrF::ermB. The obtained DNA fragment was cloned into the pGEM-T Easy vector (Promega, Madison, WI). The primers used here are listed in Table 1.

FIG 1.

Diagrams illustrating the vectors of pyrF::ermB and pFlgEⁱⁿ. (A) pyrF::ermB was constructed by two-step PCR and used for in-frame replacement of the pyrF gene with the ermB cassette. (B) Plasmid pFlgEⁱⁿ was constructed to reintroduce the pyrF gene back into the chromosome targeted to the flgE gene. The pyrF gene and aacC1 were ligated by PCR. The resulting fragment was cloned into pGEM-T vector at the AclI site within the ampicillin resistance gene, yielding the pCounter vector. The upstream (US′) and downstream (DS′) regions of flgE were amplified and fused by two-step PCR. The resulting fragment was cloned into pCounter at the SpeI and SphI sites, creating the pFlgEⁱⁿ vector. The arrows represent the relative positions and orientations of the PCR primers, which are described in Table 1. MCR, multiple cloning region; ermB, erythromycin resistance cassette; aacC1, gentamicin resistance cassette.

Construction of a suicide plasmid for deletion of flgE using pyrF as a counterselectable marker.

The pFlgEⁱⁿ plasmid (Fig. 1B) was used to delete the flgE gene, utilizing the pyrF gene as a counterselectable marker. This vector was constructed by two-step PCR and DNA cloning. The pyrF gene (along with its upstream promoter sequence) and a previously constructed gentamicin resistance cassette (aacC1) (12) were PCR amplified with primer pairs P₇-P₈ and P₉-P₁₀, respectively, and then fused together using primers P₇ and P₁₀, generating the pyrF-aacC1 fragment. The resulting fragment was cloned into the pGEM-T Easy vector. The cloned pyrF-aacC1 fragment was then released by AclI digestion and reinserted into the ampicillin resistance gene in the pGEM-T Easy vector at the same site, yielding the pCounter vector. To target the flgE gene, its upstream (US′) and downstream (DS′) flanking regions were PCR amplified with primer pairs P₁₁-P₁₂ and P₁₃-P₁₄, respectively, and then fused together using primers P₁₁ and P₁₄, generating a US′-DS′ fragment. The resulting fragment was cloned into the pGEM-T Easy vector. The cloned US′-DS′ fragment was then released by SphI and SpeI from the plasmid and inserted into the pCounter vector at the same sites, yielding the pFlgEⁱⁿ vector (Fig. 1B). The primers used in this study are listed in Table 1.

Preparation of T. denticola competent cells and transformations.

The preparation of T. denticola competent cells, transformation, and cell plating were carried out as previously described, with some modifications (28). Briefly, to prepare the competent cells, 50 ml of late-logarithmic-phase T. denticola cultures (10⁸ cells/ml) was centrifuged at 8,000 × g and 4°C for 10 min. The harvested cells were washed four times with ice-cold 15% glycerol containing 50 mM CaCl₂ (washing buffer) and then resuspended in 0.5 ml of ice-cold washing buffer. For transformation, 80 μl of competent cells was mixed with 10 μg of either the linearized pyrF::ermB vector or the circular suicide plasmid pFlgEⁱⁿ. The cells were incubated on ice for 10 min, at 50°C for 1 min, and on ice again for 5 min. After the incubations, the cells were immediately inoculated into 10 ml of TYGVS medium. After 2 days of incubation, the cells were plated on TYGVS medium containing 0.75% SeaPlaque agarose with appropriate antibiotics for positive selection. Bacterial colonies on the plates were visible after 5 to 7 days of incubation. The resultant antibiotic-resistant colonies were first screened by PCR. The selected positive clones were further confirmed by Southern blotting, as described below.

Southern blotting.

Southern blotting was carried out as previously described (7, 10). Briefly, total genomic DNA from T. denticola strains was prepared using the ArchivePure DNA purification kit (5 PRIME, Gaithersburg, MD). The purified genomic DNA was digested with either AclI or HindIII, separated on a 1.0% agarose gel, and then transferred to Hybond-N⁺ membranes (GE Healthcare, Buckinghamshire, United Kingdom). To prepare DNA probes, pyrF (892 bp), flgE (1,392 bp), aacC1 (534 bp), and ermB (738 bp) were amplified by PCR. The resultant PCR products were purified and labeled with digoxigenin (DIG) using the DIG-High Prime DNA labeling and detection starter kit I (Roche Diagnostics, Mannheim, Germany). DNA labeling, hybridization, and detection were carried out according to the manufacturer's protocol.

Measuring T. denticola growth rates and resistance to 5-FOA.

To measure the growth rates, 5 μl of the late-logarithmic-phase T. denticola cultures (10⁸ cells/ml) was inoculated into 5 ml of TYGVS medium with or without 10 mM 5-FOA (27). T. denticola cells in the cultures were enumerated every 24 h or 48 h using a Petroff-Hausser counting chamber (Hausser Scientific, Horsham, PA). Each growth curve is representative of at least three independent cultures, and the results are represented as mean cell numbers ± standard errors of the means (SEM). To test 5-FOA resistance, the late-logarithmic-phase T. denticola cultures (10⁸ cells/ml) were streaked on TYGVS medium containing 0.75% agarose with or without 10 mM 5-FOA and incubated for 5 days.

Western blotting.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting were carried out as previously described (16, 29). For Western blotting, T. denticola cells were harvested in the late-logarithmic phase (∼10⁸ cells/ml). Equal amounts of whole-cell lysates (1 to 5 μg) were separated on SDS-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes. The immunoblots were probed with specific antibodies against T. denticola FlgE and DnaK and E. coli MotB (a gift from the late Robert Macnab at Yale University). The antibodies against T. denticola flagellar hook protein FlgE and DnaK were recently raised in rats (our unpublished data). Immunoblots were developed using a horseradish peroxidase-conjugated secondary antibody with an enhanced chemiluminescence (ECL) luminol assay, and signals were quantified using the Molecular Imager ChemiDoc XRS system with the Image Lab software (Bio-Rad Laboratories), as previously described (16).

Infection studies in mice.

A previously documented mouse skin abscess model was used to assess the virulence of T. denticola (16, 30). For the animal studies, 6- to 8-week-old C57BL/6 mice (Jackson Laboratory, Bar Harbor, ME) were used. Each mouse (4 mice per bacterial strain) received a single subcutaneous injection of 100 μl of bacterial suspension (∼10⁹ cells) on its posterior dorsolateral surface. After the injection, the animals were monitored for symptoms of infection and virulence on a daily basis for a total of 10 days. The diameters of the observed abscesses were measured with a caliper gauge. Each abscess was measured at least three times from different angles, and average sizes were calculated (area = πr², where r is the radius). The significance of the difference between different experimental groups was evaluated with an unpaired Student t test (P < 0.01). All animal experimentation was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (40). The animal protocol was approved by the SUNY Buffalo Institutional Animal Care and Use Committee (permit no. ORB 23068Y).

RESULTS AND DISCUSSION

Strategy of constructing a pyrF-based gene knockout system in T. denticola.

pyrF-based counterselectable gene knockout systems have successfully been applied to yeast (22), archaea (23), and some bacterial species (24–26). In these systems, a wild-type strain is often susceptible to 5-FOA and the deletion of pyrF confers resistance to 5-FOA. Next, a single-crossover mutant (often referred to as a pop-in mutant) is constructed by reintroducing the pyrF gene along with an antibiotic resistance marker back into the mutant chromosome at a targeted gene. Finally, the pop-in mutant is plated to screen for 5-FOA-resistant colonies, from which the pyrF gene, the antibiotic resistance marker, and the targeted gene are excised through allelic exchange recombination, creating a clean marker-free mutant (often called a pop-out mutant). A similar strategy was adopted for T. denticola, as illustrated in Fig. 2. Here, a pyrF deletion mutant (PyrF^mut) was first constructed. Next, the flgE gene was selected as a target for reintroducing the pyrF gene back into the chromosome of PyrF^mut to create pop-in mutants (FlgEⁱⁿ) and subsequent pop-out mutants (FlgE^out). The rationale for choosing the flgE gene as a target is that the function of this gene has been well characterized (6, 8, 14). The location of flgE in a large motility gene operon (31, 32) will also help test the advantage of this new gene knockout system in terms of avoiding potential polar effects on downstream genes, a common issue of previous gene knockout methods based on positive selection in T. denticola.

FIG 2.

Schematic diagram of a pyrF-based knockout system in T. denticola. PyrF^mut was first constructed as described in Materials and Methods and used as a parental strain to construct the mutant FlgEⁱⁿ, in which pyrF-aacC1 was inserted into the chromosome at the flgE locus via single-crossover recombination. The resulting mutant was grown in the presence of 5-FOA to screen for the FlgE^out mutant, in which the inserted pyrF-aacC1 along with the flgE gene were excised by double-crossover recombination at the US′/US and DS′/DS regions. The phenotypes of these mutants are labeled. 5-FOA^R, 5-FOA resistant; 5-FOA^s, 5-FOA susceptible; Erm^R, erythromycin resistant; Gen^R, gentamicin resistant; Gen^s, gentamicin susceptible.

Isolation and characterization of the PyrF^mut mutant.

To delete the pyrF gene (tde2110) in frame, the pyrF::ermB vector was constructed (Fig. 1A), linearized, and transformed into T. denticola strain ATCC 35405 (wild type), as described in Materials and Methods. After 5 days of incubation, approximately 50 erythromycin-resistant colonies appeared on the agar plates. Twelve colonies were picked and screened for the presence of ermB and the absence of pyrF by PCR analysis. PyrF^mut, one of those positive colonies, was further confirmed by PCR using two primers (P₁₅ and P₁₆) at the flanking regions of pyrF and two primers (P₃ and P₄) that are specific to ermB (Fig. 3A). PCRs detected two 1.7-kb products in the mutant but not in the wild type (Fig. 3B), indicating that the pyrF gene was deleted and replaced with ermB, as expected. In the TYGVS medium, PyrF^mut grew at the same rate as the wild type (Fig. 3C), indicating that T. denticola might have a salvage pathway to acquire pyrimidine and that the deletion of pyrF has no impact on its growth in vitro. In the presence of 10 mM 5-FOA, the growth of the wild type was completely inhibited but that of PyrF^mut was not (Fig. 3D). The mutant grew normally and reached the same cell density as in the medium without 5-FOA. These results indicate that T. denticola is susceptible to 5-FOA and that the deletion of pyrF confers resistance to 5-FOA.

FIG 3.

Characterization of the PyrF^mut mutant by PCR analysis and growth curves. (A) Diagram showing the PCR analysis of PyrF^mut. Primers P₁₅ and P₁₆ locate at the flanking regions of pyrF; primers P₃ and P₄ locate within the ermB cassette. The numbers are the predicted sizes of the PCR products generated by the primers. (B) Agarose (1%) gel electrophoresis of the PCR products stained with ethidium bromide. The primers are labeled. The numbers represent DNA ladders (in kilobases). (C and D) Growth curves of the wild type (WT) and PyrF^mut in TYGVS medium without (C) and with (D) 10 mM 5-FOA. Cell counting was repeated in triplicate with at least three independent samples. The results are expressed as the means ± standard errors of the means (SEM).

Isolation of pop-in and pop-out mutants.

To reintroduce the pyrF gene back into the chromosome of PyrF^mut at the flgE locus, the pFlgEⁱⁿ plasmid (Fig. 1B) was constructed and transformed into PyrF^mut, as described above. Of note, pFlgEⁱⁿ is a suicide plasmid that cannot replicate in T. denticola, and it was utilized to create single-crossover mutations. After 5 days of incubation, >100 clones appeared on the agar plates in the presence of both erythromycin and gentamicin. Twelve colonies were selected and subjected to PCR to detect the presence of the aacC1 and pyrF genes. One of positive colonies was further characterized by PCR using two pairs of primers: P₇ and P₁₀, which are specific to pyrF and aacC1, and P₁₇ and P₁₈, which are specific to the flgE gene and its downstream region. If the suicide plasmid is integrated into the chromosome at the flgE locus via a single-crossover recombination event, a 1.9-kb fragment (pyrF-aacC1) should be detected by P₇ and P₁₀ and a 2.4-kb band should be detected by P₁₇ and P₁₈ (Fig. 4A). As shown in Fig. 4B, the predicted products were detected by PCR, indicating that the pyrF gene was reintroduced back into the chromosome at the flgE locus, as expected. The resultant mutant was designated FlgEⁱⁿ.

FIG 4.

Characterization of FlgEⁱⁿ and FlgE^out strains by PCR analysis. (A) Diagram showing the PCR analysis. The arrows represent the relative positions and orientations of these primers. The numbers are the predicted sizes of PCR products generated by the corresponding primers, as labeled. P₇ is specific for the 5′ end of pyrF, P₁₀ for the 3′ end of aacC1, P₁₇ for the 5′ end of flgE, and P₁₈ for the region downstream of flgE. The sequences of these primers are listed in Table 1. (B) Agarose (1%) gel electrophoresis of the PCR products stained with ethidium bromide. The primers are labeled. The numbers represent DNA ladders (in kilobases).

To screen pyrF pop-out mutants that are resistant to 5-FOA, the FlgEⁱⁿ mutant was first cultured in TYGVS medium, passaged for at least three generations in the presence of 5-FOA, and then plated on the 5-FOA agar plates. After 5 days of incubation, 12 5-FOA-resistant colonies were selected and screened by PCR for the absence of the pyrF gene. Four colonies were positive. One positive colony (designated FlgE^out) was further characterized by PCR using the P₇-P₁₀ and P₁₇-P₁₈ primer pairs. While the pyrF-aacC1 (1.9 kb) and flgE (2.4 kb) fragments were detected in pFlgEⁱⁿ, neither were detected in FlgE^out (Fig. 4B), indicating that the pFlgEⁱⁿ vector and flgE gene were excised from the mutant chromosome.

Characterization of FlgEⁱⁿ and FlgE^out mutants.

To further characterize the obtained FlgEⁱⁿ and FlgE^out mutants, Southern blotting and 5-FOA resistance analyses were conducted. For the Southern blots (Fig. 5A), the chromosomal DNA from the wild-type (lane 1), PyrF^mut (lane 2), FlgEⁱⁿ (lane 3), and FlgE^out (lane 4) strains was isolated, digested with either HindIII or AclI, and then blotted against four different DNA probes (pyrF, ermB, aacC1, and flgE). As shown in Fig. 5A, all four of the genes were detected in the FlgEⁱⁿ mutant (lanes 3), but only ermB was detected in the FlgE^out mutant, further confirming that pyrF-aacC1 and the flgE gene were excised from the chromosome of FlgE^out. Of note, for the flgE probe (Fig. 5A), the size of flgE detected in FlgEⁱⁿ was 5.2 kb (lane 3), which is bigger than that (4.0 kb) detected in the wild type (lane 1) and PyrF^mut (lane 2), further confirming that FlgEⁱⁿ is a single-crossover mutant in which the pFlgEⁱⁿ vector was integrated into the chromosome of PyrF^mut at the flgE locus. Consistent with the above-mentioned PCR results, for the pyrF probe (Fig. 5A), the pyrF gene was detected in the wild type (lane 1) and FlgEⁱⁿ (lane 3), but not in the PyrF^mut (lane 2) and FlgE^out mutants (lane 4). Of note, one pyrF fragment (Fig. 5A) was detected in the wild type (lane 1), but two fragments were detected in FlgEⁱⁿ (lane 3), which is consistent with the predicted size of the pyrF gene that was reintroduced into the chromosome at the flgE locus. Along with the presence of pyrF, 5-FOA resistance analysis showed that the wild type and the FlgEⁱⁿ mutant failed to grow on the plates containing 5-FOA, whereas the PyrF^mut and FlgE^out mutants did grow (Fig. 5B and C). These results further confirm the PCR and Southern blotting results, highlighting the feasibility of using the pyrF gene as a counterselectable marker in T. denticola.

FIG 5.

Characterization of the FlgEⁱⁿ and FlgE^out strains by Southern blotting and 5-FOA resistance. For the Southern blots (A), the purified genomic DNA from the wild-type (lane 1), PyrF^mut (lane 2), FlgEⁱⁿ (lane 3), and FlgE^out (lane 4) strains was digested with either HindIII or AclI and probed with four different DIG-labeled DNA fragments (pyrF, ermB, aacC1, and flgE). For measuring 5-FOA resistance, the wild-type and mutant cells were streaked on TVGVS plates without (B) or with (C) 10 mM 5-FOA and incubated for 5 days.

Marker-free deletion of flgE has no polar effect on its downstream gene expression.

To further confirm the above-mentioned PCR and Southern blotting results, immunoblotting analysis was carried out to detect the FlgE protein among these mutants. The results showed that the expression of FlgE was completely abolished in FlgE^out but not in the wild-type, PyrF^mut, and FlgEⁱⁿ strains (Fig. 6A). Of note, T. denticola FlgE is crossed-linked and forms high-molecular-weight complexes (HMWC) (14, 33). In Fig. 6A, only a HMWC (>250 kDa) is shown. One of the advantages of counterselectable mutagenesis is that it can avoid a potential polar effect on the expression of genes that are downstream of a targeted gene. To examine if this is also the case for the pyrF-based counterselectable knockout system that we developed, the expression of motB, a gene downstream of flgE (31, 32), was measured by Western blotting. Compared to that in the wild type, the level of MotB was reduced approximately 40% in ΔflgE (Fig. 6B, lane 5), a mutant that was previously constructed via allelic exchange recombination (8), which indicates that the insertion of erm impaired the expression of motB. In contrast, the level of MotB in the FlgE^out mutant (lane 4) remained unchanged from that in the wild type (lane 1), indicating that the deletion of flgE using pyrF as a counterselectable marker has no polar effect on the expression of motB. Of note, only a trace of MotB was detected in the FlgEⁱⁿ mutant (lane 3), indicating that insertion of the pFlgEⁱⁿ vector at the flgE locus blocked the expression of motB due to a polar effect. Collectively, these results demonstrate that this newly developed method is able to create marker-free mutants in which the previously observed polar effect can be avoided or minimized.

FIG 6.

Western blotting of the FlgEⁱⁿ and FlgE^out strains. Whole-cell lysates were subjected to SDS-PAGE, transferred to a PVDF membrane, and probed against T. denticola FlgE antibody (αFlgE) (A) and E. coli MotB antibody (αMotB) (B). T. denticola DnaK antibody (αDnaK) was used as an internal control. MotB and DnaK signals were quantified using the Molecular Imager ChemiDoc XRS system with the Image Lab software (Bio-Rad).

Deletion of pyrF has no impact on the virulence of T. denticola.

There is a concern that the deletion of pyrF may affect pyrimidine biosynthesis, which in turn would impair T. denticola virulence and survival in vivo. If this were the case, it would limit the application of this newly developed method for the study of T. denticola pathogenicity. To address this concern, the impact of pyrF on T. denticola virulence was measured using a previously established mouse skin abscess model (30). For this study, C57BL/6 mice received a single subcutaneous injection of 100 μl of bacterial suspension (∼10⁹ cells) on their posterior dorsolateral surfaces. Ten days after the injections, the mice were sacrificed and the induced skin abscesses were measured. Demarcated subcutaneous abscesses were observed in all of the infected mice, and the average size of the skin lesions (± standard deviation) induced by PyrF^mut (37.5 ± 3.6 mm², n = 4) was similar (P = 0.536, unpaired Student t test) to that induced by the wild type (41.1 ± 4.7 mm², n = 4), indicating that the deletion of pyrF has no impact on the virulence of T. denticola, at least in the mouse model that was used.

Conclusion.

T. denticola is one of the most important periodontal pathogens and is notoriously difficult to be harnessed genetically (34, 35). In this report, we demonstrate the feasibility and advantage of using the pyrF gene as a counterselectable marker to create marker-free mutants in T. denticola. This method will provide us with a new genetic tool to study the pathophysiology of T. denticola. More importantly, it will also open a new avenue to develop a similar gene knockout system in other spirochetes and oral bacterial pathogens that have pyrF genes, such as Leptospira interrogans, a causative agent of leptospirosis (36), and red complex bacteria Porphyromonas gingivalis (37) and Tannerella forsythia (38), two keystone pathogens of periodontitis (3, 39).